Starting /dee2/code/volunteer_pipeline.sh SRR7804176 current disk space = 1540920266752 free memory = 1601501396 SRR7804176 SRAfilesize 4d9cc470bd51846519ca743406223a90 SRR7804176.sra SRR7804176.sra file validated SRR7804176 is paired end SRR7804176 is conventional basespace SRR7804176 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804176_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.21 37.0 37.0 37.0 37.0 37.0 2 36.328 37.0 37.0 37.0 37.0 37.0 3 36.3375 37.0 37.0 37.0 37.0 37.0 4 36.526 37.0 37.0 37.0 37.0 37.0 5 36.4925 37.0 37.0 37.0 37.0 37.0 6 36.4105 37.0 37.0 37.0 37.0 37.0 7 36.376 37.0 37.0 37.0 37.0 37.0 8 36.52 37.0 37.0 37.0 37.0 37.0 9 36.437 37.0 37.0 37.0 37.0 37.0 10-14 36.49810000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4586 37.0 37.0 37.0 37.0 37.0 20-24 36.472 37.0 37.0 37.0 37.0 37.0 25-29 36.423700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.3811 37.0 37.0 37.0 37.0 37.0 35-39 36.32770000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.304 37.0 37.0 37.0 37.0 37.0 45-49 36.24 37.0 37.0 37.0 37.0 37.0 50-54 36.2203 37.0 37.0 37.0 37.0 37.0 55-59 36.209500000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.1453 37.0 37.0 37.0 37.0 37.0 65-69 36.1207 37.0 37.0 37.0 37.0 37.0 70-74 36.03580000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.0262 37.0 37.0 37.0 37.0 37.0 80-84 36.0219 37.0 37.0 37.0 37.0 37.0 85-89 35.943 37.0 37.0 37.0 37.0 37.0 90-94 35.8662 37.0 37.0 37.0 37.0 37.0 95-99 35.8273 37.0 37.0 37.0 37.0 37.0 100-104 35.769800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7312 37.0 37.0 37.0 37.0 37.0 110-114 35.7376 37.0 37.0 37.0 37.0 37.0 115-119 35.5779 37.0 37.0 37.0 37.0 37.0 120-124 35.4658 37.0 37.0 37.0 37.0 37.0 125-129 35.4748 37.0 37.0 37.0 37.0 37.0 130-134 35.3843 37.0 37.0 37.0 34.6 37.0 135-139 35.259299999999996 37.0 37.0 37.0 27.4 37.0 140-144 35.3342 37.0 37.0 37.0 29.8 37.0 145-149 35.157799999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.531000000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 3.0 24 3.0 25 6.0 26 3.0 27 22.0 28 17.0 29 20.0 30 44.0 31 48.0 32 69.0 33 114.0 34 188.0 35 479.0 36 2756.0 37 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.255639097744364 12.882205513784461 10.050125313283207 34.81203007518797 2 25.45 16.575 33.725 24.25 3 21.575 23.925 23.75 30.75 4 26.450000000000003 28.225 19.475 25.85 5 25.95 30.825000000000003 21.175 22.05 6 20.5 31.374999999999996 23.65 24.474999999999998 7 16.35 20.45 40.875 22.325 8 20.125 21.025 27.224999999999998 31.624999999999996 9 20.1 19.25 30.825000000000003 29.825000000000003 10-14 23.71 25.264999999999997 24.205 26.82 15-19 23.330000000000002 24.285 25.11 27.275 20-24 24.505 24.0 24.665 26.83 25-29 23.830000000000002 24.435000000000002 24.92 26.815 30-34 23.895 24.175 24.654999999999998 27.275 35-39 24.26 23.995 24.529999999999998 27.215 40-44 24.145 24.560000000000002 24.3 26.995 45-49 23.925 23.835 24.86 27.38 50-54 24.65 23.78 23.97 27.6 55-59 25.245 24.065 23.845 26.845000000000002 60-64 24.975 23.53 24.044999999999998 27.450000000000003 65-69 24.825 24.21 23.79 27.175 70-74 25.25 23.599999999999998 23.77 27.38 75-79 24.9 24.115000000000002 23.865 27.12 