Starting /dee2/code/volunteer_pipeline.sh SRR7804177 current disk space = 1525993504768 free memory = 1561748376 SRR7804177 SRAfilesize ae786a152ef50e15d91f4364199fae30 SRR7804177.sra SRR7804177.sra file validated SRR7804177 is paired end SRR7804177 is conventional basespace SRR7804177 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804177_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.11875 37.0 37.0 37.0 37.0 37.0 2 36.0465 37.0 37.0 37.0 37.0 37.0 3 36.329 37.0 37.0 37.0 37.0 37.0 4 36.445 37.0 37.0 37.0 37.0 37.0 5 36.4495 37.0 37.0 37.0 37.0 37.0 6 36.531 37.0 37.0 37.0 37.0 37.0 7 36.2875 37.0 37.0 37.0 37.0 37.0 8 36.4295 37.0 37.0 37.0 37.0 37.0 9 36.3755 37.0 37.0 37.0 37.0 37.0 10-14 36.47539999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.476 37.0 37.0 37.0 37.0 37.0 20-24 36.3982 37.0 37.0 37.0 37.0 37.0 25-29 36.3816 37.0 37.0 37.0 37.0 37.0 30-34 36.3591 37.0 37.0 37.0 37.0 37.0 35-39 36.348 37.0 37.0 37.0 37.0 37.0 40-44 36.269000000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2189 37.0 37.0 37.0 37.0 37.0 50-54 36.182199999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1242 37.0 37.0 37.0 37.0 37.0 60-64 36.1746 37.0 37.0 37.0 37.0 37.0 65-69 36.1237 37.0 37.0 37.0 37.0 37.0 70-74 35.958400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0675 37.0 37.0 37.0 37.0 37.0 80-84 35.9728 37.0 37.0 37.0 37.0 37.0 85-89 35.9455 37.0 37.0 37.0 37.0 37.0 90-94 35.84439999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7907 37.0 37.0 37.0 37.0 37.0 100-104 35.7652 37.0 37.0 37.0 37.0 37.0 105-109 35.7115 37.0 37.0 37.0 37.0 37.0 110-114 35.734899999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.5878 37.0 37.0 37.0 37.0 37.0 120-124 35.5015 37.0 37.0 37.0 37.0 37.0 125-129 35.5183 37.0 37.0 37.0 37.0 37.0 130-134 35.3979 37.0 37.0 37.0 34.6 37.0 135-139 35.2665 37.0 37.0 37.0 34.6 37.0 140-144 35.2942 37.0 37.0 37.0 32.2 37.0 145-149 34.986000000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.3955 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 7.0 26 11.0 27 22.0 28 14.0 29 33.0 30 37.0 31 52.0 32 87.0 33 123.0 34 182.0 35 486.0 36 2696.0 37 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.26887383997993 12.616002006521192 10.18309505894156 32.932029094557315 2 25.0 17.150000000000002 34.35 23.5 3 23.35 26.0 23.400000000000002 27.250000000000004 4 27.3 29.975 20.9 21.825 5 25.874999999999996 31.15 22.05 20.925 6 21.475 32.05 21.9 24.575 7 16.5 20.025000000000002 41.949999999999996 21.525 8 21.15 19.45 26.224999999999998 33.175 9 20.175 19.85 29.875 30.099999999999998 10-14 23.62 24.985 24.349999999999998 27.045 15-19 24.060000000000002 24.375 24.92 26.645000000000003 20-24 24.57 24.11 25.0 26.32 25-29 24.145 24.245 24.529999999999998 27.08 30-34 24.055 24.14 24.84 26.965 35-39 24.3 24.25 24.6 26.85 40-44 24.72 23.54 24.845 26.895000000000003 45-49 24.474999999999998 23.84 24.45 27.235 50-54 25.305 23.815 24.015 26.865 55-59 24.81 24.215 24.02 26.955000000000002 60-64 25.045 23.919999999999998 23.965 27.07 65-69 24.72 23.615 24.27 27.395000000000003 70-74 25.130000000000003 23.98 23.799999999999997 27.089999999999996 75-79 24.84 23.244999999999997 24.240000000000002 27.675 80-84 