Starting /dee2/code/volunteer_pipeline.sh SRR7804184 current disk space = 1526009020416 free memory = 1555626244 SRR7804184 SRAfilesize 605f649411feb279768464fc2c8d241c SRR7804184.sra SRR7804184.sra file validated SRR7804184 is paired end SRR7804184 is conventional basespace SRR7804184 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804184_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1125 37.0 37.0 37.0 37.0 37.0 2 36.299 37.0 37.0 37.0 37.0 37.0 3 36.3245 37.0 37.0 37.0 37.0 37.0 4 36.454 37.0 37.0 37.0 37.0 37.0 5 36.539 37.0 37.0 37.0 37.0 37.0 6 36.4155 37.0 37.0 37.0 37.0 37.0 7 36.2095 37.0 37.0 37.0 37.0 37.0 8 36.45 37.0 37.0 37.0 37.0 37.0 9 36.4295 37.0 37.0 37.0 37.0 37.0 10-14 36.4935 37.0 37.0 37.0 37.0 37.0 15-19 36.4596 37.0 37.0 37.0 37.0 37.0 20-24 36.4526 37.0 37.0 37.0 37.0 37.0 25-29 36.3918 37.0 37.0 37.0 37.0 37.0 30-34 36.3494 37.0 37.0 37.0 37.0 37.0 35-39 36.336400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.3127 37.0 37.0 37.0 37.0 37.0 45-49 36.254599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2116 37.0 37.0 37.0 37.0 37.0 55-59 36.1652 37.0 37.0 37.0 37.0 37.0 60-64 36.189299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.155499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0613 37.0 37.0 37.0 37.0 37.0 75-79 36.0709 37.0 37.0 37.0 37.0 37.0 80-84 36.1105 37.0 37.0 37.0 37.0 37.0 85-89 36.0231 37.0 37.0 37.0 37.0 37.0 90-94 35.943000000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8819 37.0 37.0 37.0 37.0 37.0 100-104 35.8818 37.0 37.0 37.0 37.0 37.0 105-109 35.7635 37.0 37.0 37.0 37.0 37.0 110-114 35.7816 37.0 37.0 37.0 37.0 37.0 115-119 35.7348 37.0 37.0 37.0 37.0 37.0 120-124 35.6049 37.0 37.0 37.0 37.0 37.0 125-129 35.5811 37.0 37.0 37.0 37.0 37.0 130-134 35.4719 37.0 37.0 37.0 37.0 37.0 135-139 35.2941 37.0 37.0 37.0 32.2 37.0 140-144 35.3821 37.0 37.0 37.0 32.2 37.0 145-149 35.163599999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.4785 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 2.0 22 0.0 23 1.0 24 3.0 25 1.0 26 10.0 27 7.0 28 12.0 29 32.0 30 46.0 31 53.0 32 83.0 33 97.0 34 188.0 35 435.0 36 2772.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.61364776718515 13.221274460612143 10.812844957350727 36.35223281485198 2 25.575 17.224999999999998 33.7 23.5 3 23.0 22.400000000000002 23.724999999999998 30.875000000000004 4 27.35 30.375000000000004 19.1 23.175 5 24.0 35.125 21.075 19.8 6 21.224999999999998 33.775 23.425 21.575 7 18.525 19.075 40.125 22.275 8 20.5 20.150000000000002 26.650000000000002 32.7 9 21.15 20.225 30.8 27.825 10-14 24.19 25.650000000000002 23.810000000000002 26.35 15-19 24.055 24.82 25.185000000000002 25.94 20-24 24.25 25.085 24.490000000000002 26.174999999999997 25-29 24.865000000000002 24.685000000000002 24.740000000000002 25.71 30-34 24.4 24.6 25.095 25.905 35-39 24.044999999999998 24.94 24.610000000000003 26.405 40-44 24.27 24.62 24.725 26.384999999999998 45-49 24.55 24.060000000000002 24.9 26.490000000000002 50-54 24.169999999999998 24.63 24.685000000000002 26.515 55-59 24.5 24.0 24.9 26.6 60-64 24.77 24.095 24.495 26.640000000000004 65-69 