Starting /dee2/code/volunteer_pipeline.sh SRR7804178 current disk space = 1540909436928 free memory = 1479065160 SRR7804178 SRAfilesize f923a5d209a372f24a016453525dfd02 SRR7804178.sra SRR7804178.sra file validated SRR7804178 is paired end SRR7804178 is conventional basespace SRR7804178 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804178_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.07175 37.0 37.0 37.0 37.0 37.0 2 36.0695 37.0 37.0 37.0 37.0 37.0 3 36.257 37.0 37.0 37.0 37.0 37.0 4 36.441 37.0 37.0 37.0 37.0 37.0 5 36.458 37.0 37.0 37.0 37.0 37.0 6 36.487 37.0 37.0 37.0 37.0 37.0 7 36.178 37.0 37.0 37.0 37.0 37.0 8 36.442 37.0 37.0 37.0 37.0 37.0 9 36.372 37.0 37.0 37.0 37.0 37.0 10-14 36.454600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.467999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4101 37.0 37.0 37.0 37.0 37.0 25-29 36.3551 37.0 37.0 37.0 37.0 37.0 30-34 36.297000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3088 37.0 37.0 37.0 37.0 37.0 40-44 36.2496 37.0 37.0 37.0 37.0 37.0 45-49 36.2128 37.0 37.0 37.0 37.0 37.0 50-54 36.1772 37.0 37.0 37.0 37.0 37.0 55-59 36.1494 37.0 37.0 37.0 37.0 37.0 60-64 36.1515 37.0 37.0 37.0 37.0 37.0 65-69 36.1274 37.0 37.0 37.0 37.0 37.0 70-74 36.020300000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.0232 37.0 37.0 37.0 37.0 37.0 80-84 36.0355 37.0 37.0 37.0 37.0 37.0 85-89 35.9758 37.0 37.0 37.0 37.0 37.0 90-94 35.8272 37.0 37.0 37.0 37.0 37.0 95-99 35.7066 37.0 37.0 37.0 37.0 37.0 100-104 35.701299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7041 37.0 37.0 37.0 37.0 37.0 110-114 35.6383 37.0 37.0 37.0 37.0 37.0 115-119 35.64020000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.5056 37.0 37.0 37.0 37.0 37.0 125-129 35.463499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.398799999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.2755 37.0 37.0 37.0 32.2 37.0 140-144 35.249 37.0 37.0 37.0 29.8 37.0 145-149 35.0333 37.0 37.0 37.0 25.0 37.0 150-151 34.437749999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 3.0 25 3.0 26 10.0 27 16.0 28 25.0 29 33.0 30 38.0 31 72.0 32 73.0 33 118.0 34 176.0 35 457.0 36 2725.0 37 248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.48659483838637 10.899523928839889 10.899523928839889 39.71435730393385 2 27.474999999999998 15.299999999999999 33.75 23.474999999999998 3 24.775 22.475 22.6 30.15 4 30.575000000000003 28.275 18.05 23.1 5 29.5 31.15 19.25 20.1 6 23.1 32.824999999999996 21.075 23.0 7 18.4 19.875 39.925 21.8 8 23.425 19.575 26.05 30.95 9 21.525 19.2 30.85 28.425 10-14 24.75 25.645 23.775 25.83 15-19 24.6 24.185000000000002 24.265 26.950000000000003 20-24 24.665 24.26 24.490000000000002 26.584999999999997 25-29 25.28 24.145 24.36 26.215 30-34 24.825 23.905 24.365000000000002 26.905 35-39 25.040000000000003 23.724999999999998 24.685000000000002 26.55 40-44 25.124999999999996 24.355 23.48 27.04 45-49 25.035 23.990000000000002 23.98 26.995 50-54 25.15 24.75 23.035 27.065 55-59 25.305 23.845 23.93 26.919999999999998 60-64 25.36 23.695 23.865 27.08 65-69 25.0 23.97 24.224999999999998 26.805 70-74 25.7 23.565 23.1 27.634999999999998 75-79 25.71 23.45 23.625 27.215 80-84 25.995 23.395 23.330000000000002 27.279999999999998 85-89 25.674999999999997 