80-84 25.535000000000004 23.625 24.095 26.745 85-89 25.235000000000003 23.055 24.765 26.945000000000004 90-94 24.86 23.835 23.69 27.615000000000002 95-99 25.14 23.674999999999997 24.395 26.790000000000003 100-104 25.005 23.52 23.905 27.57 105-109 25.564999999999998 23.044999999999998 23.9 27.49 110-114 25.564999999999998 22.975 24.395 27.065 115-119 25.7 23.064999999999998 23.605 27.63 120-124 25.455 23.05 23.685000000000002 27.810000000000002 125-129 25.915 23.515 23.61 26.96 130-134 26.19 23.005 23.365 27.439999999999998 135-139 25.480000000000004 22.98 23.885 27.655 140-144 26.355 22.58 23.86 27.205000000000002 145-149 25.629999999999995 23.580000000000002 23.085 27.705000000000002 150-151 26.75 22.35 23.1 27.800000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 2.5 28 2.0 29 2.5 30 7.0 31 10.5 32 13.5 33 17.0 34 24.0 35 36.0 36 38.5 37 49.5 38 64.5 39 79.5 40 98.0 41 109.5 42 128.0 43 137.0 44 145.5 45 150.0 46 148.0 47 154.5 48 146.5 49 147.5 50 147.0 51 139.0 52 141.5 53 142.0 54 141.0 55 147.5 56 145.5 57 121.5 58 100.5 59 97.0 60 95.0 61 84.5 62 76.5 63 76.5 64 82.5 65 72.5 66 61.5 67 67.0 68 62.0 69 47.0 70 41.0 71 42.0 72 39.0 73 30.5 74 21.5 75 12.5 76 12.0 77 9.5 78 4.5 79 6.5 80 5.0 81 2.0 82 2.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.05491868834977 88.2 2 5.305251932817915 9.950000000000001 3 0.5865102639296188 1.6500000000000001 4 0.053319114902692616 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.6000000000000001 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8374999999999999 0.0 0.0 0.0 0.0 132-133 0.9125000000000001 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 0.9875 0.0 0.0 0.0 0.0 138-139 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTCT 10 0.006830828 145.0 1 >>END_MODULE SRR7804176 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804176_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4245 37.0 37.0 37.0 37.0 37.0 2 36.256 37.0 37.0 37.0 37.0 37.0 3 36.2775 37.0 37.0 37.0 37.0 37.0 4 36.2595 37.0 37.0 37.0 37.0 37.0 5 36.348 37.0 37.0 37.0 37.0 37.0 6 36.246 37.0 37.0 37.0 37.0 37.0 7 36.0865 37.0 37.0 37.0 37.0 37.0 8 36.2955 37.0 37.0 37.0 37.0 37.0 9 36.312 37.0 37.0 37.0 37.0 37.0 10-14 36.221500000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.1594 37.0 37.0 37.0 37.0 37.0 20-24 36.11149999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.1005 37.0 37.0 37.0 37.0 37.0 30-34 36.125299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0025 37.0 37.0 37.0 37.0 37.0 40-44 36.0133 37.0 37.0 37.0 37.0 37.0 45-49 35.9319 37.0 37.0 37.0 37.0 37.0 50-54 35.908100000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.9306 37.0 37.0 37.0 37.0 37.0 60-64 35.824400000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.800200000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.7321 37.0 37.0 37.0 37.0 37.0 75-79 35.72710000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.5885 37.0 37.0 37.0 37.0 37.0 85-89 35.523199999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.498200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.4565 37.0 37.0 37.0 37.0 37.0 100-104 35.3998 37.0 37.0 37.0 37.0 37.0 105-109 35.402899999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.2625 