25.11 24.43 24.404999999999998 26.055 70-74 25.105 23.810000000000002 24.57 26.515 75-79 25.28 24.265 24.205 26.25 80-84 24.785 23.845 24.32 27.05 85-89 25.52 23.794999999999998 24.21 26.474999999999998 90-94 25.52 24.295 23.775 26.41 95-99 25.41 23.669999999999998 24.18 26.740000000000002 100-104 25.525 23.935000000000002 24.165 26.375 105-109 25.319999999999997 23.16 24.235 27.284999999999997 110-114 24.990000000000002 24.215 23.635 27.16 115-119 25.180000000000003 23.815 24.465 26.540000000000003 120-124 25.430000000000003 23.615 23.68 27.275 125-129 25.540000000000003 24.145 23.895 26.419999999999998 130-134 25.990000000000002 23.45 23.575 26.985 135-139 25.69 23.205000000000002 24.02 27.084999999999997 140-144 25.86 23.855 24.12 26.165 145-149 25.185000000000002 23.605 23.724999999999998 27.485 150-151 26.137500000000003 23.150000000000002 23.674999999999997 27.037499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.0 25 0.0 26 0.5 27 1.0 28 4.5 29 8.0 30 7.5 31 10.0 32 16.0 33 20.0 34 25.0 35 38.5 36 49.0 37 57.0 38 76.5 39 82.0 40 100.5 41 137.0 42 153.5 43 162.0 44 165.5 45 163.0 46 159.5 47 167.0 48 170.0 49 161.5 50 140.5 51 133.5 52 134.5 53 118.5 54 106.0 55 93.5 56 98.0 57 99.0 58 93.0 59 91.0 60 81.5 61 82.0 62 78.0 63 74.5 64 79.0 65 77.5 66 71.5 67 66.0 68 56.5 69 51.0 70 48.5 71 37.5 72 30.0 73 28.5 74 25.5 75 21.0 76 15.0 77 8.0 78 6.0 79 4.5 80 3.5 81 2.5 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.10268562401264 90.3 2 4.528699315429173 8.6 3 0.315955766192733 0.8999999999999999 4 0.0526592943654555 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138-139 1.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804184 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804184_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.391 37.0 37.0 37.0 37.0 37.0 2 36.0905 37.0 37.0 37.0 37.0 37.0 3 36.228 37.0 37.0 37.0 37.0 37.0 4 36.1915 37.0 37.0 37.0 37.0 37.0 5 36.217 37.0 37.0 37.0 37.0 37.0 6 36.1965 37.0 37.0 37.0 37.0 37.0 7 36.103 37.0 37.0 37.0 37.0 37.0 8 36.284 37.0 37.0 37.0 37.0 37.0 9 36.265 37.0 37.0 37.0 37.0 37.0 10-14 36.1626 37.0 37.0 37.0 37.0 37.0 15-19 36.114999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.0871 37.0 37.0 37.0 37.0 37.0 25-29 36.0601 37.0 37.0 37.0 37.0 37.0 30-34 36.01520000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.8836 37.0 37.0 37.0 37.0 37.0 40-44 35.899800000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.824 37.0 37.0 37.0 37.0 37.0 50-54 35.8556 37.0 37.0 37.0 37.0 37.0 55-59 35.8001 37.0 37.0 37.0 37.0 37.0 60-64 35.625299999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.5753 37.0 37.0 37.0 37.0 37.0 70-74 35.568200000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.5244 37.0 37.0 37.0 37.0 37.0 80-84 35.4536 37.0 37.0 37.0 37.0 37.0 85-89 35.422799999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.3283 37.0 37.0 37.0 37.0 37.0 95-99 35.241499999999995 37.0 37.0 37.0 32.2 37.0 100-104 35.142 37.0 37.0 37.0 27.4 37.0 105-109 35.1839 37.0 37.0 37.0 29.8 37.0 110-114 35.026799999999994 37.0 37.0 37.0 25.0 37.0 115-119 34.9583 37.0 37.0 37.0 