23.735 23.35 27.24 90-94 26.240000000000002 23.265 23.62 26.875 95-99 25.985000000000003 23.580000000000002 23.645 26.790000000000003 100-104 26.290000000000003 23.315 23.419999999999998 26.974999999999998 105-109 26.155 23.205000000000002 23.115 27.525 110-114 26.63 23.095 23.21 27.065 115-119 26.08 23.195 23.52 27.205000000000002 120-124 26.590000000000003 22.735 22.79 27.884999999999998 125-129 26.43 22.755 23.145 27.67 130-134 26.915 22.84 23.585 26.66 135-139 26.765 22.919999999999998 22.869999999999997 27.445000000000004 140-144 27.005000000000003 22.81 22.935 27.250000000000004 145-149 27.215 22.685 23.01 27.089999999999996 150-151 27.212500000000002 22.5625 22.575 27.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 4.0 29 7.5 30 9.0 31 8.0 32 9.5 33 15.5 34 16.0 35 23.5 36 45.5 37 60.5 38 68.5 39 75.0 40 102.5 41 126.5 42 132.5 43 150.5 44 161.0 45 153.5 46 150.0 47 148.5 48 146.0 49 140.0 50 131.5 51 116.0 52 110.0 53 113.0 54 114.5 55 107.5 56 93.5 57 90.0 58 95.0 59 103.5 60 96.5 61 99.0 62 95.5 63 85.0 64 89.5 65 88.5 66 86.5 67 92.5 68 82.0 69 61.5 70 59.0 71 50.5 72 35.5 73 34.5 74 34.5 75 23.0 76 12.5 77 12.0 78 8.0 79 4.0 80 3.5 81 3.5 82 2.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.33510638297872 88.675 2 5.079787234042553 9.55 3 0.5053191489361702 1.425 4 0.05319148936170213 0.2 5 0.0 0.0 6 0.026595744680851064 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGAC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.037500000000000006 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.425 0.0 0.0 0.0 0.0 128-129 0.475 0.0 0.0 0.0 0.0 130-131 0.6875 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.75 0.0 0.0 0.0 0.0 136-137 0.875 0.0 0.0 0.0 0.0 138-139 1.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATAT 10 0.006830828 145.0 5 AACTCAA 10 0.006830828 145.0 5 >>END_MODULE SRR7804178 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804178_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.367 37.0 37.0 37.0 37.0 37.0 2 36.2015 37.0 37.0 37.0 37.0 37.0 3 36.141 37.0 37.0 37.0 37.0 37.0 4 36.2565 37.0 37.0 37.0 37.0 37.0 5 36.3735 37.0 37.0 37.0 37.0 37.0 6 36.235 37.0 37.0 37.0 37.0 37.0 7 36.23 37.0 37.0 37.0 37.0 37.0 8 36.2595 37.0 37.0 37.0 37.0 37.0 9 36.3445 37.0 37.0 37.0 37.0 37.0 10-14 36.2818 37.0 37.0 37.0 37.0 37.0 15-19 36.198699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1721 37.0 37.0 37.0 37.0 37.0 25-29 36.1141 37.0 37.0 37.0 37.0 37.0 30-34 36.0553 37.0 37.0 37.0 37.0 37.0 35-39 35.9471 37.0 37.0 37.0 37.0 37.0 40-44 35.984899999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9211 37.0 37.0 37.0 37.0 37.0 50-54 35.9173 37.0 37.0 37.0 37.0 37.0 55-59 35.8859 37.0 37.0 37.0 37.0 37.0 60-64 35.8031 37.0 37.0 37.0 37.0 37.0 65-69 35.7556 37.0 37.0 37.0 37.0 37.0 70-74 35.717200000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.654199999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.5862 37.0 37.0 37.0 37.0 37.0 85-89 35.509 37.0 37.0 37.0 37.0 37.0 90-94 35.461200000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.368 37.0 37.0 37.0 37.0 37.0 100-104 35.3091 37.0 37.0 37.0 32.2 37.0 105-109 35.2995 37.0 37.0 37.0 34.6 37.0 110-114 35.089099999999995 37.0 37.0 37.0 25.0 37.0 