Starting /dee2/code/volunteer_pipeline.sh SRR7804185 current disk space = 1515096596480 free memory = 1587747880 SRR7804185 SRAfilesize ac927d88c147b20d515e7e8c3dca4aba SRR7804185.sra SRR7804185.sra file validated SRR7804185 is paired end SRR7804185 is conventional basespace SRR7804185 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804185_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.14775 37.0 37.0 37.0 37.0 37.0 2 36.281 37.0 37.0 37.0 37.0 37.0 3 36.4725 37.0 37.0 37.0 37.0 37.0 4 36.4805 37.0 37.0 37.0 37.0 37.0 5 36.486 37.0 37.0 37.0 37.0 37.0 6 36.5555 37.0 37.0 37.0 37.0 37.0 7 36.3975 37.0 37.0 37.0 37.0 37.0 8 36.4395 37.0 37.0 37.0 37.0 37.0 9 36.419 37.0 37.0 37.0 37.0 37.0 10-14 36.5235 37.0 37.0 37.0 37.0 37.0 15-19 36.4893 37.0 37.0 37.0 37.0 37.0 20-24 36.500299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.379599999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.406400000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.360299999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.344899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.1996 37.0 37.0 37.0 37.0 37.0 50-54 36.219100000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2162 37.0 37.0 37.0 37.0 37.0 60-64 36.1993 37.0 37.0 37.0 37.0 37.0 65-69 36.159800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0013 37.0 37.0 37.0 37.0 37.0 75-79 36.091 37.0 37.0 37.0 37.0 37.0 80-84 36.054899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9876 37.0 37.0 37.0 37.0 37.0 90-94 35.9357 37.0 37.0 37.0 37.0 37.0 95-99 35.8324 37.0 37.0 37.0 37.0 37.0 100-104 35.8379 37.0 37.0 37.0 37.0 37.0 105-109 35.78249999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.8328 37.0 37.0 37.0 37.0 37.0 115-119 35.688199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.556200000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.547000000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.4538 37.0 37.0 37.0 37.0 37.0 135-139 35.2959 37.0 37.0 37.0 32.2 37.0 140-144 35.3654 37.0 37.0 37.0 34.6 37.0 145-149 35.1367 37.0 37.0 37.0 29.8 37.0 150-151 34.63849999999999 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 3.0 24 2.0 25 5.0 26 10.0 27 10.0 28 13.0 29 33.0 30 43.0 31 46.0 32 66.0 33 106.0 34 191.0 35 435.0 36 2766.0 37 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.84007029876977 12.804418779814212 9.56565402962591 38.78985689179011 2 24.625 19.525000000000002 34.150000000000006 21.7 3 22.675 25.474999999999998 23.05 28.799999999999997 4 27.175 30.2 18.625 24.0 5 25.124999999999996 32.525 20.65 21.7 6 20.175 33.475 22.075 24.275 7 17.849999999999998 19.05 40.550000000000004 22.55 8 21.425 18.725 26.875 32.975 9 20.75 18.675 29.925 30.65 10-14 23.845 25.759999999999998 23.400000000000002 26.995 15-19 24.59 25.05 24.115000000000002 26.245 20-24 24.15 24.615000000000002 24.18 27.055 25-29 24.43 24.775 24.2 26.595000000000002 30-34 24.88 24.43 24.55 26.14 35-39 23.515 24.57 24.34 27.575 40-44 24.545 24.845 24.15 26.46 45-49 24.325 24.23 24.425 27.02 50-54 24.33 23.990000000000002 24.845 26.834999999999997 55-59 24.385 24.97 23.585 27.060000000000002 60-64 25.41 24.04 24.240000000000002 26.31 65-69 24.935 23.685000000000002 24.515 26.865 70-74 25.374999999999996 23.995 23.974999999999998 26.655 75-79 26.005 24.145 23.175 26.674999999999997 80-84 25.230000000000004 23.985 23.955000000000002 26.83 85-89 24.884999999999998 23.78 23.799999999999997 27.534999999999997 90-94 26.075 24.36 23.26 26.305 95-99 25.575 23.835 23.715 26.875 100-104 25.655 23.794999999999998 23.625 26.924999999999997 105-109 26.369999999999997 23.435 23.97 26.224999999999998 110-114 25.790000000000003 24.07 23.53 26.61 115-119 25.715 23.765 23.674999999999997 26.845000000000002 120-124 25.82 23.445 23.125 27.61 125-129 25.83 23.724999999999998 23.865 26.58 130-134 26.69 23.599999999999998 23.465 26.245 135-139 26.05 23.765 23.35 26.834999999999997 140-144 26.06 23.27 23.25 27.42 145-149 