25.474999999999998 23.849999999999998 23.56 27.115000000000002 85-89 25.419999999999998 23.175 24.075 27.33 90-94 25.595000000000002 23.395 24.2 26.810000000000002 95-99 25.155 23.515 23.830000000000002 27.500000000000004 100-104 25.46 23.29 24.075 27.175 105-109 25.645 23.330000000000002 23.685000000000002 27.339999999999996 110-114 25.275 23.125 24.065 27.534999999999997 115-119 25.324999999999996 23.29 24.295 27.089999999999996 120-124 25.335 23.005 23.810000000000002 27.85 125-129 25.745 22.79 24.055 27.41 130-134 25.885 22.945 23.380000000000003 27.79 135-139 25.985000000000003 22.919999999999998 23.53 27.565 140-144 25.424999999999997 23.080000000000002 23.79 27.705000000000002 145-149 26.334999999999997 22.73 23.615 27.32 150-151 26.0625 22.3875 24.775 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 1.5 25 1.0 26 2.5 27 2.0 28 2.5 29 5.5 30 7.5 31 9.5 32 13.0 33 18.5 34 23.5 35 27.5 36 39.5 37 63.5 38 75.5 39 82.5 40 99.0 41 118.0 42 128.0 43 130.0 44 140.5 45 146.0 46 151.0 47 155.0 48 153.5 49 149.5 50 134.5 51 123.0 52 128.5 53 131.5 54 126.0 55 128.0 56 135.0 57 133.5 58 117.5 59 111.5 60 104.0 61 85.5 62 82.0 63 84.5 64 77.0 65 70.5 66 70.5 67 71.5 68 62.5 69 48.0 70 48.5 71 45.0 72 32.5 73 22.5 74 19.0 75 18.5 76 13.0 77 7.5 78 5.0 79 4.5 80 5.0 81 3.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.02825913089843 88.175 2 5.3319114902692615 10.0 3 0.6131698213809651 1.725 4 0.026659557451346308 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.38749999999999996 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8375 0.0 0.0 0.0 0.0 132-133 0.9875 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.3250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACATA 10 0.006830828 145.0 8 >>END_MODULE SRR7804177 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804177_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.753 37.0 37.0 37.0 37.0 37.0 2 35.099 37.0 37.0 37.0 25.0 37.0 3 35.477 37.0 37.0 37.0 37.0 37.0 4 35.719 37.0 37.0 37.0 37.0 37.0 5 35.8 37.0 37.0 37.0 37.0 37.0 6 35.6345 37.0 37.0 37.0 37.0 37.0 7 35.573 37.0 37.0 37.0 37.0 37.0 8 35.8005 37.0 37.0 37.0 37.0 37.0 9 35.6435 37.0 37.0 37.0 37.0 37.0 10-14 35.716300000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.6099 37.0 37.0 37.0 37.0 37.0 20-24 35.5751 37.0 37.0 37.0 37.0 37.0 25-29 35.495 37.0 37.0 37.0 37.0 37.0 30-34 35.4913 37.0 37.0 37.0 37.0 37.0 35-39 35.3698 37.0 37.0 37.0 37.0 37.0 40-44 35.356700000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.282000000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.2949 37.0 37.0 37.0 37.0 37.0 55-59 35.2415 37.0 37.0 37.0 32.2 37.0 60-64 35.0465 37.0 37.0 37.0 27.4 37.0 65-69 34.9615 37.0 37.0 37.0 25.0 37.0 70-74 35.0495 37.0 37.0 37.0 25.0 37.0 75-79 34.9695 37.0 37.0 37.0 25.0 37.0 80-84 34.87070000000001 37.0 37.0 37.0 25.0 37.0 85-89 34.8671 37.0 37.0 37.0 25.0 37.0 90-94 34.7273 37.0 37.0 37.0 25.0 37.0 95-99 34.6157 37.0 37.0 37.0 25.0 37.0 100-104 34.580600000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.463800000000006 37.0 37.0 37.0 25.0 37.0 110-114 34.3249 37.0 37.0 37.0 25.0 37.0 115-119 34.2038 37.0 37.0 37.0 25.0 37.0 120-124 34.1677 37.0 37.0 37.0 25.0 37.0 