Starting /dee2/code/volunteer_pipeline.sh SRR7804183 current disk space = 1526020001792 free memory = 1599161196 SRR7804183 SRAfilesize 3288cfdb785d7e0f6dd955c97244a62a SRR7804183.sra SRR7804183.sra file validated SRR7804183 is paired end SRR7804183 is conventional basespace SRR7804183 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804183_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.00475 37.0 37.0 37.0 37.0 37.0 2 36.2215 37.0 37.0 37.0 37.0 37.0 3 36.35 37.0 37.0 37.0 37.0 37.0 4 36.4605 37.0 37.0 37.0 37.0 37.0 5 36.4215 37.0 37.0 37.0 37.0 37.0 6 36.4565 37.0 37.0 37.0 37.0 37.0 7 36.274 37.0 37.0 37.0 37.0 37.0 8 36.4245 37.0 37.0 37.0 37.0 37.0 9 36.418 37.0 37.0 37.0 37.0 37.0 10-14 36.4684 37.0 37.0 37.0 37.0 37.0 15-19 36.3974 37.0 37.0 37.0 37.0 37.0 20-24 36.408300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3963 37.0 37.0 37.0 37.0 37.0 30-34 36.331 37.0 37.0 37.0 37.0 37.0 35-39 36.2949 37.0 37.0 37.0 37.0 37.0 40-44 36.2781 37.0 37.0 37.0 37.0 37.0 45-49 36.240700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.19199999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.1745 37.0 37.0 37.0 37.0 37.0 60-64 36.18079999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.1421 37.0 37.0 37.0 37.0 37.0 70-74 36.067 37.0 37.0 37.0 37.0 37.0 75-79 35.96490000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0285 37.0 37.0 37.0 37.0 37.0 85-89 35.9835 37.0 37.0 37.0 37.0 37.0 90-94 35.88009999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.8183 37.0 37.0 37.0 37.0 37.0 100-104 35.7376 37.0 37.0 37.0 37.0 37.0 105-109 35.7351 37.0 37.0 37.0 37.0 37.0 110-114 35.775999999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.62320000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.508500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.470000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.3943 37.0 37.0 37.0 34.6 37.0 135-139 35.2519 37.0 37.0 37.0 29.8 37.0 140-144 35.2578 37.0 37.0 37.0 32.2 37.0 145-149 35.0346 37.0 37.0 37.0 25.0 37.0 150-151 34.515249999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 6.0 25 5.0 26 6.0 27 12.0 28 16.0 29 30.0 30 35.0 31 65.0 32 86.0 33 108.0 34 197.0 35 484.0 36 2742.0 37 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.26638212402712 13.055485814712528 11.172483052975144 42.50564900828521 2 24.099999999999998 18.125 36.825 20.95 3 22.575 23.75 23.875 29.799999999999997 4 26.174999999999997 32.0 19.2 22.625 5 24.825 33.800000000000004 22.625 18.75 6 21.0 32.9 22.925 23.175 7 16.225 19.125 41.375 23.275000000000002 8 20.575 20.349999999999998 27.05 32.025 9 20.974999999999998 18.15 30.875000000000004 30.0 10-14 23.21 26.795 23.905 26.090000000000003 15-19 24.0 25.45 24.654999999999998 25.895000000000003 20-24 23.445 25.124999999999996 24.805 26.625 25-29 23.830000000000002 24.725 25.580000000000002 25.865 30-34 23.419999999999998 25.165 25.319999999999997 26.095000000000002 35-39 23.02 25.724999999999998 25.040000000000003 26.215 40-44 23.794999999999998 25.34 24.985 25.88 45-49 23.549999999999997 25.195 25.009999999999998 26.245 50-54 23.5 25.569999999999997 24.349999999999998 26.58 55-59 23.86 25.569999999999997 24.875 25.695 60-64 24.16 24.45 24.775 26.615 65-69 24.43 25.040000000000003 24.709999999999997 25.82 70-74 23.919999999999998 24.48 25.27 26.33 75-79 24.3 24.815 25.06 25.825 80-84 24.435000000000002 24.425 24.66 26.479999999999997 85-89 24.42 24.525 25.16 25.895000000000003 90-94 24.125 24.635 24.95 26.290000000000003 95-99 24.425 24.785 24.175 26.615 100-104 23.880000000000003 25.119999999999997 24.44 26.56 105-109 24.425 24.95 24.6 26.025 110-114 24.675 24.75 24.585 25.990000000000002 115-119 24.740000000000002 24.285 24.29 26.685 120-124 25.095 24.465 24.04 26.400000000000002 125-129 24.404999999999998 24.855 24.59 26.150000000000002 130-134 24.94 24.42 24.41 26.229999999999997 135-139 24.555 24.145 24.75 26.55 140-144 25.06 24.345 23.78 26.815 145-149 24.73 24.015 24.11 27.145000000000003 150-151 25.974999999999998 24.3875 23.974999999999998 25.