Starting /dee2/code/volunteer_pipeline.sh SRR7804181 current disk space = 1540897345536 free memory = 1421748740 SRR7804181 SRAfilesize c2c9963231ebc2f7c9292760db917845 SRR7804181.sra SRR7804181.sra file validated SRR7804181 is paired end SRR7804181 is conventional basespace SRR7804181 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804181_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1975 37.0 37.0 37.0 37.0 37.0 2 36.175 37.0 37.0 37.0 37.0 37.0 3 36.3845 37.0 37.0 37.0 37.0 37.0 4 36.5635 37.0 37.0 37.0 37.0 37.0 5 36.4215 37.0 37.0 37.0 37.0 37.0 6 36.541 37.0 37.0 37.0 37.0 37.0 7 36.3365 37.0 37.0 37.0 37.0 37.0 8 36.4565 37.0 37.0 37.0 37.0 37.0 9 36.4335 37.0 37.0 37.0 37.0 37.0 10-14 36.5463 37.0 37.0 37.0 37.0 37.0 15-19 36.5141 37.0 37.0 37.0 37.0 37.0 20-24 36.4687 37.0 37.0 37.0 37.0 37.0 25-29 36.4465 37.0 37.0 37.0 37.0 37.0 30-34 36.404399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.367 37.0 37.0 37.0 37.0 37.0 40-44 36.37109999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.312400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.292 37.0 37.0 37.0 37.0 37.0 55-59 36.2307 37.0 37.0 37.0 37.0 37.0 60-64 36.2397 37.0 37.0 37.0 37.0 37.0 65-69 36.1956 37.0 37.0 37.0 37.0 37.0 70-74 36.0934 37.0 37.0 37.0 37.0 37.0 75-79 36.087900000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.119600000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0384 37.0 37.0 37.0 37.0 37.0 90-94 35.949 37.0 37.0 37.0 37.0 37.0 95-99 35.8638 37.0 37.0 37.0 37.0 37.0 100-104 35.8977 37.0 37.0 37.0 37.0 37.0 105-109 35.785900000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.8416 37.0 37.0 37.0 37.0 37.0 115-119 35.68339999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.637 37.0 37.0 37.0 37.0 37.0 125-129 35.7158 37.0 37.0 37.0 37.0 37.0 130-134 35.4707 37.0 37.0 37.0 37.0 37.0 135-139 35.45270000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.338699999999996 37.0 37.0 37.0 32.2 37.0 145-149 35.126799999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.522 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 5.0 25 2.0 26 6.0 27 14.0 28 18.0 29 23.0 30 27.0 31 49.0 32 87.0 33 97.0 34 175.0 35 467.0 36 2772.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.50950950950951 10.985985985985986 11.636636636636636 42.86786786786787 2 25.724999999999998 16.675 35.8 21.8 3 23.825 22.525000000000002 23.474999999999998 30.175 4 29.2 29.475 18.125 23.200000000000003 5 27.275 30.75 21.325 20.65 6 21.8 32.05 22.475 23.674999999999997 7 18.275 18.925 41.525 21.275 8 22.05 18.4 27.525 32.025 9 22.6 17.825 30.725 28.849999999999998 10-14 24.03 25.655 23.61 26.705000000000002 15-19 24.68 23.565 24.990000000000002 26.765 20-24 24.29 24.104999999999997 24.685000000000002 26.919999999999998 25-29 24.77 23.47 24.015 27.744999999999997 30-34 24.745 23.915 24.52 26.82 35-39 24.310000000000002 24.4 24.505 26.784999999999997 40-44 25.014999999999997 23.674999999999997 24.740000000000002 26.57 45-49 25.11 24.315 23.645 26.93 50-54 25.080000000000002 24.115000000000002 23.785 27.02 55-59 24.775 24.15 23.974999999999998 27.1 60-64 24.725 24.135 23.525 27.615000000000002 65-69 25.235000000000003 23.53 24.0 27.235 70-74 25.14 23.335 24.23 27.295 75-79 25.52 22.985 24.355 27.139999999999997 80-84 25.290000000000003 23.275000000000002 24.055 27.38 85-89 25.7 23.74 23.525 27.034999999999997 90-94 25.590000000000003 22.785 24.224999999999998 27.400000000000002 95-99 25.814999999999998 23.255 23.62 27.310000000000002 100-104 25.95 23.195 23.7 27.155 105-109 26.075 23.544999999999998 23.235 27.145000000000003 110-114 25.545 22.84 23.945 27.67 115-119 26.650000000000002 23.085 23.200000000000003 27.065 120-124 26.265 23.085 23.735 26.915 125-129 26.41 22.985 23.79 26.815 130-134 25.995 22.755 23.565 27.685 135-139 26.33 23.265 23.155 27.250000000000004 140-144 26.855 22.814999999999998 23.385 26.945000000000004 145-149 26.174999999999997 22.45 24.14 27.235 150-151 27.35 23.0125 22.650000000000002 26.987499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.5 27 2.5 28 2.5 29 4.0 30 3.5 31 6.0 32 10.0 33 15.5 34 23.5 35 28.5 36 37.0 37 53.0 38 67.0 39 87.0 40 103.5 41 118.5 42 138.5 43 152.5 44 150.0 45 156.5 46 166.5 47 151.0 48 154.5 49 158.0 50 135.0 51 133.0 52 133.0 53 109.5 54 89.0 55 91.0 56 108.5 57 105.0 58 90.5 59 89.5 60 100.5 61 104.0 62 93.5 63 88.5 64 90.0 65 87.0 66 82.0 67 73.0 68 61.0 69 60.5 70 55.5 71 47.0 72 41.5 73 34.0 74 30.0 75 23.5 76 15.5 77 9.5 78 9.5 79 6.0 80 2.0 81 2.0 82 1.