Starting /dee2/code/volunteer_pipeline.sh SRR7804179 current disk space = 1540917428224 free memory = 1601435412 SRR7804179 SRAfilesize 40611722c1437c616ee457e86ad323a9 SRR7804179.sra SRR7804179.sra file validated SRR7804179 is paired end SRR7804179 is conventional basespace SRR7804179 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804179_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.163 37.0 37.0 37.0 37.0 37.0 2 36.286 37.0 37.0 37.0 37.0 37.0 3 36.4125 37.0 37.0 37.0 37.0 37.0 4 36.542 37.0 37.0 37.0 37.0 37.0 5 36.4885 37.0 37.0 37.0 37.0 37.0 6 36.518 37.0 37.0 37.0 37.0 37.0 7 36.4065 37.0 37.0 37.0 37.0 37.0 8 36.56 37.0 37.0 37.0 37.0 37.0 9 36.4685 37.0 37.0 37.0 37.0 37.0 10-14 36.5264 37.0 37.0 37.0 37.0 37.0 15-19 36.5422 37.0 37.0 37.0 37.0 37.0 20-24 36.509699999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4436 37.0 37.0 37.0 37.0 37.0 30-34 36.4355 37.0 37.0 37.0 37.0 37.0 35-39 36.4033 37.0 37.0 37.0 37.0 37.0 40-44 36.330799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.32520000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.293600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.254900000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.220299999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.1727 37.0 37.0 37.0 37.0 37.0 70-74 36.0944 37.0 37.0 37.0 37.0 37.0 75-79 36.082499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0626 37.0 37.0 37.0 37.0 37.0 85-89 35.987300000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.995799999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.875299999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8206 37.0 37.0 37.0 37.0 37.0 105-109 35.7995 37.0 37.0 37.0 37.0 37.0 110-114 35.7878 37.0 37.0 37.0 37.0 37.0 115-119 35.686699999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.6632 37.0 37.0 37.0 37.0 37.0 125-129 35.6059 37.0 37.0 37.0 37.0 37.0 130-134 35.489 37.0 37.0 37.0 37.0 37.0 135-139 35.3895 37.0 37.0 37.0 34.6 37.0 140-144 35.3805 37.0 37.0 37.0 37.0 37.0 145-149 35.183499999999995 37.0 37.0 37.0 29.8 37.0 150-151 34.6035 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 1.0 24 1.0 25 6.0 26 9.0 27 13.0 28 15.0 29 24.0 30 35.0 31 50.0 32 80.0 33 86.0 34 177.0 35 430.0 36 2828.0 37 242.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.06573005519318 12.719518314099348 11.590566984445559 42.62418464626192 2 24.25 18.45 34.625 22.675 3 24.95 24.425 21.95 28.675 4 27.675 33.0 16.975 22.35 5 27.025 32.05 19.475 21.45 6 20.599999999999998 33.675 22.225 23.5 7 16.650000000000002 20.95 41.15 21.25 8 21.375 19.5 27.075 32.05 9 22.25 20.349999999999998 29.375 28.025 10-14 23.645 26.465 23.47 26.419999999999998 15-19 24.385 25.415 23.595 26.605 20-24 24.345 25.5 23.89 26.265 25-29 23.830000000000002 25.064999999999998 24.125 26.979999999999997 30-34 24.39 25.575 23.544999999999998 26.490000000000002 35-39 24.015 25.21 24.060000000000002 26.715 40-44 24.455 25.380000000000003 23.68 26.484999999999996 45-49 24.195 25.490000000000002 23.87 26.445 50-54 24.645 24.69 23.49 27.175 55-59 24.240000000000002 25.135 23.605 27.02 60-64 23.974999999999998 24.97 24.235 26.82 65-69 24.46 24.83 23.935000000000002 26.775 70-74 24.575 24.8 23.724999999999998 26.900000000000002 75-79 25.135 24.57 22.955000000000002 27.339999999999996 80-84 24.959999999999997 24.59 23.615 26.834999999999997 85-89 24.88 23.919999999999998 24.14 27.060000000000002 90-94 25.56 23.9 23.565 26.974999999999998 95-99 25.15 24.224999999999998 23.48 27.145000000000003 100-104 25.2 24.075 24.035 26.69 105-109 24.925 23.945 24.08 27.05 110-114 25.3 24.235 23.23 27.235 115-119 25.445 23.919999999999998 23.405 27.229999999999997 120-124 25.695 23.68 23.445 27.18 125-129 25.52 23.965 23.29 27.224999999999998 130-134 25.505 23.875 22.939999999999998 27.68 135-139 25.135 24.365000000000002 23.080000000000002 27.42 140-144 26.205000000000002 