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 3.0 26 3.5 27 4.0 28 5.5 29 5.0 30 6.5 31 12.0 32 17.5 33 21.0 34 24.0 35 33.5 36 49.5 37 72.0 38 92.5 39 101.5 40 119.0 41 140.0 42 156.0 43 186.5 44 191.5 45 190.5 46 197.5 47 188.0 48 184.5 49 180.5 50 151.5 51 122.0 52 122.5 53 104.5 54 84.5 55 84.5 56 84.5 57 86.0 58 84.5 59 78.5 60 65.5 61 56.0 62 61.0 63 69.5 64 65.5 65 53.0 66 47.5 67 46.0 68 53.0 69 56.5 70 41.0 71 37.5 72 38.5 73 31.5 74 24.5 75 19.0 76 14.0 77 7.0 78 8.0 79 7.0 80 3.0 81 3.0 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.39616282084522 92.95 2 3.500129634430905 6.75 3 0.10370754472387865 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.23750000000000002 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.6625 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.1375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAAC 10 0.006830828 145.0 3 >>END_MODULE SRR7804183 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804183_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.189 37.0 37.0 37.0 37.0 37.0 2 35.8465 37.0 37.0 37.0 37.0 37.0 3 35.9525 37.0 37.0 37.0 37.0 37.0 4 36.036 37.0 37.0 37.0 37.0 37.0 5 36.0355 37.0 37.0 37.0 37.0 37.0 6 35.987 37.0 37.0 37.0 37.0 37.0 7 36.007 37.0 37.0 37.0 37.0 37.0 8 36.1575 37.0 37.0 37.0 37.0 37.0 9 36.103 37.0 37.0 37.0 37.0 37.0 10-14 36.0843 37.0 37.0 37.0 37.0 37.0 15-19 36.022999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0008 37.0 37.0 37.0 37.0 37.0 25-29 35.991200000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.8938 37.0 37.0 37.0 37.0 37.0 35-39 35.8203 37.0 37.0 37.0 37.0 37.0 40-44 35.7957 37.0 37.0 37.0 37.0 37.0 45-49 35.7595 37.0 37.0 37.0 37.0 37.0 50-54 35.754 37.0 37.0 37.0 37.0 37.0 55-59 35.7 37.0 37.0 37.0 37.0 37.0 60-64 35.580499999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.529 37.0 37.0 37.0 37.0 37.0 70-74 35.4828 37.0 37.0 37.0 37.0 37.0 75-79 35.3956 37.0 37.0 37.0 37.0 37.0 80-84 35.3155 37.0 37.0 37.0 37.0 37.0 85-89 35.2382 37.0 37.0 37.0 32.2 37.0 90-94 35.1822 37.0 37.0 37.0 27.4 37.0 95-99 35.0824 37.0 37.0 37.0 27.4 37.0 100-104 35.0393 37.0 37.0 37.0 25.0 37.0 105-109 35.0312 37.0 37.0 37.0 25.0 37.0 110-114 34.781800000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.7798 37.0 37.0 37.0 25.0 37.0 120-124 34.6671 37.0 37.0 37.0 25.0 37.0 125-129 34.589299999999994 37.0 37.0 37.0 25.0 37.0 130-134 34.4953 37.0 37.0 37.0 25.0 37.0 135-139 34.2748 37.0 37.0 37.0 25.0 37.0 140-144 34.1417 37.0 37.0 37.0 25.0 37.0 145-149 34.099599999999995 37.0 37.0 37.0 25.0 37.0 150-151 33.529250000000005 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 2.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 2.0 23 6.0 24 11.0 25 17.0 26 18.0 27 19.0 28 28.0 29 39.0 30 49.0 31 79.0 32 107.0 33 203.0 34 405.0 35 932.0 36 2020.0 37 57.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.15 11.325000000000001 13.925 41.6 2 28.65 18.55 31.974999999999998 20.825 3 22.925 21.925 27.3 27.85 4 26.924999999999997 30.0 18.075 25.0 5 29.225 31.225 19.8 19.75 6 20.65 34.875 19.7 24.775 7 19.650000000000002 15.1 38.525 26.724999999999998 8 21.925 18.025 24.425 35.625 9 23.35 20.025000000000002 26.450000000000003 30.175 10-14 25.465 25.005 22.39 27.139999999999997 15-19 25.674999999999997 24.310000000000002 23.74 26.275 20-24 26.1 23.36 23.54 27.0 25-29 25.985000000000003 24.51 23.0 26.505000000000003 30-34 26.095000000000002 24.05 23.965 25.89 35-39 26.650000000000002 23.775 22.865 26.71 40-44 26.240000000000002 24.235 23.330000000000002 26.195 45-49 26.779999999999998 23.945 23.305 25.97 50-54 26.82 24.07 22.985 26.125 55-59 26.405 23.3 23.91 26.384999999999998 60-64 26.87 23.405 23.855 25.869999999999997 65-69 26.19 23.825 