25.0 37.0 120-124 34.8789 37.0 37.0 37.0 25.0 37.0 125-129 34.7116 37.0 37.0 37.0 25.0 37.0 130-134 34.6748 37.0 37.0 37.0 25.0 37.0 135-139 34.482499999999995 37.0 37.0 37.0 25.0 37.0 140-144 34.3472 37.0 37.0 37.0 25.0 37.0 145-149 34.2884 37.0 37.0 37.0 25.0 37.0 150-151 33.5645 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 3.0 15 5.0 16 2.0 17 1.0 18 2.0 19 6.0 20 1.0 21 3.0 22 5.0 23 10.0 24 7.0 25 3.0 26 12.0 27 13.0 28 20.0 29 26.0 30 46.0 31 75.0 32 107.0 33 160.0 34 328.0 35 809.0 36 2268.0 37 83.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.525 13.700000000000001 12.25 35.525 2 28.7 20.0 28.175 23.125 3 24.375 22.675 26.075 26.875 4 28.050000000000004 28.825 17.0 26.125 5 27.224999999999998 31.7 18.425 22.650000000000002 6 23.474999999999998 33.225 18.475 24.825 7 21.65 15.35 36.3 26.700000000000003 8 22.575 19.3 23.025000000000002 35.099999999999994 9 23.375 19.475 24.3 32.85 10-14 26.009999999999998 23.97 21.905 28.115000000000002 15-19 26.11 23.945 22.67 27.275 20-24 26.245 23.875 22.495 27.384999999999998 25-29 26.63 23.919999999999998 22.275 27.175 30-34 26.195 23.94 22.040000000000003 27.825 35-39 26.245 24.279999999999998 21.915000000000003 27.560000000000002 40-44 26.985 23.794999999999998 22.189999999999998 27.029999999999998 45-49 27.075 23.65 22.470000000000002 26.805 50-54 26.724999999999998 23.52 22.61 27.145000000000003 55-59 27.05 23.745 21.86 27.345000000000002 60-64 26.565 23.294999999999998 22.525000000000002 27.615000000000002 65-69 27.375 23.03 22.505 27.089999999999996 70-74 26.640000000000004 23.22 22.805 27.334999999999997 75-79 27.235 23.285 22.485 26.995 80-84 26.99 23.849999999999998 22.335 26.825 85-89 27.625 23.175 21.945 27.255000000000003 90-94 27.650000000000002 23.41 22.41 26.529999999999998 95-99 27.189999999999998 22.939999999999998 23.145 26.724999999999998 100-104 27.175 23.3 22.74 26.784999999999997 105-109 27.215 23.59 22.435 26.76 110-114 27.675 23.54 21.884999999999998 26.900000000000002 115-119 26.895000000000003 23.635 22.405 27.065 120-124 27.515 23.89 22.24 26.355 125-129 28.349999999999998 23.26 22.134999999999998 26.255 130-134 28.075 23.724999999999998 22.55 25.650000000000002 135-139 27.439999999999998 24.415 22.08 26.064999999999998 140-144 28.384999999999998 24.240000000000002 21.91 25.465 145-149 28.050000000000004 23.89 22.689999999999998 25.369999999999997 150-151 27.3 24.625 21.925 26.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 1.0 27 1.0 28 1.5 29 2.0 30 2.0 31 4.0 32 10.0 33 16.0 34 20.0 35 24.5 36 33.0 37 38.5 38 52.5 39 68.5 40 74.5 41 91.5 42 106.0 43 125.5 44 133.0 45 133.5 46 143.5 47 150.5 48 158.5 49 141.5 50 132.5 51 136.0 52 108.5 53 93.0 54 99.0 55 93.0 56 91.0 57 108.5 58 115.5 59 104.0 60 105.5 61 108.5 62 107.0 63 102.5 64 96.5 65 85.5 66 83.5 67 92.5 68 96.5 69 86.5 70 66.5 71 59.0 72 58.5 73 56.0 74 46.0 75 38.0 76 28.5 77 18.0 78 11.0 79 7.5 80 9.0 81 4.0 82 1.0 83 2.0 84 1.5 85 1.5 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.78007419183889 89.425 2 4.636989931107578 8.75 3 0.47694753577106513 1.35 4 0.0794912559618442 0.3 5 0.0 0.0 6 0.0 0.0 7 0.026497085320614733 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138-139 1.