Starting /dee2/code/volunteer_pipeline.sh SRR7804182 current disk space = 1525987205120 free memory = 1599782544 SRR7804182 SRAfilesize 8f390d35d476b7163ad3873f68495bf1 SRR7804182.sra SRR7804182.sra file validated SRR7804182 is paired end SRR7804182 is conventional basespace SRR7804182 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804182_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.146 37.0 37.0 37.0 37.0 37.0 2 36.301 37.0 37.0 37.0 37.0 37.0 3 36.3135 37.0 37.0 37.0 37.0 37.0 4 36.5125 37.0 37.0 37.0 37.0 37.0 5 36.5075 37.0 37.0 37.0 37.0 37.0 6 36.524 37.0 37.0 37.0 37.0 37.0 7 36.3025 37.0 37.0 37.0 37.0 37.0 8 36.4785 37.0 37.0 37.0 37.0 37.0 9 36.341 37.0 37.0 37.0 37.0 37.0 10-14 36.5295 37.0 37.0 37.0 37.0 37.0 15-19 36.5247 37.0 37.0 37.0 37.0 37.0 20-24 36.4947 37.0 37.0 37.0 37.0 37.0 25-29 36.4355 37.0 37.0 37.0 37.0 37.0 30-34 36.42810000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.3999 37.0 37.0 37.0 37.0 37.0 40-44 36.4011 37.0 37.0 37.0 37.0 37.0 45-49 36.2567 37.0 37.0 37.0 37.0 37.0 50-54 36.26719999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.2278 37.0 37.0 37.0 37.0 37.0 60-64 36.185900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.1808 37.0 37.0 37.0 37.0 37.0 70-74 36.1372 37.0 37.0 37.0 37.0 37.0 75-79 36.0711 37.0 37.0 37.0 37.0 37.0 80-84 36.0514 37.0 37.0 37.0 37.0 37.0 85-89 36.064099999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.955799999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8519 37.0 37.0 37.0 37.0 37.0 100-104 35.8604 37.0 37.0 37.0 37.0 37.0 105-109 35.8239 37.0 37.0 37.0 37.0 37.0 110-114 35.8104 37.0 37.0 37.0 37.0 37.0 115-119 35.7197 37.0 37.0 37.0 37.0 37.0 120-124 35.587599999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.59349999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.4416 37.0 37.0 37.0 37.0 37.0 135-139 35.4125 37.0 37.0 37.0 34.6 37.0 140-144 35.409800000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.153 37.0 37.0 37.0 27.4 37.0 150-151 34.4775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 4.0 24 2.0 25 4.0 26 11.0 27 4.0 28 9.0 29 22.0 30 36.0 31 44.0 32 58.0 33 138.0 34 185.0 35 452.0 36 2784.0 37 244.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.44110275689223 13.032581453634084 9.423558897243108 41.10275689223057 2 23.275000000000002 19.225 35.075 22.425 3 24.4 22.85 22.650000000000002 30.099999999999998 4 26.525 30.85 19.675 22.95 5 25.4 33.25 22.125 19.225 6 21.65 32.2 23.825 22.325 7 17.474999999999998 18.925 41.0 22.6 8 20.65 20.349999999999998 25.6 33.4 9 21.45 19.15 31.8 27.6 10-14 22.869999999999997 25.885 24.635 26.61 15-19 23.53 25.369999999999997 25.045 26.055 20-24 24.275 24.58 24.785 26.36 25-29 23.685000000000002 25.195 24.79 26.33 30-34 24.015 25.05 24.89 26.045 35-39 23.915 25.224999999999998 25.480000000000004 25.380000000000003 40-44 23.98 24.535 25.080000000000002 26.405 45-49 23.745 25.169999999999998 24.925 26.16 50-54 23.31 24.735 25.180000000000003 26.775 55-59 23.955000000000002 24.7 25.21 26.135 60-64 24.01 24.145 25.369999999999997 26.474999999999998 65-69 24.27 24.58 24.395 26.755000000000003 70-74 