23.395 26.590000000000003 70-74 26.985 23.665 23.335 26.015 75-79 26.02 23.855 23.71 26.415 80-84 26.700000000000003 23.995 23.150000000000002 26.155 85-89 27.029999999999998 22.62 23.79 26.56 90-94 26.55 23.39 23.75 26.31 95-99 27.215 22.925 23.665 26.195 100-104 26.915 23.91 23.175 26.0 105-109 26.815 23.724999999999998 23.89 25.569999999999997 110-114 27.425 24.035 22.73 25.81 115-119 27.229999999999997 23.705000000000002 22.915 26.150000000000002 120-124 27.355 23.53 23.945 25.169999999999998 125-129 27.36 24.104999999999997 23.474999999999998 25.06 130-134 27.04 23.91 23.23 25.82 135-139 27.175 23.935000000000002 23.79 25.1 140-144 27.689999999999998 24.26 22.759999999999998 25.290000000000003 145-149 27.694999999999997 24.075 23.07 25.16 150-151 27.6125 23.7125 23.525 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.5 25 0.5 26 1.0 27 3.0 28 2.5 29 2.0 30 4.0 31 8.0 32 11.5 33 14.5 34 22.5 35 29.5 36 34.0 37 48.0 38 72.0 39 86.0 40 100.0 41 118.5 42 133.0 43 140.0 44 158.5 45 171.5 46 167.0 47 170.5 48 158.5 49 137.0 50 129.5 51 124.5 52 105.5 53 94.5 54 86.5 55 81.5 56 75.5 57 69.0 58 83.0 59 88.5 60 87.5 61 85.5 62 83.5 63 88.0 64 80.0 65 79.0 66 90.5 67 95.0 68 85.5 69 74.5 70 74.0 71 71.5 72 62.0 73 45.5 74 39.0 75 37.0 76 27.5 77 18.0 78 12.0 79 11.0 80 7.0 81 3.0 82 1.5 83 1.5 84 2.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.175 #Duplication Level Percentage of deduplicated Percentage of total 1 96.3088120613465 92.625 2 3.4572394073303876 6.65 3 0.1819599688068625 0.525 4 0.05198856251624642 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.23750000000000002 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.6625 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.025 0.0 0.0 0.0 0.0 138-139 1.1124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACGGAA 10 0.006830828 145.0 9 CTACGGA 10 0.006830828 145.0 8 >>END_MODULE Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278421 spots for SRR7804183.sra Written 2278421 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra Read 2278407 spots for SRR7804183.sra Written 2278407 spots for SRR7804183.sra SRR ids: ['SRR7804183.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_azry9ugo SRR7804183.sra spots: 45568154 blocks: [[1, 2278407], [2278408, 4556814], [4556815, 6835221], [6835222, 9113628], [9113629, 11392035], [11392036, 13670442], [13670443, 15948849], [15948850, 18227256], [18227257, 20505663], [20505664, 22784070], [22784071, 25062477], [25062478, 27340884], [27340885, 29619291], [29619292, 31897698], [31897699, 34176105], [34176106, 36454512], [36454513, 38732919], [38732920, 41011326], [41011327, 43289733], [43289734, 45568154]] SRR7804183 file size 15419851 SRR7804183 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804183 SRR7804183_1.fastq SRR7804183_2.fastq Input file: SRR7804183_1.fastq Paired file: SRR7804183_2.fastq trimmed: SRR7804183-trimmed-pair1.fastq, SRR7804183-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:27:46 2024 >> started Tue Dec 10 03:28:39 2024 >> done (52.464s) 45568154 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 941 ( 0.00%) empty read pairs filtered out after trimming by size control 45567106 (100.00%) read pairs available; of these: 814168 ( 1.79%) trimmed read pairs available after processing 44752938 (98.