26.555 23.335 23.185 26.924999999999997 150-151 26.924999999999997 22.25 23.5375 27.287499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.0 25 1.0 26 2.0 27 1.5 28 0.5 29 4.0 30 8.5 31 8.0 32 13.5 33 24.5 34 28.5 35 34.0 36 49.5 37 52.0 38 66.5 39 93.5 40 91.0 41 107.5 42 142.0 43 156.0 44 164.0 45 168.0 46 164.5 47 157.5 48 153.5 49 150.0 50 148.5 51 133.5 52 116.5 53 126.5 54 125.0 55 103.0 56 92.5 57 93.0 58 89.5 59 84.0 60 93.0 61 92.0 62 85.5 63 83.5 64 80.5 65 86.0 66 84.5 67 75.0 68 60.5 69 48.0 70 50.0 71 51.5 72 39.0 73 28.5 74 22.0 75 16.5 76 13.0 77 12.0 78 10.5 79 5.5 80 2.5 81 1.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.90361763929232 89.85 2 4.673884341167151 8.85 3 0.36968576709796674 1.05 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.026406126221283337 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGAC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.0499999999999998 0.0 0.0 0.0 0.0 138-139 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804185 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804185_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.532 37.0 37.0 37.0 37.0 37.0 2 36.2975 37.0 37.0 37.0 37.0 37.0 3 36.256 37.0 37.0 37.0 37.0 37.0 4 36.333 37.0 37.0 37.0 37.0 37.0 5 36.394 37.0 37.0 37.0 37.0 37.0 6 36.311 37.0 37.0 37.0 37.0 37.0 7 36.3185 37.0 37.0 37.0 37.0 37.0 8 36.404 37.0 37.0 37.0 37.0 37.0 9 36.436 37.0 37.0 37.0 37.0 37.0 10-14 36.3703 37.0 37.0 37.0 37.0 37.0 15-19 36.2828 37.0 37.0 37.0 37.0 37.0 20-24 36.2742 37.0 37.0 37.0 37.0 37.0 25-29 36.2219 37.0 37.0 37.0 37.0 37.0 30-34 36.1913 37.0 37.0 37.0 37.0 37.0 35-39 36.1087 37.0 37.0 37.0 37.0 37.0 40-44 36.1068 37.0 37.0 37.0 37.0 37.0 45-49 36.067899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.0396 37.0 37.0 37.0 37.0 37.0 55-59 36.022499999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9469 37.0 37.0 37.0 37.0 37.0 65-69 35.886599999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.86900000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8215 37.0 37.0 37.0 37.0 37.0 80-84 35.733599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.6531 37.0 37.0 37.0 37.0 37.0 90-94 35.625099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.481199999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.482299999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.4015 37.0 37.0 37.0 37.0 37.0 110-114 35.3406 37.0 37.0 37.0 34.6 37.0 115-119 35.1355 37.0 37.0 37.0 25.0 37.0 120-124 35.1506 37.0 37.0 37.0 27.4 37.0 125-129 35.1092 37.0 37.0 37.0 25.0 37.0 130-134 35.016099999999994 37.0 37.0 37.0 25.0 37.0 135-139 34.79880000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.5814 37.0 37.0 37.0 25.0 37.0 145-149 34.534600000000005 37.0 37.0 37.0 25.0 37.0 150-151 33.83475 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 5.0 15 2.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 4.0 24 6.0 25 8.0 26 12.0 27 17.0 28 20.0 29 25.0 30 37.0 31 42.0 32 76.0 33 124.0 34 282.0 35 805.0 36 2436.0 37 94.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.275000000000006 11.4 11.075 40.25 2 28.799999999999997 18.625 31.075000000000003 21.5 3 24.625 23.35 24.275 27.750000000000004 4 28.275 29.675 16.575 25.474999999999998 5 27.450000000000003 31.324999999999996 18.325 22.900000000000002 6 22.2 32.85 18.275 26.674999999999997 7 22.0 15.0 35.25 27.750000000000004 8 22.85 18.4 22.475 36.275 9 24.625 19.175 22.425 33.775 10-14 26.3 23.23 22.305 28.165000000000003 15-19 26.840000000000003 22.99 22.45 27.72 20-24 26.035000000000004 23.785 22.055 28.125 25-29 26.919999999999998 23.674999999999997 21.865000000000002 27.54 30-34 26.645000000000003 23.385 22.259999999999998 27.71 35-39 26.865 22.755 22.264999999999997 28.115000000000002 40-44 27.1 23.1 21.985 27.815 45-49 27.065 23.325000000000003 22.325 27.284999999999997 50-54 27.165 22.8 22.134999999999998 27.900000000000002 55-59 26.634999999999998 23.705000000000002 21.77 