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.0 #Duplication Level Percentage of deduplicated Percentage of total 1 95.02631578947368 90.275 2 4.7105263157894735 8.95 3 0.2368421052631579 0.675 4 0.02631578947368421 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.48750000000000004 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.1125 0.0 0.0 0.0 0.0 136-137 1.1875 0.0 0.0 0.0 0.0 138-139 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTGGT 10 0.006830828 145.0 5 >>END_MODULE SRR7804181 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804181_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5475 37.0 37.0 37.0 37.0 37.0 2 36.2145 37.0 37.0 37.0 37.0 37.0 3 36.325 37.0 37.0 37.0 37.0 37.0 4 36.3135 37.0 37.0 37.0 37.0 37.0 5 36.3555 37.0 37.0 37.0 37.0 37.0 6 36.3035 37.0 37.0 37.0 37.0 37.0 7 36.194 37.0 37.0 37.0 37.0 37.0 8 36.33 37.0 37.0 37.0 37.0 37.0 9 36.2875 37.0 37.0 37.0 37.0 37.0 10-14 36.237 37.0 37.0 37.0 37.0 37.0 15-19 36.179 37.0 37.0 37.0 37.0 37.0 20-24 36.1832 37.0 37.0 37.0 37.0 37.0 25-29 36.0955 37.0 37.0 37.0 37.0 37.0 30-34 36.12 37.0 37.0 37.0 37.0 37.0 35-39 36.0473 37.0 37.0 37.0 37.0 37.0 40-44 36.0053 37.0 37.0 37.0 37.0 37.0 45-49 35.9285 37.0 37.0 37.0 37.0 37.0 50-54 35.934000000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.9154 37.0 37.0 37.0 37.0 37.0 60-64 35.790499999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.807100000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.68429999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.720600000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.5972 37.0 37.0 37.0 37.0 37.0 85-89 35.522800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.412 37.0 37.0 37.0 37.0 37.0 95-99 35.3343 37.0 37.0 37.0 34.6 37.0 100-104 35.2461 37.0 37.0 37.0 32.2 37.0 105-109 35.243100000000005 37.0 37.0 37.0 32.2 37.0 110-114 35.1759 37.0 37.0 37.0 25.0 37.0 115-119 35.04280000000001 37.0 37.0 37.0 25.0 37.0 120-124 34.938599999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.838699999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.9045 37.0 37.0 37.0 25.0 37.0 135-139 34.5887 37.0 37.0 37.0 25.0 37.0 140-144 34.4882 37.0 37.0 37.0 25.0 37.0 145-149 34.371 37.0 37.0 37.0 25.0 37.0 150-151 33.58275 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 2.0 16 6.0 17 2.0 18 3.0 19 1.0 20 3.0 21 4.0 22 2.0 23 5.0 24 8.0 25 10.0 26 16.0 27 14.0 28 16.0 29 29.0 30 40.0 31 57.0 32 81.0 33 159.0 34 297.0 35 751.0 36 2406.0 37 85.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.9 10.65 13.05 43.4 2 29.349999999999998 17.4 29.925 23.325000000000003 3 25.1 21.025 27.0 26.875 4 27.775 29.825000000000003 16.425 25.974999999999998 5 28.875 31.874999999999996 16.925 22.325 6 23.150000000000002 32.125 18.875 25.85 7 22.275 13.850000000000001 36.15 27.725 8 23.400000000000002 18.8 22.475 35.325 9 25.0 19.55 25.074999999999996 30.375000000000004 10-14 26.715 23.925 21.3 28.060000000000002 15-19 26.825 23.905 22.085 27.185 20-24 26.365 24.365000000000002 21.48 27.79 25-29 26.924999999999997 23.474999999999998 21.634999999999998 27.965 30-34 27.145000000000003 23.435 21.975 27.445000000000004 35-39 27.305 24.035 21.23 27.43 40-44 27.305 23.5 21.52 27.675 45-49 27.310000000000002 23.31 22.165000000000003 27.215 50-54 27.169999999999998 23.53 21.375 27.925 55-59 26.995 23.5 21.75 27.755000000000003 60-64 27.51 22.985 21.42 28.084999999999997 65-69 27.900000000000002 22.735 21.915000000000003 27.450000000000003 