24.645 24.19 24.77 26.395000000000003 75-79 24.675 24.325 24.560000000000002 26.44 80-84 24.275 23.825 24.779999999999998 27.12 85-89 25.145 24.81 24.14 25.905 90-94 24.555 24.025 25.045 26.375 95-99 24.89 24.645 24.21 26.255 100-104 25.25 25.009999999999998 23.785 25.955000000000002 105-109 25.119999999999997 24.295 24.32 26.265 110-114 25.674999999999997 24.18 23.78 26.365 115-119 24.92 23.905 23.825 27.35 120-124 24.79 24.169999999999998 24.6 26.44 125-129 25.085 23.69 24.33 26.895000000000003 130-134 25.430000000000003 24.375 23.79 26.405 135-139 25.445 24.104999999999997 23.765 26.685 140-144 25.28 23.435 23.91 27.375 145-149 25.205 24.675 23.380000000000003 26.740000000000002 150-151 26.375 23.875 24.025 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.0 27 2.5 28 4.5 29 7.0 30 7.0 31 12.5 32 17.0 33 19.5 34 24.0 35 32.0 36 48.0 37 57.0 38 74.0 39 97.0 40 113.5 41 140.5 42 170.5 43 181.0 44 168.0 45 184.0 46 204.5 47 189.5 48 173.0 49 162.5 50 144.0 51 131.0 52 115.0 53 104.0 54 101.5 55 89.5 56 89.5 57 84.5 58 84.0 59 86.0 60 81.0 61 75.5 62 60.0 63 60.5 64 65.5 65 66.0 66 63.0 67 60.5 68 61.0 69 51.0 70 43.0 71 36.5 72 27.5 73 23.5 74 27.0 75 22.5 76 17.0 77 12.5 78 7.5 79 4.5 80 1.5 81 1.0 82 2.0 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.04741833508957 90.2 2 4.636459430979979 8.799999999999999 3 0.23709167544783985 0.675 4 0.052687038988408846 0.2 5 0.026343519494204423 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.45 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.5 0.0 0.0 0.0 0.0 130-131 0.575 0.0 0.0 0.0 0.0 132-133 0.6375 0.0 0.0 0.0 0.0 134-135 0.7375 0.0 0.0 0.0 0.0 136-137 0.8875 0.0 0.0 0.0 0.0 138-139 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804182 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804182_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.489 37.0 37.0 37.0 37.0 37.0 2 36.251 37.0 37.0 37.0 37.0 37.0 3 36.3255 37.0 37.0 37.0 37.0 37.0 4 36.3495 37.0 37.0 37.0 37.0 37.0 5 36.4345 37.0 37.0 37.0 37.0 37.0 6 36.264 37.0 37.0 37.0 37.0 37.0 7 36.23 37.0 37.0 37.0 37.0 37.0 8 36.376 37.0 37.0 37.0 37.0 37.0 9 36.413 37.0 37.0 37.0 37.0 37.0 10-14 36.3388 37.0 37.0 37.0 37.0 37.0 15-19 36.266099999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2192 37.0 37.0 37.0 37.0 37.0 25-29 36.1709 37.0 37.0 37.0 37.0 37.0 30-34 36.20870000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.14040000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.117 37.0 37.0 37.0 37.0 37.0 45-49 36.053799999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.979499999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.9568 37.0 37.0 37.0 37.0 37.0 60-64 35.90769999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.832499999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8195 37.0 37.0 37.0 37.0 37.0 75-79 35.766999999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.684 37.0 37.0 37.0 37.0 37.0 85-89 35.6466 37.0 37.0 37.0 37.0 37.0 90-94 35.6031 37.0 37.0 37.0 37.0 37.0 95-99 35.4903 37.0 37.0 37.0 37.0 37.0 100-104 35.4413 37.0 37.0 37.0 37.0 37.0 105-109 35.430099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.2807 