Starting /dee2/code/volunteer_pipeline.sh SRR7804180 current disk space = 1540917428224 free memory = 1601440188 SRR7804180 SRAfilesize 4c78480c5e121a674ea257d1a9dc08c2 SRR7804180.sra SRR7804180.sra file validated SRR7804180 is paired end SRR7804180 is conventional basespace SRR7804180 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804180_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.08375 37.0 37.0 37.0 37.0 37.0 2 36.2475 37.0 37.0 37.0 37.0 37.0 3 36.333 37.0 37.0 37.0 37.0 37.0 4 36.3885 37.0 37.0 37.0 37.0 37.0 5 36.451 37.0 37.0 37.0 37.0 37.0 6 36.518 37.0 37.0 37.0 37.0 37.0 7 36.3165 37.0 37.0 37.0 37.0 37.0 8 36.51 37.0 37.0 37.0 37.0 37.0 9 36.4725 37.0 37.0 37.0 37.0 37.0 10-14 36.5021 37.0 37.0 37.0 37.0 37.0 15-19 36.4953 37.0 37.0 37.0 37.0 37.0 20-24 36.4616 37.0 37.0 37.0 37.0 37.0 25-29 36.391200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3416 37.0 37.0 37.0 37.0 37.0 35-39 36.3516 37.0 37.0 37.0 37.0 37.0 40-44 36.285700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.21 37.0 37.0 37.0 37.0 37.0 50-54 36.2468 37.0 37.0 37.0 37.0 37.0 55-59 36.176 37.0 37.0 37.0 37.0 37.0 60-64 36.188100000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.158300000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0807 37.0 37.0 37.0 37.0 37.0 75-79 36.0237 37.0 37.0 37.0 37.0 37.0 80-84 36.112399999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.0355 37.0 37.0 37.0 37.0 37.0 90-94 35.9543 37.0 37.0 37.0 37.0 37.0 95-99 35.8854 37.0 37.0 37.0 37.0 37.0 100-104 35.865500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.766200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.8358 37.0 37.0 37.0 37.0 37.0 115-119 35.6639 37.0 37.0 37.0 37.0 37.0 120-124 35.5889 37.0 37.0 37.0 37.0 37.0 125-129 35.5654 37.0 37.0 37.0 37.0 37.0 130-134 35.5005 37.0 37.0 37.0 37.0 37.0 135-139 35.3241 37.0 37.0 37.0 29.8 37.0 140-144 35.3524 37.0 37.0 37.0 32.2 37.0 145-149 35.1466 37.0 37.0 37.0 27.4 37.0 150-151 34.4915 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 3.0 23 3.0 24 3.0 25 1.0 26 8.0 27 9.0 28 22.0 29 31.0 30 19.0 31 40.0 32 74.0 33 123.0 34 195.0 35 462.0 36 2787.0 37 217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.91460055096419 11.369897320310542 11.044327573253193 40.67117455547208 2 26.150000000000002 16.125 33.875 23.849999999999998 3 23.25 23.200000000000003 23.925 29.625 4 26.650000000000002 29.225 18.675 25.45 5 26.6 30.85 21.5 21.05 6 21.099999999999998 33.675 22.325 22.900000000000002 7 16.950000000000003 20.375 40.9 21.775 8 20.75 20.4 28.15 30.7 9 21.275 19.650000000000002 30.475 28.599999999999998 10-14 22.89 26.445 24.055 26.61 15-19 23.5 25.095 24.555 26.85 20-24 24.065 25.205 24.474999999999998 26.255 25-29 23.54 25.16 24.63 26.669999999999998 30-34 23.575 25.19 24.64 26.595000000000002 35-39 24.22 25.205 24.09 26.484999999999996 40-44 23.845 25.06 24.355 26.740000000000002 45-49 24.13 24.765 24.6 26.505000000000003 50-54 24.41 24.715 24.185000000000002 26.69 55-59 23.785 25.09 24.51 26.615 60-64 24.39 24.595 24.044999999999998 26.97 65-69 24.695 24.525 23.580000000000002 27.200000000000003 70-74 24.545 24.085 24.48 26.889999999999997 75-79 24.315 24.335 24.015 27.334999999999997 80-84 24.709999999999997 24.33 24.095 26.865 85-89 24.36 23.599999999999998 24.54 27.500000000000004 90-94 25.115 24.09 23.93 26.865 95-99 24.95 23.985 24.425 26.640000000000004 100-104 24.67 24.205 24.205 26.919999999999998 105-109 24.945 24.169999999999998 23.87 27.015 110-114 25.064999999999998 24.275 23.65 27.01 115-119 25.185000000000002 23.93 24.025 26.86 120-124 24.945 23.505000000000003 23.925 27.625 125-129 25.88 23.735 23.635 26.75 130-134 25.674999999999997 24.6 23.31 26.415 135-139 25.825 23.1 24.349999999999998 26.724999999999998 140-144 25.485000000000003 23.86 23.65 27.005000000000003 145-149 26.16 23.064999999999998 23.794999999999998 26.979999999999997 150-151 25.900000000000002 23.525 24.0625 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 0.5 25 0.5 26 1.0 27 0.5 28 3.0 29 5.5 30 7.5 31 12.0 32 12.5 33 20.0 34 28.0 35 35.0 36 55.0 37 66.5 38 75.5 39 95.5 40 110.5 41 120.0 42 139.0 43 155.0 44 160.5 45 162.5 46 160.0 47 175.5 48 177.0 49 161.0 50 162.0 51 146.5 52 118.5 53 116.0 54 115.5 55 100.5 56 94.0 57 94.5 58 87.0 59 79.5 60 79.5 61 83.0 62 80.0 63 79.0 64 79.5 65 69.0 66 60.5 67 51.5 68 48.0 69 50.0 70 49.5 71 42.0 72 35.0 73 34.5 74 32.0 75 24.0 76 14.0 77 9.0 78 8.0 79 7.5 80 3.