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGTT 10 0.006830828 145.0 8 GGGGGGG 215 0.007287582 6.7441864 1 >>END_MODULE Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307122 spots for SRR7804184.sra Written 2307122 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra Read 2307103 spots for SRR7804184.sra Written 2307103 spots for SRR7804184.sra SRR ids: ['SRR7804184.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5eozwc85 SRR7804184.sra spots: 46142079 blocks: [[1, 2307103], [2307104, 4614206], [4614207, 6921309], [6921310, 9228412], [9228413, 11535515], [11535516, 13842618], [13842619, 16149721], [16149722, 18456824], [18456825, 20763927], [20763928, 23071030], [23071031, 25378133], [25378134, 27685236], [27685237, 29992339], [29992340, 32299442], [32299443, 34606545], [34606546, 36913648], [36913649, 39220751], [39220752, 41527854], [41527855, 43834957], [43834958, 46142079]] SRR7804184 file size 15614336 SRR7804184 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804184 SRR7804184_1.fastq SRR7804184_2.fastq Input file: SRR7804184_1.fastq Paired file: SRR7804184_2.fastq trimmed: SRR7804184-trimmed-pair1.fastq, SRR7804184-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:29:01 2024 >> started Tue Dec 10 03:30:02 2024 >> done (60.925s) 46142079 read pairs processed; of these: 124 ( 0.00%) short read pairs filtered out after trimming by size control 1304 ( 0.00%) empty read pairs filtered out after trimming by size control 46140651 (100.00%) read pairs available; of these: 892059 ( 1.93%) trimmed read pairs available after processing 45248592 (98.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 16 0.00% 20 29 0.00% 21 29 0.00% 22 28 0.00% 23 36 0.00% 24 33 0.00% 25 36 0.00% 26 30 0.00% 27 31 0.00% 28 59 0.00% 29 54 0.00% 30 54 0.00% 31 57 0.00% 32 60 0.00% 33 46 0.00% 34 57 0.00% 35 59 0.00% 36 64 0.00% 37 64 0.00% 38 70 0.00% 39 64 0.00% 40 68 0.00% 41 79 0.00% 42 76 0.00% 43 81 0.00% 44 77 0.00% 45 83 0.00% 46 91 0.00% 47 81 0.00% 48 99 0.00% 49 100 0.00% 50 96 0.00% 51 89 0.00% 52 97 0.00% 53 103 0.00% 54 125 0.00% 55 117 0.00% 56 118 0.00% 57 72 0.00% 58 127 0.00% 59 118 0.00% 60 117 0.00% 61 150 0.00% 62 118 0.00% 63 130 0.00% 64 146 0.00% 65 159 0.00% 66 116 0.00% 67 167 0.00% 68 175 0.00% 69 187 0.00% 70 192 0.00% 71 204 0.00% 72 233 0.00% 73 273 0.00% 74 235 0.00% 75 267 0.00% 76 300 0.00% 77 297 0.00% 78 344 0.00% 79 379 0.00% 80 415 0.00% 81 431 0.00% 82 564 0.00% 83 580 0.00% 84 688 0.00% 85 754 0.00% 86 776 0.00% 87 896 0.00% 88 1056 0.00% 89 1084 0.00% 90 1178 0.00% 91 1295 0.00% 92 1444 0.00% 93 1630 0.00% 94 1900 0.00% 95 1955 0.00% 96 2098 0.00% 97 2360 0.01% 98 2501 0.01% 99 2802 0.01% 100 3050 0.01% 101 3330 0.01% 102 3584 0.01% 103 3868 0.01% 104 4176 0.01% 105 4495 0.01% 106 4759 0.01% 107 5027 0.01% 108 5293 0.01% 109 5592 0.01% 110 6006 0.01% 111 6670 0.01% 112 7035 0.02% 113 7375 0.02% 114 7985 0.02% 115 8527 0.02% 116 9069 0.02% 117 9453 0.02% 118 9708 0.02% 119 10490 0.02% 120 10829 0.02% 121 11439 0.02% 122 12355 0.03% 123 