37.0 37.0 37.0 32.2 37.0 115-119 35.1419 37.0 37.0 37.0 27.4 37.0 120-124 35.1218 37.0 37.0 37.0 25.0 37.0 125-129 34.965199999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.9722 37.0 37.0 37.0 25.0 37.0 135-139 34.7955 37.0 37.0 37.0 25.0 37.0 140-144 34.5406 37.0 37.0 37.0 25.0 37.0 145-149 34.4273 37.0 37.0 37.0 25.0 37.0 150-151 33.72175 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 1.0 17 1.0 18 0.0 19 3.0 20 1.0 21 2.0 22 6.0 23 5.0 24 6.0 25 8.0 26 3.0 27 14.0 28 12.0 29 20.0 30 46.0 31 48.0 32 89.0 33 151.0 34 289.0 35 803.0 36 2409.0 37 79.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.25 13.3 12.975 38.475 2 28.349999999999998 19.325 31.924999999999997 20.4 3 22.8 21.575 27.400000000000002 28.225 4 27.500000000000004 30.7 18.325 23.474999999999998 5 27.700000000000003 31.624999999999996 19.15 21.525 6 22.225 33.800000000000004 19.475 24.5 7 22.3 14.025000000000002 37.175000000000004 26.5 8 22.075 20.5 23.1 34.325 9 23.724999999999998 21.5 26.150000000000002 28.625 10-14 25.924999999999997 24.68 22.52 26.875 15-19 26.224999999999998 23.76 23.494999999999997 26.52 20-24 26.245 23.799999999999997 22.985 26.97 25-29 26.715 23.57 23.25 26.465 30-34 26.625 23.64 23.09 26.645000000000003 35-39 26.895000000000003 23.76 23.21 26.135 40-44 27.495000000000005 23.330000000000002 23.125 26.05 45-49 26.950000000000003 23.175 23.11 26.765 50-54 26.5 24.095 22.695 26.71 55-59 27.02 23.05 22.915 27.015 60-64 26.07 23.94 23.189999999999998 26.8 65-69 26.919999999999998 23.169999999999998 23.345 26.565 70-74 26.21 22.85 23.169999999999998 27.77 75-79 26.71 22.955000000000002 23.294999999999998 27.04 80-84 27.0 23.415 22.975 26.61 85-89 27.224999999999998 23.630000000000003 22.82 26.325 90-94 26.784999999999997 23.59 23.435 26.19 95-99 26.784999999999997 23.71 23.26 26.245 100-104 26.900000000000002 23.695 22.795 26.61 105-109 26.72 23.685000000000002 22.814999999999998 26.779999999999998 110-114 27.195000000000004 23.235 22.939999999999998 26.63 115-119 27.425 23.26 22.98 26.334999999999997 120-124 27.435 23.16 23.005 26.400000000000002 125-129 27.139999999999997 23.255 23.494999999999997 26.11 130-134 27.389999999999997 23.935000000000002 22.865 25.81 135-139 27.32 23.69 22.965 26.025 140-144 27.46 23.285 23.005 26.25 145-149 27.74 23.645 23.330000000000002 25.285000000000004 150-151 27.625 24.762500000000003 22.5875 25.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 1.5 28 4.5 29 5.0 30 6.5 31 6.5 32 7.0 33 14.5 34 25.5 35 30.0 36 34.5 37 50.0 38 64.5 39 86.0 40 95.5 41 101.0 42 122.5 43 134.5 44 134.0 45 151.0 46 166.0 47 158.5 48 158.0 49 140.5 50 124.5 51 124.5 52 109.5 53 95.5 54 82.5 55 84.0 56 92.0 57 91.0 58 93.5 59 93.5 60 89.0 61 85.5 62 84.0 63 89.0 64 90.0 65 86.0 66 83.0 67 87.0 68 94.5 69 90.5 70 81.5 71 60.5 72 53.5 73 53.5 74 46.5 75 39.5 76 25.0 77 17.5 78 14.5 79 13.5 80 9.0 81 3.5 82 4.0 83 3.