22.939999999999998 23.849999999999998 27.005000000000003 145-149 25.805 23.97 22.925 27.3 150-151 26.075 23.3125 23.075000000000003 27.537499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.0 28 2.0 29 5.0 30 7.0 31 7.5 32 9.5 33 15.0 34 23.5 35 35.0 36 53.5 37 70.5 38 89.0 39 106.0 40 99.0 41 101.5 42 134.5 43 165.0 44 163.5 45 144.0 46 157.5 47 174.5 48 159.5 49 152.5 50 160.0 51 160.0 52 140.5 53 130.0 54 118.5 55 96.5 56 99.0 57 95.0 58 72.0 59 73.5 60 85.0 61 80.5 62 72.0 63 74.0 64 80.5 65 75.5 66 67.0 67 69.5 68 66.0 69 60.0 70 53.5 71 39.0 72 36.0 73 34.5 74 31.0 75 20.0 76 10.5 77 6.0 78 5.5 79 7.0 80 3.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.93114241001565 91.95 2 3.808033385498174 7.3 3 0.2608242044861763 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.725 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.3875 0.0 0.0 0.0 0.0 136-137 1.5375 0.0 0.0 0.0 0.0 138-139 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGTT 10 0.006830828 145.0 8 AGGGTCA 10 0.006830828 145.0 8 AAGGGTC 10 0.006830828 145.0 7 >>END_MODULE SRR7804179 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804179_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5165 37.0 37.0 37.0 37.0 37.0 2 36.324 37.0 37.0 37.0 37.0 37.0 3 36.4165 37.0 37.0 37.0 37.0 37.0 4 36.3955 37.0 37.0 37.0 37.0 37.0 5 36.425 37.0 37.0 37.0 37.0 37.0 6 36.3705 37.0 37.0 37.0 37.0 37.0 7 36.3145 37.0 37.0 37.0 37.0 37.0 8 36.4365 37.0 37.0 37.0 37.0 37.0 9 36.43 37.0 37.0 37.0 37.0 37.0 10-14 36.375 37.0 37.0 37.0 37.0 37.0 15-19 36.34009999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.277100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3181 37.0 37.0 37.0 37.0 37.0 30-34 36.238800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.1948 37.0 37.0 37.0 37.0 37.0 40-44 36.113600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.09159999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.144000000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.086200000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9686 37.0 37.0 37.0 37.0 37.0 65-69 35.898799999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.9052 37.0 37.0 37.0 37.0 37.0 75-79 35.857299999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.825100000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.7659 37.0 37.0 37.0 37.0 37.0 90-94 35.7703 37.0 37.0 37.0 37.0 37.0 95-99 35.6868 37.0 37.0 37.0 37.0 37.0 100-104 35.554300000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.5798 37.0 37.0 37.0 37.0 37.0 110-114 35.42809999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.3537 37.0 37.0 37.0 34.6 37.0 120-124 35.355599999999995 37.0 37.0 37.0 34.6 37.0 125-129 35.22240000000001 37.0 37.0 37.0 27.4 37.0 130-134 35.0404 37.0 37.0 37.0 25.0 37.0 135-139 35.0203 37.0 37.0 37.0 25.0 37.0 140-144 34.75150000000001 37.0 37.0 37.0 25.0 37.0 145-149 34.6703 37.0 37.0 37.0 25.0 37.0 150-151 34.042 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 5.0 22 8.0 23 7.0 24 4.0 25 7.0 26 5.0 27 16.0 28 20.0 29 13.0 30 24.0 31 38.0 32 77.0 33 126.0 34 244.0 35 715.0 36 2571.0 37 113.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.5 10.725 14.549999999999999 41.225 2 28.525 16.6 32.25 22.625 3 25.7 20.125 27.35 26.825 4 30.15 26.950000000000003 16.925 25.974999999999998 5 30.225 30.55 16.925 22.3 6 22.95 33.650000000000006 18.475 24.925 7 21.525 13.975000000000001 38.0 26.5 8 23.549999999999997 18.975 22.25 35.225 9 24.7 19.75 26.1 29.45 10-14 26.19 23.9 22.005 27.905 15-19 26.515 23.805 22.55 27.13 20-24 26.87 23.59 22.685 26.855 25-29 26.474999999999998 23.435 22.7 27.389999999999997 30-34 26.015 23.91 23.085 26.99 35-39 27.125 23.955000000000002 22.55 26.369999999999997 40-44 26.974999999999998 24.09 22.585 26.35 45-49 27.33 23.565 22.7 26.405 50-54 26.875 23.69 22.61 26.825 55-59 27.185 23.56 22.56 26.695 60-64 27.165 23.585 22.585 26.665 