37.0 37.0 37.0 34.6 37.0 115-119 35.153800000000004 37.0 37.0 37.0 29.8 37.0 120-124 35.1352 37.0 37.0 37.0 25.0 37.0 125-129 35.054899999999996 37.0 37.0 37.0 25.0 37.0 130-134 35.01219999999999 37.0 37.0 37.0 25.0 37.0 135-139 34.791 37.0 37.0 37.0 25.0 37.0 140-144 34.5799 37.0 37.0 37.0 25.0 37.0 145-149 34.543099999999995 37.0 37.0 37.0 25.0 37.0 150-151 33.87325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 5.0 16 6.0 17 2.0 18 2.0 19 4.0 20 6.0 21 3.0 22 13.0 23 14.0 24 10.0 25 10.0 26 8.0 27 9.0 28 15.0 29 20.0 30 32.0 31 44.0 32 69.0 33 117.0 34 248.0 35 725.0 36 2495.0 37 138.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.55 14.649999999999999 12.775 31.025000000000002 2 31.974999999999998 19.475 25.5 23.05 3 26.224999999999998 22.625 26.075 25.074999999999996 4 28.349999999999998 30.625000000000004 17.5 23.525 5 29.725 30.599999999999998 17.375 22.3 6 24.224999999999998 32.7 18.05 25.025 7 23.0 15.7 35.05 26.25 8 24.425 19.225 21.625 34.725 9 25.05 20.375 23.150000000000002 31.424999999999997 10-14 27.305 24.88 21.355 26.46 15-19 27.365000000000002 24.310000000000002 22.189999999999998 26.135 20-24 27.77 23.95 22.245 26.035000000000004 25-29 27.400000000000002 23.885 21.98 26.735 30-34 27.37 24.495 21.815 26.32 35-39 27.32 23.605 22.215 26.86 40-44 28.21 23.995 21.875 25.919999999999998 45-49 27.435 24.345 21.745 26.474999999999998 50-54 27.83 23.919999999999998 21.72 26.529999999999998 55-59 27.744999999999997 23.565 22.09 26.6 60-64 27.71 23.025000000000002 22.54 26.724999999999998 65-69 27.189999999999998 23.48 22.505 26.825 70-74 27.58 23.34 22.085 26.995 75-79 27.634999999999998 24.05 21.584999999999997 26.729999999999997 80-84 27.700000000000003 23.965 22.0 26.334999999999997 85-89 27.935 23.135 22.555 26.375 90-94 27.755000000000003 23.97 21.634999999999998 26.640000000000004 95-99 27.839999999999996 23.39 22.84 25.929999999999996 100-104 27.345000000000002 24.16 22.29 26.205000000000002 105-109 26.979999999999997 23.925 22.7 26.395000000000003 110-114 27.900000000000002 23.49 22.28 26.33 115-119 27.67 24.27 21.91 26.150000000000002 120-124 28.060000000000002 23.925 22.05 25.965 125-129 27.505000000000003 24.37 21.85 26.275 130-134 28.04 23.95 22.900000000000002 25.11 135-139 27.62 24.785 21.605 25.990000000000002 140-144 28.49 24.865000000000002 21.12 25.525 145-149 28.13 24.990000000000002 21.535 25.345000000000002 150-151 28.999999999999996 24.125 21.175 25.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.5 5 0.5 6 0.5 7 1.0 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 1.0 15 1.5 16 1.0 17 0.5 18 0.0 19 1.0 20 1.5 21 1.5 22 1.5 23 2.0 24 2.0 25 1.5 26 2.0 27 2.0 28 1.0 29 2.0 30 3.5 31 3.5 32 5.5 33 9.0 34 13.0 35 24.5 36 32.0 37 36.5 38 52.5 39 64.5 40 76.5 41 82.5 42 86.5 43 107.0 44 121.5 45 110.5 46 113.0 47 144.0 48 150.5 49 138.5 50 137.0 51 140.0 52 129.0 53 126.0 54 127.0 55 127.0 56 128.5 57 106.0 58 111.0 59 123.0 60 104.0 61 94.5 62 101.5 63 103.5 64 95.5 65 83.0 66 79.0 67 88.0 68 94.0 69 87.5 70 77.0 71 63.0 72 56.5 73 56.0 74 45.5 75 28.0 76 21.0 77 18.0 78 10.0 79 8.5 80 6.5 81 4.5 82 2.5 83 1.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.5 97 0.5 98 0.0 99 1.