70-74 26.935 22.98 22.105 27.98 75-79 27.35 22.825 21.94 27.884999999999998 80-84 27.715 23.494999999999997 21.62 27.169999999999998 85-89 27.73 22.74 21.89 27.639999999999997 90-94 27.435 23.7 21.695 27.169999999999998 95-99 27.62 23.505000000000003 22.189999999999998 26.685 100-104 27.87 22.634999999999998 22.18 27.315 105-109 27.08 23.145 22.165000000000003 27.61 110-114 27.775 23.575 21.88 26.77 115-119 27.83 22.875 21.725 27.57 120-124 27.715 23.72 21.905 26.66 125-129 27.650000000000002 23.974999999999998 21.834999999999997 26.540000000000003 130-134 27.639999999999997 22.925 22.3 27.134999999999998 135-139 27.755000000000003 23.53 22.235 26.479999999999997 140-144 28.165000000000003 24.025 21.29 26.52 145-149 27.525 24.14 21.82 26.515 150-151 29.25 23.8875 22.7 24.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 1.0 29 2.5 30 3.0 31 3.0 32 3.5 33 4.0 34 10.0 35 17.0 36 28.5 37 46.0 38 47.5 39 58.0 40 79.0 41 93.0 42 106.5 43 118.5 44 123.5 45 120.5 46 133.5 47 146.0 48 143.5 49 127.0 50 116.5 51 123.5 52 113.0 53 97.0 54 96.5 55 100.5 56 91.0 57 89.0 58 102.5 59 105.0 60 103.5 61 114.5 62 125.5 63 119.5 64 119.0 65 111.0 66 97.5 67 96.0 68 97.5 69 93.5 70 82.5 71 74.5 72 69.0 73 58.5 74 45.0 75 37.0 76 28.5 77 16.0 78 12.5 79 11.5 80 5.5 81 4.5 82 3.0 83 0.5 84 2.5 85 4.0 86 2.0 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.025 #Duplication Level Percentage of deduplicated Percentage of total 1 94.68226535495879 89.025 2 4.653017814411061 8.75 3 0.3988300983780909 1.125 4 0.15953203935123636 0.6 5 0.10635469290082426 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit CGCAACCGTCGCGCCCCGCGCTAAGAGCGTCGTCGTCGCCAGCCTCGGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.45 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.7749999999999999 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 1.025 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138-139 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414648 spots for SRR7804181.sra Written 1414648 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra Read 1414646 spots for SRR7804181.sra Written 1414646 spots for SRR7804181.sra SRR ids: ['SRR7804181.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t98_py2m SRR7804181.sra spots: 28292922 blocks: [[1, 1414646], [1414647, 2829292], [2829293, 4243938], [4243939, 5658584], [5658585, 7073230], [7073231, 8487876], [8487877, 9902522], [9902523, 11317168], [11317169, 12731814], [12731815, 14146460], [14146461, 15561106], [15561107, 16975752], [16975753, 18390398], [18390399, 19805044], [19805045, 21219690], [21219691, 22634336], [22634337, 24048982], [24048983, 25463628], [25463629, 26878274], [26878275, 28292922]] SRR7804181 file size 9565842 SRR7804181 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804181 SRR7804181_1.fastq SRR7804181_2.fastq Input file: SRR7804181_1.fastq Paired file: SRR7804181_2.fastq trimmed: SRR7804181-trimmed-pair1.fastq, SRR7804181-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:57:05 2024 >> started Sat Dec 7 17:57:44 2024 >> done (38.748s) 28292922 read pairs processed; of these: 59 ( 0.00%) short read pairs filtered out after trimming by size control 408 ( 0.00%) empty read pairs filtered out after trimming by size control 28292455 (100.00%) read pairs available; of these: 789040 ( 2.79%) trimmed read pairs available after processing 27503415 (97.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 11 0.00% 20 19 0.00% 21 19 0.00% 22 18 0.00% 23 21 0.00% 24 26 0.00% 25 26 0.00% 26 35 0.00% 27 36 0.00% 28 36 0.00% 29 32 0.00% 30 33 0.00% 31 42 0.00% 32 48 0.00% 33 49 0.00% 34 37 0.00% 35 50 0.00% 36 61 0.00% 37 54 0.00% 38 64 0.00% 39 73 0.00% 40 64 0.00% 41 64 0.00% 42 77 0.00% 43 67 0.00% 44 60 0.00% 45 78 0.00% 46 81 0.00% 47 66 0.00% 48 72 0.00% 49 86 0.00% 50 101 0.00% 51 71 0.00% 52 77 0.00% 53 105 0.00% 54 104 0.00% 55 97 0.00% 56 111 0.00% 57 110 0.00% 58 90 0.00% 59 112 0.00% 60 105 0.00% 61 111 0.00% 62 109 0.00% 63 125 0.00% 64 