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.59962756052141 88.9 2 4.735301942005853 8.9 3 0.4788507581803671 1.35 4 0.13301409949454643 0.5 5 0.0 0.0 6 0.026602819898909287 0.15 7 0.0 0.0 8 0.026602819898909287 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 8 0.2 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.525 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.6000000000000001 0.0 0.0 0.0 0.0 132-133 0.6625000000000001 0.0 0.0 0.0 0.0 134-135 0.7625 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584744 spots for SRR7804182.sra Written 1584744 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra Read 1584740 spots for SRR7804182.sra Written 1584740 spots for SRR7804182.sra SRR ids: ['SRR7804182.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bril6cfq SRR7804182.sra spots: 31694804 blocks: [[1, 1584740], [1584741, 3169480], [3169481, 4754220], [4754221, 6338960], [6338961, 7923700], [7923701, 9508440], [9508441, 11093180], [11093181, 12677920], [12677921, 14262660], [14262661, 15847400], [15847401, 17432140], [17432141, 19016880], [19016881, 20601620], [20601621, 22186360], [22186361, 23771100], [23771101, 25355840], [25355841, 26940580], [26940581, 28525320], [28525321, 30110060], [30110061, 31694804]] SRR7804182 file size 10718628 SRR7804182 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804182 SRR7804182_1.fastq SRR7804182_2.fastq Input file: SRR7804182_1.fastq Paired file: SRR7804182_2.fastq trimmed: SRR7804182-trimmed-pair1.fastq, SRR7804182-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:28:58 2024 >> started Tue Dec 10 03:29:36 2024 >> done (38.020s) 31694804 read pairs processed; of these: 82 ( 0.00%) short read pairs filtered out after trimming by size control 601 ( 0.00%) empty read pairs filtered out after trimming by size control 31694121 (100.00%) read pairs available; of these: 672490 ( 2.12%) trimmed read pairs available after processing 31021631 (97.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 13 0.00% 20 11 0.00% 21 23 0.00% 22 19 0.00% 23 21 0.00% 24 26 0.00% 25 27 0.00% 26 23 0.00% 27 34 0.00% 28 28 0.00% 29 28 0.00% 30 27 0.00% 31 36 0.00% 32 43 0.00% 33 41 0.00% 34 43 0.00% 35 42 0.00% 36 37 0.00% 37 36 0.00% 38 40 0.00% 39 48 0.00% 40 59 0.00% 41 45 0.00% 42 48 0.00% 43 61 0.00% 44 74 0.00% 45 55 0.00% 46 57 0.00% 47 76 0.00% 48 61 0.00% 49 60 0.00% 50 66 0.00% 51 83 0.00% 52 81 0.00% 53 65 0.00% 54 80 0.00% 55 78 0.00% 56 87 0.00% 57 72 0.00% 58 79 0.00% 59 96 0.00% 60 108 0.00% 61 101 0.00% 62 104 0.00% 63 86 0.00% 64 96 0.00% 65 107 0.00% 66 124 0.00% 67 126 0.00% 68 127 0.00% 69 143 0.00% 70 163 0.00% 71 166 0.00% 72 195 0.00% 73 199 0.00% 74 213 0.00% 75 249 0.00% 76 282 0.00% 77 260 0.00% 78 315 0.00% 79 400 0.00% 80 428 0.00% 81 469 0.00% 82 533 0.00% 83 595 0.00% 84 584 0.00% 85 680 0.00% 86 749 0.00% 87 865 0.00% 88 936 0.00% 89 1057 0.00% 90 1101 0.00% 91 1244 0.00% 92 1354 0.00% 93 1446 0.00% 94 1739 0.01% 95 1883 0.01% 96 1964 0.01% 97 2106 0.01% 98 2293 0.01% 99 2408 0.01% 100 2620 0.01% 101 2818 0.01% 102 3006 0.01% 103 3268 0.01% 104 3451 0.01% 105 3879 0.01% 106 4136 0.01% 107 4069 0.01% 108 4498 0.01% 109 4858 0.02% 110 4874 0.02% 111 5317 0.02% 112 5606 0.02% 113 5975 0.02% 114 6528 0.02% 115 7085 0.02% 116 7085 0.02% 117 7290 0.02% 118 7663 0.02% 119 7941 0.03% 120 8267 0.03% 121 9105 0.03% 