13167 0.03% 124 13738 0.03% 125 14545 0.03% 126 15439 0.03% 127 15665 0.03% 128 16326 0.04% 129 17188 0.04% 130 17704 0.04% 131 18404 0.04% 132 19628 0.04% 133 20587 0.04% 134 21963 0.05% 135 22988 0.05% 136 24028 0.05% 137 24481 0.05% 138 25605 0.06% 139 26416 0.06% 140 27437 0.06% 141 28479 0.06% 142 29523 0.06% 143 30898 0.07% 144 32226 0.07% 145 33919 0.07% 146 34854 0.08% 147 36508 0.08% 148 37438 0.08% 149 38918 0.08% 150 40387 0.09% 151 45248592 98.07% 46140651 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=10 prefix-density=0.88 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.19 sequence-density-rank=29 fanout-score=15.59 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=5.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGACAGGTGGTCGGCCAGGTTCTCGAG criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=9 prefix-density=0.91 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=151.81 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.1 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804184 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:31:51 Started mapping on | Dec 10 03:31:51 Finished on | Dec 10 03:39:42 Mapping speed, Million of reads per hour | 352.67 Number of input reads | 46140651 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 43293458 Uniquely mapped reads % | 93.83% Average mapped length | 300.22 Number of splices: Total | 45483007 Number of splices: Annotated (sjdb) | 42977735 Number of splices: GT/AG | 44865424 Number of splices: GC/AG | 542150 Number of splices: AT/AC | 20666 Number of splices: Non-canonical | 54767 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.61 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486322 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 41309 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2360871 2360871 2360871 N_multimapping 486322 486322 486322 N_noFeature 1060755 42090952 1364255 N_ambiguous 1112032 6912 214187 UnstrandedReadsAssigned:41120671 PositiveStrandReadsAssigned:1195594 NegativeStrandReadsAssigned:41715016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804184 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804184-trimmed-pair1.fastq SRR7804184-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,140,651 reads, 42,133,899 reads pseudoaligned [quant] estimated average fragment length: 339.971 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR7804184.ke.tsv 35125 SRR7804184.se.tsv 88098 total ==> SRR7804184.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 598.305 0 0 PNS24247 1044 705.029 79.6614 3.33767 PNS24249 1928 1589.03 271.276 5.04291 PNS24246 1044 705.029 79.6614 3.33767 PNS24248 1044 705.029 79.6614 3.33767 PNS24244 1471 1132.03 109.74 2.86359 PNS24243 293 68.5754 0 0 KQK14069 1603 1264.03 727.985 17.0125 KQK14071 474 185.133 11.2202 1.79026 ==> SRR7804184.se.tsv <== BRADI_1g14170v3 791 BRADI_1g53295v3 192 BRADI_1g59795v3 1046 BRADI_1g07683v3 0 BRADI_1g00485v3 88 BRADI_1g20270v3 5930 BRADI_1g74790v3 381 BRADI_1g09890v3 31 BRADI_1g77505v3 549 BRADI_1g48960v3 0 SRR7804184 completed mapping pipeline successfully