117 0.00% 65 125 0.00% 66 157 0.00% 67 154 0.00% 68 157 0.00% 69 181 0.00% 70 159 0.00% 71 171 0.00% 72 196 0.00% 73 202 0.00% 74 234 0.00% 75 249 0.00% 76 248 0.00% 77 313 0.00% 78 293 0.00% 79 346 0.00% 80 363 0.00% 81 406 0.00% 82 444 0.00% 83 499 0.00% 84 507 0.00% 85 632 0.00% 86 718 0.00% 87 740 0.00% 88 830 0.00% 89 953 0.00% 90 1077 0.00% 91 1092 0.00% 92 1273 0.00% 93 1436 0.01% 94 1578 0.01% 95 1835 0.01% 96 1943 0.01% 97 2145 0.01% 98 2306 0.01% 99 2448 0.01% 100 2702 0.01% 101 2919 0.01% 102 3147 0.01% 103 3588 0.01% 104 3791 0.01% 105 4071 0.01% 106 4486 0.02% 107 4743 0.02% 108 4959 0.02% 109 5514 0.02% 110 5604 0.02% 111 6086 0.02% 112 6371 0.02% 113 7042 0.02% 114 7388 0.03% 115 8051 0.03% 116 8453 0.03% 117 8730 0.03% 118 9191 0.03% 119 9636 0.03% 120 10045 0.04% 121 10587 0.04% 122 11085 0.04% 123 11680 0.04% 124 12571 0.04% 125 13225 0.05% 126 13545 0.05% 127 14357 0.05% 128 14785 0.05% 129 15569 0.06% 130 16323 0.06% 131 16927 0.06% 132 17929 0.06% 133 18484 0.07% 134 19568 0.07% 135 20167 0.07% 136 20969 0.07% 137 21861 0.08% 138 22548 0.08% 139 23211 0.08% 140 24072 0.09% 141 25090 0.09% 142 25788 0.09% 143 26603 0.09% 144 27739 0.10% 145 28359 0.10% 146 29679 0.10% 147 31489 0.11% 148 32305 0.11% 149 32584 0.12% 150 33950 0.12% 151 27503415 97.21% 28292455 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=21 prefix-density=0.87 prefix-fanout=2.3 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=13.09 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=2.9 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGTGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAG criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=15 prefix-density=0.80 prefix-fanout=2.8 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=134.70 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=4.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804181 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 17:58:37 Started mapping on | Dec 07 17:58:37 Finished on | Dec 07 18:03:05 Mapping speed, Million of reads per hour | 380.05 Number of input reads | 28292455 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 26874053 Uniquely mapped reads % | 94.99% Average mapped length | 300.02 Number of splices: Total | 28101691 Number of splices: Annotated (sjdb) | 26617531 Number of splices: GT/AG | 27690221 Number of splices: GC/AG | 365984 Number of splices: AT/AC | 9934 Number of splices: Non-canonical | 35552 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.56 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225854 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 17653 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1192548 1192548 1192548 N_multimapping 225854 225854 225854 N_noFeature 615336 26007764 804539 N_ambiguous 807796 4196 130565 UnstrandedReadsAssigned:25450921 PositiveStrandReadsAssigned:862093 NegativeStrandReadsAssigned:25938949 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804181 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804181-trimmed-pair1.fastq SRR7804181-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,292,455 reads, 26,015,257 reads pseudoaligned [quant] estimated average fragment length: 321.132 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,346 rounds 52973 SRR7804181.ke.tsv 35125 SRR7804181.se.tsv 88098 total ==> SRR7804181.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 616.629 0 0 PNS24247 1044 723.868 67.0098 4.28247 PNS24249 1928 1607.87 82.6711 2.37859 PNS24246 1044 723.868 67.0098 4.28247 PNS24248 1044 723.868 67.0098 4.28247 PNS24244 1471 1150.87 118.3 4.75526 PNS24243 293 72.8103 0 0 KQK14069 1603 1282.87 395.73 14.2703 KQK14071 474 192.722 27.767 6.66522 ==> SRR7804181.se.tsv <== BRADI_1g14170v3 511 BRADI_1g53295v3 282 BRADI_1g59795v3 772 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 419 BRADI_1g74790v3 473 BRADI_1g09890v3 0 BRADI_1g77505v3 412 BRADI_1g48960v3 0 SRR7804181 completed mapping pipeline successfully