125-129 34.138 37.0 37.0 37.0 25.0 37.0 130-134 33.9513 37.0 37.0 37.0 25.0 37.0 135-139 33.7264 37.0 37.0 37.0 25.0 37.0 140-144 33.6428 37.0 37.0 37.0 25.0 37.0 145-149 33.483900000000006 37.0 37.0 37.0 25.0 37.0 150-151 32.870000000000005 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 5.0 15 4.0 16 4.0 17 4.0 18 1.0 19 4.0 20 4.0 21 7.0 22 11.0 23 22.0 24 14.0 25 15.0 26 30.0 27 31.0 28 47.0 29 46.0 30 62.0 31 82.0 32 133.0 33 251.0 34 424.0 35 998.0 36 1746.0 37 48.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.3 14.124999999999998 11.175 31.4 2 31.424999999999997 19.075 27.750000000000004 21.75 3 25.650000000000002 22.875 27.1 24.375 4 29.75 29.225 16.400000000000002 24.625 5 28.999999999999996 32.625 17.474999999999998 20.9 6 23.799999999999997 33.75 16.8 25.650000000000002 7 21.625 16.2 35.125 27.05 8 22.5 21.175 21.925 34.4 9 23.825 20.8 24.65 30.725 10-14 26.395000000000003 24.64 21.91 27.055 15-19 27.435 23.919999999999998 22.08 26.565 20-24 27.365000000000002 23.655 22.095000000000002 26.884999999999998 25-29 27.51 23.849999999999998 21.995 26.645000000000003 30-34 27.560000000000002 24.19 21.6 26.650000000000002 35-39 27.375 24.175 21.959999999999997 26.490000000000002 40-44 27.235 24.095 22.34 26.33 45-49 27.265 24.529999999999998 21.615000000000002 26.590000000000003 50-54 28.444999999999997 23.599999999999998 21.345 26.61 55-59 28.07 23.465 21.705 26.76 60-64 28.075 23.615 21.625 26.685 65-69 28.015 24.13 21.425 26.43 70-74 27.500000000000004 23.79 22.035 26.674999999999997 75-79 27.605 23.685000000000002 22.12 26.590000000000003 80-84 27.975 23.145 21.765 27.115000000000002 85-89 27.560000000000002 23.195 22.515 26.729999999999997 90-94 27.584999999999997 23.380000000000003 22.33 26.705000000000002 95-99 28.485 23.794999999999998 21.834999999999997 25.885 100-104 27.555000000000003 24.169999999999998 21.765 26.51 105-109 27.794999999999998 23.825 21.740000000000002 26.640000000000004 110-114 29.054999999999996 23.535 21.605 25.805 115-119 27.76 23.880000000000003 21.58 26.779999999999998 120-124 27.450000000000003 23.56 22.025 26.965 125-129 28.175 23.9 21.67 26.255 130-134 28.134999999999998 23.56 22.375 25.929999999999996 135-139 28.125 24.0 22.32 25.555 140-144 28.42 23.98 21.66 25.94 145-149 28.384999999999998 24.23 21.709999999999997 25.674999999999997 150-151 28.425 24.5 21.9375 25.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 0.5 23 0.5 24 0.0 25 3.0 26 3.5 27 1.0 28 2.5 29 3.0 30 6.5 31 10.0 32 8.5 33 9.5 34 15.0 35 27.0 36 36.0 37 43.5 38 55.5 39 59.0 40 79.0 41 94.5 42 91.5 43 108.5 44 138.0 45 138.0 46 121.0 47 127.0 48 122.5 49 112.5 50 115.5 51 125.5 52 122.0 53 109.5 54 124.0 55 127.0 56 108.0 57 112.5 58 118.5 59 111.0 60 113.0 61 110.5 62 108.5 63 102.5 64 88.0 65 90.5 66 89.5 67 95.0 68 96.5 69 80.5 70 76.0 71 64.0 72 56.5 73 52.5 74 38.0 75 34.5 76 27.5 77 15.0 78 12.0 79 9.0 80 7.0 81 6.0 82 4.5 83 3.5 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 1.0 92 1.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.0 98 0.0 99 1.