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 20 0.00% 20 20 0.00% 21 26 0.00% 22 36 0.00% 23 26 0.00% 24 29 0.00% 25 45 0.00% 26 30 0.00% 27 39 0.00% 28 51 0.00% 29 56 0.00% 30 49 0.00% 31 57 0.00% 32 59 0.00% 33 49 0.00% 34 60 0.00% 35 74 0.00% 36 60 0.00% 37 71 0.00% 38 76 0.00% 39 85 0.00% 40 79 0.00% 41 74 0.00% 42 92 0.00% 43 65 0.00% 44 78 0.00% 45 84 0.00% 46 89 0.00% 47 106 0.00% 48 109 0.00% 49 110 0.00% 50 97 0.00% 51 114 0.00% 52 97 0.00% 53 112 0.00% 54 115 0.00% 55 147 0.00% 56 125 0.00% 57 137 0.00% 58 141 0.00% 59 132 0.00% 60 129 0.00% 61 165 0.00% 62 133 0.00% 63 140 0.00% 64 172 0.00% 65 179 0.00% 66 194 0.00% 67 169 0.00% 68 198 0.00% 69 219 0.00% 70 203 0.00% 71 229 0.00% 72 313 0.00% 73 288 0.00% 74 275 0.00% 75 330 0.00% 76 330 0.00% 77 348 0.00% 78 407 0.00% 79 476 0.00% 80 432 0.00% 81 465 0.00% 82 548 0.00% 83 635 0.00% 84 654 0.00% 85 718 0.00% 86 805 0.00% 87 913 0.00% 88 1041 0.00% 89 1023 0.00% 90 1178 0.00% 91 1322 0.00% 92 1482 0.00% 93 1575 0.00% 94 1755 0.00% 95 1942 0.00% 96 2106 0.00% 97 2347 0.01% 98 2405 0.01% 99 2587 0.01% 100 2861 0.01% 101 3063 0.01% 102 3315 0.01% 103 3601 0.01% 104 3961 0.01% 105 4302 0.01% 106 4601 0.01% 107 4814 0.01% 108 5299 0.01% 109 5477 0.01% 110 5829 0.01% 111 6079 0.01% 112 6819 0.01% 113 7063 0.02% 114 7473 0.02% 115 8046 0.02% 116 8374 0.02% 117 8787 0.02% 118 9177 0.02% 119 9843 0.02% 120 10183 0.02% 121 11057 0.02% 122 11661 0.03% 123 12358 0.03% 124 13112 0.03% 125 13313 0.03% 126 13966 0.03% 127 14516 0.03% 128 15198 0.03% 129 15894 0.03% 130 16325 0.04% 131 17426 0.04% 132 18047 0.04% 133 18860 0.04% 134 19725 0.04% 135 20307 0.04% 136 21553 0.05% 137 21976 0.05% 138 22869 0.05% 139 24068 0.05% 140 24903 0.05% 141 25197 0.06% 142 26906 0.06% 143 27663 0.06% 144 28610 0.06% 145 30092 0.07% 146 31295 0.07% 147 32084 0.07% 148 33317 0.07% 149 34056 0.07% 150 34878 0.08% 151 44752938 98.21% 45567106 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=7.81 fanout-score-rank=7 prefix-density=0.58 prefix-fanout=3.1 sequence=ATGGCGAGGATGCTCTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=274.01 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=16.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=28 prefix-density=0.56 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=178.77 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.2 sequence=AGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804183 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:30:29 Started mapping on | Dec 10 03:30:29 Finished on | Dec 10 03:35:49 Mapping speed, Million of reads per hour | 512.63 Number of input reads | 45567106 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 43848241 Uniquely mapped reads % | 96.23% Average mapped length | 300.21 Number of splices: Total | 45872828 Number of splices: Annotated (sjdb) | 43099794 Number of splices: GT/AG | 45248701 Number of splices: GC/AG | 538629 Number of splices: AT/AC | 18385 Number of splices: Non-canonical | 67113 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440283 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 32882 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1278582 1278582 1278582 N_multimapping 440283 440283 440283 N_noFeature 1620151 42566065 1996061 N_ambiguous 1092194 7945 186090 UnstrandedReadsAssigned:41135896 PositiveStrandReadsAssigned:1274231 NegativeStrandReadsAssigned:41666090 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804183 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804183-trimmed-pair1.fastq SRR7804183-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,567,106 reads, 41,921,796 reads pseudoaligned [quant] estimated average fragment length: 349.767 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 SRR7804183.ke.tsv 35125 SRR7804183.se.tsv 88098 total ==> SRR7804183.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 588.648 0 0 PNS24247 1044 695.233 120.286 5.50761 PNS24249 1928 1579.23 362.021 7.29737 PNS24246 1044 695.233 120.286 5.50761 PNS24248 1044 695.233 120.286 5.50761 PNS24244 1471 1122.23 194.122 5.50643 PNS24243 293 67.6607 0 0 KQK14069 1603 1254.23 4318.55 109.607 KQK14071 474 181.191 61.917 10.8781 ==> SRR7804183.se.tsv <== BRADI_1g14170v3 4852 BRADI_1g53295v3 330 BRADI_1g59795v3 607 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 784 BRADI_1g74790v3 1710 BRADI_1g09890v3 1 BRADI_1g77505v3 606 BRADI_1g48960v3 0 SRR7804183 completed mapping pipeline successfully