122 9464 0.03% 123 9837 0.03% 124 10508 0.03% 125 11127 0.04% 126 11802 0.04% 127 12325 0.04% 128 12424 0.04% 129 12867 0.04% 130 13356 0.04% 131 13795 0.04% 132 14709 0.05% 133 15525 0.05% 134 16356 0.05% 135 16772 0.05% 136 17673 0.06% 137 18016 0.06% 138 18821 0.06% 139 19528 0.06% 140 20129 0.06% 141 20095 0.06% 142 21406 0.07% 143 22519 0.07% 144 23628 0.07% 145 24297 0.08% 146 25398 0.08% 147 26569 0.08% 148 27380 0.09% 149 27803 0.09% 150 28980 0.09% 151 31021631 97.88% 31694121 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=34 prefix-density=0.52 prefix-fanout=2.1 sequence=AGCAGCTCGGGGAAGACGCA criterion=fanout-score sequence-density=0.23 sequence-density-rank=35 fanout-score=15.14 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=5.2 sequence=ACTTGCCGGGAAC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=24 prefix-density=0.80 prefix-fanout=2.8 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=119.20 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.0 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804182 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:30:36 Started mapping on | Dec 10 03:30:36 Finished on | Dec 10 03:35:18 Mapping speed, Million of reads per hour | 404.61 Number of input reads | 31694121 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 30251121 Uniquely mapped reads % | 95.45% Average mapped length | 300.18 Number of splices: Total | 31197077 Number of splices: Annotated (sjdb) | 29386978 Number of splices: GT/AG | 30770083 Number of splices: GC/AG | 371218 Number of splices: AT/AC | 10902 Number of splices: Non-canonical | 44874 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.53 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281414 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 25931 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1161586 1161586 1161586 N_multimapping 281414 281414 281414 N_noFeature 1086337 29374944 1330543 N_ambiguous 773890 5178 141929 UnstrandedReadsAssigned:28390894 PositiveStrandReadsAssigned:870999 NegativeStrandReadsAssigned:28778649 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804182 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804182-trimmed-pair1.fastq SRR7804182-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,694,121 reads, 28,937,297 reads pseudoaligned [quant] estimated average fragment length: 339.132 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR7804182.ke.tsv 35125 SRR7804182.se.tsv 88098 total ==> SRR7804182.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 599.16 0 0 PNS24247 1044 705.868 52.5001 3.36192 PNS24249 1928 1589.87 220.264 6.26227 PNS24246 1044 705.868 52.5001 3.36192 PNS24248 1044 705.868 52.5001 3.36192 PNS24244 1471 1132.87 154.236 6.15399 PNS24243 293 69.6935 0 0 KQK14069 1603 1264.87 4372.77 156.265 KQK14071 474 185.13 61.4195 14.9962 ==> SRR7804182.se.tsv <== BRADI_1g14170v3 5030 BRADI_1g53295v3 188 BRADI_1g59795v3 492 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 679 BRADI_1g74790v3 609 BRADI_1g09890v3 3 BRADI_1g77505v3 523 BRADI_1g48960v3 0 SRR7804182 completed mapping pipeline successfully