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 95.71913338553902 91.675 2 4.176455233620464 8.0 3 0.07830853563038372 0.22499999999999998 4 0.026102845210127904 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.30000000000000004 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.48750000000000004 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.9125 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.2000000000000002 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138-139 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTTC 10 0.006830828 145.0 3 CATGTGG 10 0.006830828 145.0 4 >>END_MODULE SRR7804180 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804180_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3775 37.0 37.0 37.0 37.0 37.0 2 36.0365 37.0 37.0 37.0 37.0 37.0 3 36.109 37.0 37.0 37.0 37.0 37.0 4 36.2885 37.0 37.0 37.0 37.0 37.0 5 36.3155 37.0 37.0 37.0 37.0 37.0 6 36.0715 37.0 37.0 37.0 37.0 37.0 7 36.084 37.0 37.0 37.0 37.0 37.0 8 36.1905 37.0 37.0 37.0 37.0 37.0 9 36.2245 37.0 37.0 37.0 37.0 37.0 10-14 36.179899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.1472 37.0 37.0 37.0 37.0 37.0 20-24 36.085899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.072199999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.027699999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9099 37.0 37.0 37.0 37.0 37.0 40-44 35.9506 37.0 37.0 37.0 37.0 37.0 45-49 35.8545 37.0 37.0 37.0 37.0 37.0 50-54 35.8652 37.0 37.0 37.0 37.0 37.0 55-59 35.9033 37.0 37.0 37.0 37.0 37.0 60-64 35.7426 37.0 37.0 37.0 37.0 37.0 65-69 35.646 37.0 37.0 37.0 37.0 37.0 70-74 35.6485 37.0 37.0 37.0 37.0 37.0 75-79 35.624300000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.464099999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.4092 37.0 37.0 37.0 37.0 37.0 90-94 35.4661 37.0 37.0 37.0 37.0 37.0 95-99 35.2729 37.0 37.0 37.0 32.2 37.0 100-104 35.2938 37.0 37.0 37.0 34.6 37.0 105-109 35.252300000000005 37.0 37.0 37.0 27.4 37.0 110-114 35.022800000000004 37.0 37.0 37.0 25.0 37.0 115-119 35.0165 37.0 37.0 37.0 25.0 37.0 120-124 35.0067 37.0 37.0 37.0 25.0 37.0 125-129 34.8567 37.0 37.0 37.0 25.0 37.0 130-134 34.8063 37.0 37.0 37.0 25.0 37.0 135-139 34.5812 37.0 37.0 37.0 25.0 37.0 140-144 34.454100000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.382999999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.66375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 5.0 15 1.0 16 2.0 17 1.0 18 3.0 19 2.0 20 3.0 21 2.0 22 4.0 23 6.0 24 12.0 25 10.0 26 12.0 27 10.0 28 16.0 29 24.0 30 38.0 31 52.0 32 88.0 33 169.0 34 323.0 35 881.0 36 2255.0 37 77.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.65 13.975000000000001 14.099999999999998 36.275 2 32.074999999999996 17.849999999999998 29.4 20.674999999999997 3 23.7 22.225 27.950000000000003 26.125 4 28.549999999999997 29.2 19.05 23.200000000000003 5 29.925 30.95 17.474999999999998 21.65 6 23.1 34.175 19.125 23.599999999999998 7 23.175 15.575 35.375 25.874999999999996 8 24.349999999999998 20.625 21.75 33.275 9 24.75 21.175 24.474999999999998 29.599999999999998 10-14 26.76 24.84 22.235 26.165 15-19 26.695 24.19 22.62 26.495 20-24 27.265 23.45 23.05 26.235000000000003 25-29 27.245 24.275 22.400000000000002 26.08 30-34 26.729999999999997 23.825 22.884999999999998 26.56 35-39 27.029999999999998 24.11 23.155 25.705 40-44 28.17 23.115 22.85 25.865 45-49 27.12 23.630000000000003 