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.9930276213462 87.625 2 5.229283990345937 9.75 3 0.5631536604987932 1.575 4 0.053633681952266025 0.2 5 0.08045052292839903 0.375 6 0.053633681952266025 0.3 7 0.026816840976133013 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CAAGGATTGACAGACTGAGAGCTCTTTCTTGATTCTATGGGTGGTGGTGC 6 0.15 No Hit CCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCG 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit AAACGATCTAGTGCAGCAGCAGCTTGCTCTCTCCTCCATCTAGTAGAAGA 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 0.9624999999999999 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138-139 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra Read 1562767 spots for SRR7804176.sra Written 1562767 spots for SRR7804176.sra SRR ids: ['SRR7804176.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jqoyz896 SRR7804176.sra spots: 31255340 blocks: [[1, 1562767], [1562768, 3125534], [3125535, 4688301], [4688302, 6251068], [6251069, 7813835], [7813836, 9376602], [9376603, 10939369], [10939370, 12502136], [12502137, 14064903], [14064904, 15627670], [15627671, 17190437], [17190438, 18753204], [18753205, 20315971], [20315972, 21878738], [21878739, 23441505], [23441506, 25004272], [25004273, 26567039], [26567040, 28129806], [28129807, 29692573], [29692574, 31255340]] SRR7804176 file size 10569708 SRR7804176 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804176 SRR7804176_1.fastq SRR7804176_2.fastq Input file: SRR7804176_1.fastq Paired file: SRR7804176_2.fastq trimmed: SRR7804176-trimmed-pair1.fastq, SRR7804176-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:52:22 2024 >> started Sat Dec 7 17:52:54 2024 >> done (32.577s) 31255340 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 1103 ( 0.00%) empty read pairs filtered out after trimming by size control 31254157 (100.00%) read pairs available; of these: 807850 ( 2.58%) trimmed read pairs available after processing 30446307 (97.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 12 0.00% 21 23 0.00% 22 17 0.00% 23 20 0.00% 24 23 0.00% 25 29 0.00% 26 27 0.00% 27 30 0.00% 28 35 0.00% 29 34 0.00% 30 34 0.00% 31 41 0.00% 32 50 0.00% 33 61 0.00% 34 38 0.00% 35 53 0.00% 36 47 0.00% 37 43 0.00% 38 49 0.00% 39 63 0.00% 40 53 0.00% 41 50 0.00% 42 67 0.00% 43 59 0.00% 44 56 0.00% 45 65 0.00% 46 79 0.00% 47 67 0.00% 48 57 0.00% 49 65 0.00% 50 62 0.00% 51 99 0.00% 52 65 0.00% 53 89 0.00% 54 62 0.00% 55 84 0.00% 56 80 0.00% 57 80 0.00% 58 79 0.00% 59 95 0.00% 60 97 0.00% 61 82 0.00% 62 111 0.00% 63 115 0.00% 64 106 0.00% 65 109 0.00% 66 100 0.00% 67 125 0.00% 68 132 0.00% 69 153 0.00% 70 171 0.00% 71 153 0.00% 72 159 0.00% 73 189 0.00% 74 185 0.00% 75 208 0.00% 76 230 0.00% 77 254 0.00% 78 277 0.00% 79 300 0.00% 80 345 0.00% 81 363 0.00% 82 429 0.00% 83 467 0.00% 84 520 0.00% 85 582 0.00% 86 643 0.00% 87 675 0.00% 88 768 0.00% 89 839 0.00% 90 901 0.00% 91 1027 0.00% 92 1219 0.00% 93 1371 0.00% 94 1514 0.00% 95 1730 0.01% 96 1888 0.01% 97 1937 0.01% 98 2222 0.01% 99 2273 0.01% 100 2465 0.01% 101 2771 0.01% 102 3014 0.01% 103 3234 0.01% 104 3713 0.01% 105 4095 0.01% 106 4286 0.01% 107 4438 0.01% 108 4886 0.02% 109 5234 0.02% 110 5393 0.02% 111 5997 0.02% 