65-69 27.529999999999998 23.105 22.759999999999998 26.605 70-74 27.334999999999997 23.275000000000002 22.685 26.705000000000002 75-79 27.66 22.96 22.545 26.834999999999997 80-84 27.66 23.78 22.645 25.915 85-89 27.455000000000002 23.585 22.79 26.169999999999998 90-94 27.555000000000003 24.175 22.1 26.169999999999998 95-99 27.755000000000003 23.64 22.665 25.94 100-104 27.49 23.27 22.61 26.63 105-109 27.845 23.7 22.655 25.8 110-114 27.815 23.35 22.8 26.035000000000004 115-119 27.794999999999998 24.23 22.285 25.69 120-124 27.229999999999997 23.46 22.85 26.46 125-129 27.6 23.974999999999998 22.82 25.605 130-134 28.16 23.630000000000003 22.465 25.745 135-139 27.275 24.34 22.994999999999997 25.39 140-144 28.03 23.505000000000003 22.805 25.66 145-149 28.335 23.580000000000002 22.91 25.174999999999997 150-151 28.449999999999996 23.4375 23.150000000000002 24.962500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 2.0 28 0.5 29 0.5 30 2.0 31 4.5 32 5.5 33 9.0 34 14.5 35 20.5 36 30.5 37 43.0 38 57.0 39 65.5 40 67.5 41 89.5 42 108.0 43 117.0 44 141.5 45 151.0 46 145.5 47 144.5 48 138.0 49 135.0 50 128.0 51 131.0 52 140.5 53 120.5 54 113.5 55 109.5 56 104.5 57 109.0 58 97.5 59 93.0 60 103.0 61 101.0 62 104.0 63 99.0 64 100.0 65 106.5 66 93.0 67 95.5 68 89.0 69 83.5 70 76.0 71 56.0 72 52.5 73 53.0 74 46.0 75 31.0 76 20.5 77 15.5 78 9.0 79 4.5 80 3.0 81 1.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.6282722513089 91.325 2 4.031413612565445 7.7 3 0.3403141361256544 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 0.9875 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.2 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138-139 1.7625000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTGGG 10 0.006830828 145.0 145 >>END_MODULE Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691901 spots for SRR7804179.sra Written 1691901 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra Read 1691893 spots for SRR7804179.sra Written 1691893 spots for SRR7804179.sra SRR ids: ['SRR7804179.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kkhjnh_2 SRR7804179.sra spots: 33837868 blocks: [[1, 1691893], [1691894, 3383786], [3383787, 5075679], [5075680, 6767572], [6767573, 8459465], [8459466, 10151358], [10151359, 11843251], [11843252, 13535144], [13535145, 15227037], [15227038, 16918930], [16918931, 18610823], [18610824, 20302716], [20302717, 21994609], [21994610, 23686502], [23686503, 25378395], [25378396, 27070288], [27070289, 28762181], [28762182, 30454074], [30454075, 32145967], [32145968, 33837868]] SRR7804179 file size 11444842 SRR7804179 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804179 SRR7804179_1.fastq SRR7804179_2.fastq Input file: SRR7804179_1.fastq Paired file: SRR7804179_2.fastq trimmed: SRR7804179-trimmed-pair1.fastq, SRR7804179-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:57:31 2024 >> started Sat Dec 7 17:58:07 2024 >> done (35.578s) 33837868 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 578 ( 0.00%) empty read pairs filtered out after trimming by size control 33837199 (100.00%) read pairs available; of these: 1073774 ( 3.17%) trimmed read pairs available after processing 32763425 (96.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 14 0.00% 20 14 0.00% 21 18 0.00% 22 22 0.00% 23 18 0.00% 24 25 0.00% 25 40 0.00% 26 38 0.00% 27 43 0.00% 28 42 0.00% 29 51 0.00% 30 59 0.00% 31 44 0.00% 32 63 0.00% 33 60 0.00% 34 50 0.00% 35 74 0.00% 36 72 0.00% 37 58 0.00% 38 73 0.00% 39 73 0.00% 40 71 0.00% 41 80 0.00% 42 80 0.00% 43 82 0.00% 44 81 0.00% 45 77 0.00% 46 97 0.00% 47 94 0.00% 48 95 0.00% 49 99 0.00% 50 104 0.00% 51 82 0.00% 52 99 0.00% 53 114 0.00% 54 133 0.00% 55 105 0.00% 56 122 0.00% 57 123 0.00% 58 129 0.00% 59 144 0.00% 60 163 0.00% 61 157 0.00% 62 172 0.00% 63 156 0.00% 64 162 0.00% 65 155 0.00% 66 190 0.00% 67 204 0.00% 68 202 0.00% 69 193 0.00% 70 241 0.00% 71 254 