115-119 35.0122 37.0 37.0 37.0 25.0 37.0 120-124 34.9482 37.0 37.0 37.0 25.0 37.0 125-129 34.986900000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.8032 37.0 37.0 37.0 25.0 37.0 135-139 34.5792 37.0 37.0 37.0 25.0 37.0 140-144 34.48440000000001 37.0 37.0 37.0 25.0 37.0 145-149 34.41610000000001 37.0 37.0 37.0 25.0 37.0 150-151 33.78675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 3.0 16 5.0 17 1.0 18 1.0 19 3.0 20 4.0 21 3.0 22 2.0 23 9.0 24 9.0 25 10.0 26 15.0 27 19.0 28 20.0 29 19.0 30 41.0 31 64.0 32 91.0 33 130.0 34 282.0 35 763.0 36 2405.0 37 96.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.9 12.85 13.575000000000001 37.675 2 29.775000000000002 16.575 29.375 24.275 3 24.725 21.5 25.55 28.225 4 28.999999999999996 28.575 16.75 25.674999999999997 5 29.15 30.45 17.424999999999997 22.975 6 22.875 32.25 17.5 27.375 7 22.325 13.225000000000001 35.925000000000004 28.525 8 23.200000000000003 20.175 21.9 34.725 9 24.075 19.375 23.7 32.85 10-14 26.174999999999997 24.240000000000002 21.01 28.575 15-19 26.99 22.955000000000002 22.155 27.900000000000002 20-24 26.705000000000002 23.71 21.735 27.85 25-29 26.375 23.835 21.495 28.294999999999998 30-34 27.150000000000002 22.759999999999998 22.32 27.77 35-39 27.21 23.05 21.790000000000003 27.950000000000003 40-44 28.055000000000003 22.884999999999998 21.310000000000002 27.750000000000004 45-49 27.97 23.105 21.325 27.6 50-54 27.250000000000004 23.14 21.66 27.950000000000003 55-59 27.66 23.105 21.2 28.035 60-64 27.395000000000003 22.425 21.545 28.634999999999998 65-69 27.98 22.03 22.2 27.79 70-74 27.555000000000003 22.28 21.495 28.67 75-79 27.22 22.86 21.88 28.04 80-84 27.815 22.634999999999998 21.09 28.46 85-89 27.384999999999998 22.965 21.52 28.13 90-94 27.944999999999997 22.33 21.685 28.04 95-99 28.1 22.285 21.82 27.794999999999998 100-104 27.755000000000003 22.515 21.5 28.23 105-109 27.935 22.835 21.490000000000002 27.74 110-114 27.825 22.470000000000002 21.46 28.244999999999997 115-119 28.13 23.200000000000003 20.875 27.794999999999998 120-124 28.53 23.415 20.82 27.235 125-129 27.52 23.1 21.13 28.249999999999996 130-134 27.900000000000002 22.82 21.47 27.810000000000002 135-139 28.005000000000003 23.775 21.545 26.674999999999997 140-144 28.28 23.189999999999998 21.535 26.995 145-149 28.46 23.22 21.68 26.640000000000004 150-151 28.725 22.8125 20.9375 27.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.0 25 2.0 26 2.0 27 2.0 28 2.5 29 5.0 30 6.5 31 5.5 32 9.5 33 12.5 34 12.0 35 21.5 36 28.0 37 30.0 38 44.5 39 59.0 40 68.0 41 78.0 42 92.5 43 116.0 44 125.0 45 117.0 46 125.0 47 127.0 48 113.5 49 106.5 50 100.5 51 102.5 52 103.5 53 92.5 54 97.0 55 94.0 56 89.5 57 102.5 58 106.0 59 104.0 60 110.5 61 121.0 62 142.0 63 135.5 64 112.5 65 121.0 66 124.0 67 118.5 68 108.0 69 106.5 70 89.0 71 72.0 72 77.5 73 60.0 74 41.0 75 38.0 76 33.0 77 23.0 78 16.5 79 9.0 80 7.5 81 6.5 82 1.5 83 1.0 84 1.0 85 1.0 86 0.5 87 1.0 88 1.5 89 1.0 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.38502673796792 88.25 2 4.786096256684492 8.95 3 0.5882352941176471 1.6500000000000001 4 0.1336898395721925 0.5 5 0.026737967914438502 0.125 6 0.053475935828877004 0.3 7 0.0 0.0 8 0.0 0.0 9 0.026737967914438502 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 