22.75 26.5 50-54 27.24 24.2 22.52 26.040000000000003 55-59 27.700000000000003 23.3 22.64 26.36 60-64 27.095000000000002 23.65 22.78 26.474999999999998 65-69 26.69 24.315 22.64 26.355 70-74 27.205000000000002 23.775 22.575 26.445 75-79 27.47 24.005000000000003 22.2 26.325 80-84 27.405 23.69 22.73 26.174999999999997 85-89 27.71 23.599999999999998 22.8 25.89 90-94 27.065 23.865 22.955000000000002 26.115 95-99 27.250000000000004 24.22 23.01 25.52 100-104 27.22 23.855 22.675 26.25 105-109 27.615000000000002 24.335 22.445 25.605 110-114 27.779999999999998 23.79 22.795 25.635 115-119 27.279999999999998 24.115000000000002 22.470000000000002 26.135 120-124 27.565 23.615 22.884999999999998 25.935000000000002 125-129 27.57 24.45 22.18 25.8 130-134 27.775 23.685000000000002 22.78 25.759999999999998 135-139 27.425 24.09 23.015 25.47 140-144 28.015 23.7 22.755 25.53 145-149 27.74 24.385 22.795 25.080000000000002 150-151 28.075 23.775 23.45 24.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 2.0 28 1.5 29 2.5 30 2.0 31 1.5 32 3.5 33 8.0 34 14.0 35 15.0 36 26.0 37 46.0 38 55.0 39 64.0 40 78.0 41 101.5 42 135.5 43 149.0 44 149.0 45 160.0 46 162.0 47 159.5 48 148.5 49 145.5 50 137.5 51 126.0 52 121.0 53 104.5 54 109.0 55 104.5 56 91.5 57 87.0 58 90.5 59 97.5 60 86.5 61 88.5 62 103.0 63 106.0 64 100.5 65 94.0 66 85.0 67 78.5 68 84.5 69 87.5 70 73.5 71 55.5 72 52.0 73 47.0 74 34.5 75 31.0 76 26.0 77 17.5 78 10.5 79 4.5 80 6.0 81 5.0 82 1.5 83 0.5 84 1.5 85 1.5 86 0.5 87 1.0 88 1.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.65331238544121 91.325 2 4.032469232783451 7.7 3 0.2618486514794449 0.75 4 0.02618486514794449 0.1 5 0.02618486514794449 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 0.9624999999999999 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138-139 1.5125000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCACAT 10 0.006830828 145.0 4 TCACATC 10 0.006830828 145.0 5 >>END_MODULE Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243673 spots for SRR7804180.sra Written 1243673 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra Read 1243666 spots for SRR7804180.sra Written 1243666 spots for SRR7804180.sra SRR ids: ['SRR7804180.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3yxcujph SRR7804180.sra spots: 24873327 blocks: [[1, 1243666], [1243667, 2487332], [2487333, 3730998], [3730999, 4974664], [4974665, 6218330], [6218331, 7461996], [7461997, 8705662], [8705663, 9949328], [9949329, 11192994], [11192995, 12436660], [12436661, 13680326], [13680327, 14923992], [14923993, 16167658], [16167659, 17411324], [17411325, 18654990], [18654991, 19898656], [19898657, 21142322], [21142323, 22385988], [22385989, 23629654], [23629655, 24873327]] SRR7804180 file size 8407053 SRR7804180 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804180 SRR7804180_1.fastq SRR7804180_2.fastq Input file: SRR7804180_1.fastq Paired file: SRR7804180_2.fastq trimmed: SRR7804180-trimmed-pair1.fastq, SRR7804180-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:55:26 2024 >> started Sat Dec 7 17:56:00 2024 >> done (33.680s) 24873327 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 652 ( 0.00%) empty read pairs filtered out after trimming by size control 24872631 (100.00%) read pairs available; of these: 664757 ( 2.67%) trimmed read pairs available after processing 24207874 (97.