0.00% 72 265 0.00% 73 305 0.00% 74 304 0.00% 75 360 0.00% 76 355 0.00% 77 410 0.00% 78 483 0.00% 79 522 0.00% 80 500 0.00% 81 601 0.00% 82 701 0.00% 83 778 0.00% 84 873 0.00% 85 868 0.00% 86 1075 0.00% 87 1171 0.00% 88 1252 0.00% 89 1400 0.00% 90 1517 0.00% 91 1892 0.01% 92 1979 0.01% 93 2063 0.01% 94 2400 0.01% 95 2595 0.01% 96 2901 0.01% 97 3050 0.01% 98 3442 0.01% 99 3631 0.01% 100 3963 0.01% 101 4112 0.01% 102 4669 0.01% 103 5071 0.01% 104 5256 0.02% 105 5932 0.02% 106 6355 0.02% 107 6881 0.02% 108 7137 0.02% 109 7661 0.02% 110 8136 0.02% 111 8473 0.03% 112 9129 0.03% 113 9827 0.03% 114 10310 0.03% 115 11439 0.03% 116 11866 0.04% 117 12040 0.04% 118 12763 0.04% 119 13245 0.04% 120 14057 0.04% 121 14728 0.04% 122 15503 0.05% 123 16526 0.05% 124 17348 0.05% 125 18113 0.05% 126 19044 0.06% 127 19623 0.06% 128 20307 0.06% 129 21145 0.06% 130 21685 0.06% 131 23034 0.07% 132 23984 0.07% 133 25036 0.07% 134 25997 0.08% 135 27285 0.08% 136 28386 0.08% 137 29167 0.09% 138 30398 0.09% 139 31367 0.09% 140 32069 0.09% 141 33284 0.10% 142 34818 0.10% 143 35735 0.11% 144 37109 0.11% 145 38328 0.11% 146 39894 0.12% 147 41145 0.12% 148 42989 0.13% 149 43166 0.13% 150 45319 0.13% 151 32763425 96.83% 33837199 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=32 prefix-density=0.63 prefix-fanout=2.2 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=47.09 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=9.7 sequence=GAGCTGCTTGCGGATGAGCTTGGCGGC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=25 prefix-density=0.62 prefix-fanout=2.9 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.21 sequence-density-rank=16 fanout-score=11.66 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=6.8 sequence=GGCAAGACCATCACCCTTGAGGTGGAGTCATCTGACACCAT SRR7804179 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:58:48 Started mapping on | Dec 07 17:58:48 Finished on | Dec 07 18:03:28 Mapping speed, Million of reads per hour | 435.05 Number of input reads | 33837199 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 32100455 Uniquely mapped reads % | 94.87% Average mapped length | 299.87 Number of splices: Total | 28558521 Number of splices: Annotated (sjdb) | 26979302 Number of splices: GT/AG | 28187949 Number of splices: GC/AG | 314348 Number of splices: AT/AC | 15345 Number of splices: Non-canonical | 40879 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.74 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306395 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 20658 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1430349 1430349 1430349 N_multimapping 306395 306395 306395 N_noFeature 603882 31181697 868464 N_ambiguous 759153 4269 105542 UnstrandedReadsAssigned:30737420 PositiveStrandReadsAssigned:914489 NegativeStrandReadsAssigned:31126449 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804179 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804179-trimmed-pair1.fastq SRR7804179-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,837,199 reads, 31,370,182 reads pseudoaligned [quant] estimated average fragment length: 310.931 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,327 rounds 52973 SRR7804179.ke.tsv 35125 SRR7804179.se.tsv 88098 total ==> SRR7804179.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 626.675 0.117983 0.00722258 PNS24247 1044 734.069 52.8595 2.7625 PNS24249 1928 1618.07 107.195 2.54151 PNS24246 1044 734.069 52.8595 2.7625 PNS24248 1044 734.069 52.8595 2.7625 PNS24244 1471 1161.07 166.109 5.48845 PNS24243 293 74.0014 1 0.518412 KQK14069 1603 1293.07 755.774 22.4226 KQK14071 474 197.427 7.506 1.45854 ==> SRR7804179.se.tsv <== BRADI_1g14170v3 789 BRADI_1g53295v3 262 BRADI_1g59795v3 526 BRADI_1g07683v3 0 BRADI_1g00485v3 164 BRADI_1g20270v3 2314 BRADI_1g74790v3 321 BRADI_1g09890v3 120 BRADI_1g77505v3 449 BRADI_1g48960v3 2 SRR7804179 completed mapping pipeline successfully