9 0.22499999999999998 No Hit GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 6 0.15 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0125 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.7125 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.875 0.0 0.0 0.0 0.0 138-139 1.0499999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602304 spots for SRR7804178.sra Written 1602304 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra Read 1602288 spots for SRR7804178.sra Written 1602288 spots for SRR7804178.sra SRR ids: ['SRR7804178.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wogwpfso SRR7804178.sra spots: 32045776 blocks: [[1, 1602288], [1602289, 3204576], [3204577, 4806864], [4806865, 6409152], [6409153, 8011440], [8011441, 9613728], [9613729, 11216016], [11216017, 12818304], [12818305, 14420592], [14420593, 16022880], [16022881, 17625168], [17625169, 19227456], [19227457, 20829744], [20829745, 22432032], [22432033, 24034320], [24034321, 25636608], [25636609, 27238896], [27238897, 28841184], [28841185, 30443472], [30443473, 32045776]] SRR7804178 file size 10837561 SRR7804178 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804178 SRR7804178_1.fastq SRR7804178_2.fastq Input file: SRR7804178_1.fastq Paired file: SRR7804178_2.fastq trimmed: SRR7804178-trimmed-pair1.fastq, SRR7804178-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:57:31 2024 >> started Sat Dec 7 18:01:36 2024 >> done (245.049s) 32045776 read pairs processed; of these: 71 ( 0.00%) short read pairs filtered out after trimming by size control 1436 ( 0.00%) empty read pairs filtered out after trimming by size control 32044269 (100.00%) read pairs available; of these: 775886 ( 2.42%) trimmed read pairs available after processing 31268383 (97.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 18 0.00% 21 19 0.00% 22 23 0.00% 23 29 0.00% 24 16 0.00% 25 21 0.00% 26 31 0.00% 27 32 0.00% 28 37 0.00% 29 46 0.00% 30 37 0.00% 31 48 0.00% 32 62 0.00% 33 40 0.00% 34 56 0.00% 35 64 0.00% 36 53 0.00% 37 65 0.00% 38 81 0.00% 39 62 0.00% 40 69 0.00% 41 67 0.00% 42 74 0.00% 43 58 0.00% 44 62 0.00% 45 74 0.00% 46 69 0.00% 47 65 0.00% 48 87 0.00% 49 67 0.00% 50 88 0.00% 51 84 0.00% 52 103 0.00% 53 96 0.00% 54 95 0.00% 55 110 0.00% 56 96 0.00% 57 109 0.00% 58 108 0.00% 59 99 0.00% 60 143 0.00% 61 109 0.00% 62 112 0.00% 63 138 0.00% 64 129 0.00% 65 141 0.00% 66 159 0.00% 67 134 0.00% 68 171 0.00% 69 155 0.00% 70 163 0.00% 71 197 0.00% 72 236 0.00% 73 198 0.00% 74 252 0.00% 75 274 0.00% 76 287 0.00% 77 314 0.00% 78 314 0.00% 79 411 0.00% 80 428 0.00% 81 461 0.00% 82 500 0.00% 83 580 0.00% 84 646 0.00% 85 722 0.00% 86 805 0.00% 87 841 0.00% 88 961 0.00% 89 1017 0.00% 90 1175 0.00% 91 1246 0.00% 92 1472 0.00% 93 1546 0.00% 94 1799 0.01% 95 1872 0.01% 96 2103 0.01% 97 2284 0.01% 98 2388 0.01% 99 2646 0.01% 100 2868 0.01% 101 3162 0.01% 102 3506 0.01% 103 3701 0.01% 104 3878 0.01% 105 4234 0.01% 106 4579 0.01% 107 4697 0.01% 108 4994 0.02% 109 5438 0.02% 110 5685 0.02% 111 6127 0.02% 112 6511 0.02% 113 7006 0.02% 114 7632 0.02% 115 7975 0.02% 116 8329 0.03% 117 8553 0.03% 118 8919 0.03% 119 9439 0.03% 120 9886 0.03% 121 10294 0.03% 122 10887 0.03% 123 11813 0.04% 124 12187 0.04% 125 12912 0.04% 126 13662 