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 12 0.00% 21 20 0.00% 22 9 0.00% 23 16 0.00% 24 24 0.00% 25 21 0.00% 26 16 0.00% 27 20 0.00% 28 19 0.00% 29 23 0.00% 30 26 0.00% 31 31 0.00% 32 39 0.00% 33 25 0.00% 34 39 0.00% 35 39 0.00% 36 34 0.00% 37 38 0.00% 38 48 0.00% 39 34 0.00% 40 43 0.00% 41 38 0.00% 42 51 0.00% 43 34 0.00% 44 44 0.00% 45 35 0.00% 46 52 0.00% 47 42 0.00% 48 45 0.00% 49 47 0.00% 50 61 0.00% 51 40 0.00% 52 45 0.00% 53 51 0.00% 54 58 0.00% 55 52 0.00% 56 55 0.00% 57 58 0.00% 58 54 0.00% 59 61 0.00% 60 71 0.00% 61 83 0.00% 62 74 0.00% 63 88 0.00% 64 73 0.00% 65 100 0.00% 66 83 0.00% 67 90 0.00% 68 95 0.00% 69 116 0.00% 70 122 0.00% 71 142 0.00% 72 173 0.00% 73 163 0.00% 74 152 0.00% 75 213 0.00% 76 160 0.00% 77 185 0.00% 78 231 0.00% 79 242 0.00% 80 326 0.00% 81 311 0.00% 82 389 0.00% 83 443 0.00% 84 487 0.00% 85 482 0.00% 86 622 0.00% 87 664 0.00% 88 693 0.00% 89 766 0.00% 90 865 0.00% 91 948 0.00% 92 1075 0.00% 93 1232 0.00% 94 1356 0.01% 95 1553 0.01% 96 1575 0.01% 97 1761 0.01% 98 1889 0.01% 99 2013 0.01% 100 2190 0.01% 101 2414 0.01% 102 2755 0.01% 103 2912 0.01% 104 3163 0.01% 105 3463 0.01% 106 3721 0.01% 107 3895 0.02% 108 4045 0.02% 109 4290 0.02% 110 4717 0.02% 111 4998 0.02% 112 5423 0.02% 113 5870 0.02% 114 6311 0.03% 115 6627 0.03% 116 6958 0.03% 117 7312 0.03% 118 7486 0.03% 119 7861 0.03% 120 8166 0.03% 121 8662 0.03% 122 9135 0.04% 123 9878 0.04% 124 10561 0.04% 125 11338 0.05% 126 11837 0.05% 127 12012 0.05% 128 12196 0.05% 129 12620 0.05% 130 13028 0.05% 131 13670 0.05% 132 14677 0.06% 133 15293 0.06% 134 16611 0.07% 135 17029 0.07% 136 18320 0.07% 137 18593 0.07% 138 19091 0.08% 139 19824 0.08% 140 19997 0.08% 141 20574 0.08% 142 21326 0.09% 143 22178 0.09% 144 23624 0.09% 145 24871 0.10% 146 26333 0.11% 147 27274 0.11% 148 28119 0.11% 149 28406 0.11% 150 29479 0.12% 151 24207874 97.33% 24872631 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=19 prefix-density=0.77 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=31 fanout-score=25.42 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=3.9 sequence=AGCATGGCCCACCTGCAGTGGATCACCTC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=19 prefix-density=0.66 prefix-fanout=2.9 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=19.14 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.3 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCAATTGAGGGCATCAA SRR7804180 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:56:41 Started mapping on | Dec 07 17:56:41 Finished on | Dec 07 18:01:21 Mapping speed, Million of reads per hour | 319.79 Number of input reads | 24872631 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 23190886 Uniquely mapped reads % | 93.24% Average mapped length | 299.73 Number of splices: Total | 22028358 Number of splices: Annotated (sjdb) | 20810784 Number of splices: GT/AG | 21729199 Number of splices: GC/AG | 247617 Number of splices: AT/AC | 7357 Number of splices: Non-canonical | 44185 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318019 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 16544 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.87% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1363726 1363726 1363726 N_multimapping 318019 318019 318019 N_noFeature 516020 22414157 692435 N_ambiguous 695741 3484 95780 UnstrandedReadsAssigned:21979125 PositiveStrandReadsAssigned:773245 NegativeStrandReadsAssigned:22402671 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804180 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804180-trimmed-pair1.fastq SRR7804180-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,872,631 reads, 22,577,552 reads pseudoaligned [quant] estimated average fragment length: 313.315 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR7804180.ke.tsv 35125 SRR7804180.se.tsv 88098 total ==> SRR7804180.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 624.195 32.8674 2.70555 PNS24247 1044 731.685 33.0392 2.32015 PNS24249 1928 1615.68 126.11 4.01055 PNS24246 1044 731.685 33.0392 2.32015 PNS24248 1044 731.685 33.0392 2.32015 PNS24244 1471 1158.68 242.905 10.7717 PNS24243 293 71.8832 1 0.7148 KQK14069 1603 1290.68 4195.64 167.028 KQK14071 474 194.594 14.7763 3.90164 ==> SRR7804180.se.tsv <== BRADI_1g14170v3 4307 BRADI_1g53295v3 554 BRADI_1g59795v3 109 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 913 BRADI_1g74790v3 555 BRADI_1g09890v3 10 BRADI_1g77505v3 466 BRADI_1g48960v3 0 SRR7804180 completed mapping pipeline successfully