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.29260450160771 87.97500000000001 2 4.957127545551983 9.25 3 0.45551982851018225 1.275 4 0.1339764201500536 0.5 5 0.05359056806002144 0.25 6 0.05359056806002144 0.3 7 0.02679528403001072 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02679528403001072 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 7 0.17500000000000002 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 6 0.15 No Hit GCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTTAAGGCCA 5 0.125 No Hit CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.38749999999999996 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8375 0.0 0.0 0.0 0.0 132-133 0.9875 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra Read 1548136 spots for SRR7804177.sra Written 1548136 spots for SRR7804177.sra SRR ids: ['SRR7804177.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2sqnlkcr SRR7804177.sra spots: 30962720 blocks: [[1, 1548136], [1548137, 3096272], [3096273, 4644408], [4644409, 6192544], [6192545, 7740680], [7740681, 9288816], [9288817, 10836952], [10836953, 12385088], [12385089, 13933224], [13933225, 15481360], [15481361, 17029496], [17029497, 18577632], [18577633, 20125768], [20125769, 21673904], [21673905, 23222040], [23222041, 24770176], [24770177, 26318312], [26318313, 27866448], [27866449, 29414584], [29414585, 30962720]] SRR7804177 file size 10470549 SRR7804177 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804177 SRR7804177_1.fastq SRR7804177_2.fastq Input file: SRR7804177_1.fastq Paired file: SRR7804177_2.fastq trimmed: SRR7804177-trimmed-pair1.fastq, SRR7804177-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:20:19 2024 >> started Tue Dec 10 03:20:54 2024 >> done (35.542s) 30962720 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 882 ( 0.00%) empty read pairs filtered out after trimming by size control 30961758 (100.00%) read pairs available; of these: 689759 ( 2.23%) trimmed read pairs available after processing 30271999 (97.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 8 0.00% 20 22 0.00% 21 20 0.00% 22 12 0.00% 23 22 0.00% 24 30 0.00% 25 43 0.00% 26 36 0.00% 27 34 0.00% 28 34 0.00% 29 40 0.00% 30 45 0.00% 31 48 0.00% 32 61 0.00% 33 41 0.00% 34 35 0.00% 35 44 0.00% 36 45 0.00% 37 54 0.00% 38 58 0.00% 39 54 0.00% 40 52 0.00% 41 63 0.00% 42 66 0.00% 43 57 0.00% 44 64 0.00% 45 72 0.00% 46 65 0.00% 47 52 0.00% 48 93 0.00% 49 73 0.00% 50 81 0.00% 51 61 0.00% 52 82 0.00% 53 91 0.00% 54 99 0.00% 55 86 0.00% 56 89 0.00% 57 89 0.00% 58 63 0.00% 59 83 0.00% 60 131 0.00% 61 120 0.00% 62 119 0.00% 63 119 0.00% 64 113 0.00% 65 115 0.00% 66 130 0.00% 67 122 0.00% 68 139 0.00% 69 151 0.00% 70 156 0.00% 71 160 0.00% 72 174 0.00% 73 199 0.00% 74 199 0.00% 75 186 0.00% 76 215 0.00% 77 249 0.00% 78 258 0.00% 79 320 0.00% 80 285 0.00% 81 306 0.00% 82 391 0.00% 83 398 0.00% 84 500 0.00% 85 511 0.00% 86 543 0.00% 87 568 0.00% 88 707 0.00% 89 793 0.00% 90 772 0.00% 91 904 0.00% 92 1056 0.00% 93 1187 0.00% 94 1348 0.00% 95 1453 0.00% 96 1566 0.01% 97 1749 0.01% 98 1805 0.01% 99 1943 0.01% 100 2148 0.01% 101 2418 0.01% 102 2749 0.01% 103 2921 0.01% 104 3018 0.01% 105 3447 0.01% 106 3673 0.01% 107 3805 0.01% 108 4139 0.01% 109 4494 0.01% 110 4684 0.02% 111 5042 0.02% 112 5553 0.02% 113 5619 0.02% 114 6301 0.02% 115 6738 0.02% 116 7098 0.02% 117 7399 0.02% 118 7901 0.03% 