112 6643 0.02% 113 6750 0.02% 114 7404 0.02% 115 7902 0.03% 116 8534 0.03% 117 8715 0.03% 118 9264 0.03% 119 9613 0.03% 120 10039 0.03% 121 10630 0.03% 122 11090 0.04% 123 12320 0.04% 124 13102 0.04% 125 13724 0.04% 126 14290 0.05% 127 14734 0.05% 128 15251 0.05% 129 15823 0.05% 130 16136 0.05% 131 17133 0.05% 132 17744 0.06% 133 19065 0.06% 134 20168 0.06% 135 21015 0.07% 136 22271 0.07% 137 22534 0.07% 138 23606 0.08% 139 24227 0.08% 140 24723 0.08% 141 25297 0.08% 142 26688 0.09% 143 27229 0.09% 144 28797 0.09% 145 31075 0.10% 146 31721 0.10% 147 32784 0.10% 148 33730 0.11% 149 33961 0.11% 150 35462 0.11% 151 30446307 97.42% 31254157 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=34 prefix-density=0.91 prefix-fanout=1.9 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=58.90 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=4.3 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=21 prefix-density=1.07 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=41.46 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR7804176 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:54:12 Started mapping on | Dec 07 17:54:12 Finished on | Dec 07 17:59:41 Mapping speed, Million of reads per hour | 341.99 Number of input reads | 31254157 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 25768135 Uniquely mapped reads % | 82.45% Average mapped length | 300.07 Number of splices: Total | 23253632 Number of splices: Annotated (sjdb) | 21956390 Number of splices: GT/AG | 22944789 Number of splices: GC/AG | 264116 Number of splices: AT/AC | 7950 Number of splices: Non-canonical | 36777 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1337951 % of reads mapped to multiple loci | 4.28% Number of reads mapped to too many loci | 224136 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.47% % of reads unmapped: other | 6.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4148071 4148071 4148071 N_multimapping 1337951 1337951 1337951 N_noFeature 2064123 24980030 2229752 N_ambiguous 764415 3919 143504 UnstrandedReadsAssigned:22939597 PositiveStrandReadsAssigned:784186 NegativeStrandReadsAssigned:23394879 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804176 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804176-trimmed-pair1.fastq SRR7804176-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,254,157 reads, 24,086,223 reads pseudoaligned [quant] estimated average fragment length: 324.993 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52973 SRR7804176.ke.tsv 35125 SRR7804176.se.tsv 88098 total ==> SRR7804176.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 612.67 0 0 PNS24247 1044 720.007 69.1512 4.2896 PNS24249 1928 1604.01 159.532 4.44219 PNS24246 1044 720.007 69.1512 4.2896 PNS24248 1044 720.007 69.1512 4.2896 PNS24244 1471 1147.01 123.014 4.79009 PNS24243 293 72.5971 0 0 KQK14069 1603 1279.01 10810 377.49 KQK14071 474 191.094 160.211 37.4453 ==> SRR7804176.se.tsv <== BRADI_1g14170v3 11410 BRADI_1g53295v3 240 BRADI_1g59795v3 546 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 303 BRADI_1g74790v3 555 BRADI_1g09890v3 0 BRADI_1g77505v3 446 BRADI_1g48960v3 0 SRR7804176 completed mapping pipeline successfully