0.04% 127 14083 0.04% 128 14143 0.04% 129 15239 0.05% 130 15366 0.05% 131 16391 0.05% 132 17181 0.05% 133 17638 0.06% 134 18797 0.06% 135 19777 0.06% 136 20496 0.06% 137 21201 0.07% 138 22095 0.07% 139 22861 0.07% 140 23125 0.07% 141 23993 0.07% 142 24746 0.08% 143 25813 0.08% 144 26809 0.08% 145 28286 0.09% 146 29383 0.09% 147 30727 0.10% 148 31694 0.10% 149 32027 0.10% 150 33069 0.10% 151 31268383 97.58% 32044269 reads passed initial QC criterion=sequence-density sequence-density=1.31 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=21 prefix-density=1.36 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=11.47 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.7 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=1.39 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=18 prefix-density=1.48 prefix-fanout=2.8 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTGGTACGGCTCCGACCGCGTGTTGTACCTCGGCCCGCTCTCCGGCGAACCCCCGAGCTACCTGACCGGTGAGTTCCCCGGCGATTACGGGTGGGACACCGCCGGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=100.61 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.3 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804178 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:07:57 Started mapping on | Dec 07 18:07:57 Finished on | Dec 07 19:03:00 Mapping speed, Million of reads per hour | 34.93 Number of input reads | 32044269 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 29815298 Uniquely mapped reads % | 93.04% Average mapped length | 300.08 Number of splices: Total | 29112291 Number of splices: Annotated (sjdb) | 27512078 Number of splices: GT/AG | 28697412 Number of splices: GC/AG | 365681 Number of splices: AT/AC | 10787 Number of splices: Non-canonical | 38411 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286882 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 26077 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.37% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1942089 1942089 1942089 N_multimapping 286882 286882 286882 N_noFeature 767793 28903441 993203 N_ambiguous 831592 4752 145418 UnstrandedReadsAssigned:28215913 PositiveStrandReadsAssigned:907105 NegativeStrandReadsAssigned:28676677 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804178 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804178-trimmed-pair1.fastq SRR7804178-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,044,269 reads, 28,834,402 reads pseudoaligned [quant] estimated average fragment length: 333.935 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR7804178.ke.tsv 35125 SRR7804178.se.tsv 88098 total ==> SRR7804178.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 604.121 0 0 PNS24247 1044 711.065 61.1114 3.50633 PNS24249 1928 1595.07 132.162 3.38039 PNS24246 1044 711.065 61.1114 3.50633 PNS24248 1044 711.065 61.1114 3.50633 PNS24244 1471 1138.07 106.504 3.81801 PNS24243 293 71.3452 0 0 KQK14069 1603 1270.07 371.342 11.9285 KQK14071 474 188.335 1.58899 0.344213 ==> SRR7804178.se.tsv <== BRADI_1g14170v3 392 BRADI_1g53295v3 50 BRADI_1g59795v3 1113 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 278 BRADI_1g74790v3 432 BRADI_1g09890v3 0 BRADI_1g77505v3 454 BRADI_1g48960v3 0 SRR7804178 completed mapping pipeline successfully