119 8081 0.03% 120 8614 0.03% 121 9249 0.03% 122 9555 0.03% 123 10279 0.03% 124 11157 0.04% 125 11491 0.04% 126 12155 0.04% 127 12380 0.04% 128 12642 0.04% 129 13429 0.04% 130 13716 0.04% 131 14457 0.05% 132 15679 0.05% 133 16245 0.05% 134 16994 0.05% 135 17821 0.06% 136 18894 0.06% 137 18959 0.06% 138 19910 0.06% 139 20813 0.07% 140 21134 0.07% 141 22240 0.07% 142 22696 0.07% 143 23782 0.08% 144 24882 0.08% 145 26010 0.08% 146 26882 0.09% 147 27833 0.09% 148 28782 0.09% 149 29141 0.09% 150 30271 0.10% 151 30271999 97.77% 30961758 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=33 prefix-density=0.70 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=63.45 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=4.9 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=17 prefix-density=1.12 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=25.82 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=1.1 sequence=CGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTG SRR7804177 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:22:00 Started mapping on | Dec 10 03:22:01 Finished on | Dec 10 03:28:52 Mapping speed, Million of reads per hour | 271.20 Number of input reads | 30961758 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 25704814 Uniquely mapped reads % | 83.02% Average mapped length | 299.92 Number of splices: Total | 23363189 Number of splices: Annotated (sjdb) | 22089035 Number of splices: GT/AG | 23048586 Number of splices: GC/AG | 269774 Number of splices: AT/AC | 8186 Number of splices: Non-canonical | 36643 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1359957 % of reads mapped to multiple loci | 4.39% Number of reads mapped to too many loci | 177090 % of reads mapped to too many loci | 0.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.02% % of reads unmapped: other | 4.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3896987 3896987 3896987 N_multimapping 1359957 1359957 1359957 N_noFeature 2165648 24934320 2350750 N_ambiguous 718644 4087 134567 UnstrandedReadsAssigned:22820522 PositiveStrandReadsAssigned:766407 NegativeStrandReadsAssigned:23219497 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804177 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804177-trimmed-pair1.fastq SRR7804177-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,961,758 reads, 24,025,935 reads pseudoaligned [quant] estimated average fragment length: 334.43 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR7804177.ke.tsv 35125 SRR7804177.se.tsv 88098 total ==> SRR7804177.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 603.633 2.72553e-07 2.09774e-08 PNS24247 1044 710.57 77.4821 5.06602 PNS24249 1928 1594.57 141.87 4.13351 PNS24246 1044 710.57 77.4821 5.06602 PNS24248 1044 710.57 77.4821 5.06602 PNS24244 1471 1137.57 117.684 4.8063 PNS24243 293 70.6138 0 0 KQK14069 1603 1269.57 10547.3 385.972 KQK14071 474 187.133 43.6987 10.8491 ==> SRR7804177.se.tsv <== BRADI_1g14170v3 10597 BRADI_1g53295v3 147 BRADI_1g59795v3 703 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 130 BRADI_1g74790v3 326 BRADI_1g09890v3 0 BRADI_1g77505v3 401 BRADI_1g48960v3 0 SRR7804177 completed mapping pipeline successfully