27.889999999999997 60-64 27.334999999999997 22.745 22.355 27.565 65-69 26.55 23.305 22.17 27.975 70-74 27.665 22.98 22.11 27.245 75-79 27.525 22.89 21.92 27.665 80-84 27.345000000000002 22.62 22.695 27.339999999999996 85-89 27.894999999999996 23.135 21.51 27.46 90-94 27.605 23.05 22.13 27.215 95-99 27.57 22.615 22.6 27.215 100-104 27.41 22.89 22.325 27.375 105-109 27.544999999999998 23.355 22.215 26.884999999999998 110-114 27.66 23.74 21.5 27.1 115-119 27.93 23.21 22.12 26.740000000000002 120-124 28.025 23.46 22.555 25.96 125-129 27.665 23.89 21.98 26.465 130-134 27.76 23.32 22.25 26.669999999999998 135-139 26.840000000000003 24.55 22.259999999999998 26.35 140-144 28.050000000000004 24.085 22.314999999999998 25.55 145-149 28.215 23.46 22.585 25.740000000000002 150-151 27.675 23.9125 22.2 26.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.5 25 1.5 26 1.0 27 2.5 28 2.5 29 3.5 30 4.5 31 4.0 32 5.5 33 9.5 34 14.5 35 15.5 36 24.0 37 38.5 38 56.5 39 68.5 40 67.5 41 77.5 42 96.5 43 115.5 44 126.0 45 141.0 46 142.5 47 138.5 48 134.0 49 127.0 50 127.5 51 119.0 52 111.5 53 103.0 54 97.5 55 91.5 56 91.0 57 95.5 58 108.0 59 112.5 60 97.0 61 94.0 62 114.0 63 129.0 64 114.0 65 98.5 66 100.5 67 103.5 68 96.5 69 94.5 70 92.0 71 81.0 72 68.5 73 57.5 74 46.5 75 37.0 76 30.0 77 22.5 78 14.5 79 10.5 80 9.0 81 4.0 82 2.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 94.74661713982488 89.275 2 4.643141416821438 8.75 3 0.42451578668081713 1.2 4 0.13266118333775537 0.5 5 0.02653223666755107 0.125 6 0.02653223666755107 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138-139 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTGAG 10 0.006830828 145.0 1 GATCCCG 10 0.006830828 145.0 5 >>END_MODULE Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232348 spots for SRR7804185.sra Written 2232348 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra Read 2232342 spots for SRR7804185.sra Written 2232342 spots for SRR7804185.sra SRR ids: ['SRR7804185.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w0lz4xje SRR7804185.sra spots: 44646846 blocks: [[1, 2232342], [2232343, 4464684], [4464685, 6697026], [6697027, 8929368], [8929369, 11161710], [11161711, 13394052], [13394053, 15626394], [15626395, 17858736], [17858737, 20091078], [20091079, 22323420], [22323421, 24555762], [24555763, 26788104], [26788105, 29020446], [29020447, 31252788], [31252789, 33485130], [33485131, 35717472], [35717473, 37949814], [37949815, 40182156], [40182157, 42414498], [42414499, 44646846]] SRR7804185 file size 15107650 SRR7804185 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804185 SRR7804185_1.fastq SRR7804185_2.fastq Input file: SRR7804185_1.fastq Paired file: SRR7804185_2.fastq trimmed: SRR7804185-trimmed-pair1.fastq, SRR7804185-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:35:35 2024 >> started Thu Dec 12 03:36:33 2024 >> done (57.065s) 44646846 read pairs processed; of these: 119 ( 0.00%) short read pairs filtered out after trimming by size control 884 ( 0.00%) empty read pairs filtered out after trimming by size control 44645843 (100.00%) read pairs available; of these: 953775 ( 2.14%) trimmed read pairs available after processing 43692068 (97.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 24 0.00% 20 17 0.00% 21 19 0.00% 22 26 0.00% 23 35 0.00% 24 24 0.00% 25 17 0.00% 26 39 0.00% 27 39 0.00% 28 33 0.00% 29 31 0.00% 30 45 0.00% 31 52 0.00% 32 50 0.00% 33 45 0.00% 34 52 0.00% 35 58 0.00% 36 57 0.00% 37 56 0.00% 38 72 0.00% 39 51 0.00% 40 59 0.00% 41 65 0.00% 42 68 0.00% 43 77 0.00% 44 82 0.00% 45 82 0.00% 46 69 0.00% 47 87 0.00% 48 76 0.00% 49 85 0.00% 50 107 0.00% 51 95 0.00% 52 75 0.00% 53 94 0.00% 54 114 0.00% 55 121 0.00% 56 119 0.00% 57 108 0.00% 58 105 0.00% 59 93 0.00% 60 134 0.00% 61 129 0.00% 62 130 0.00% 63 161 0.00% 64 144 0.00% 65 161 0.00% 66 163 0.00% 67 167 0.00% 68 178 0.00% 69 198 0.00% 70 195 0.00% 71 213 0.00% 72 261 0.00% 73 267 0.00% 74 296 0.00% 75 286 0.00% 76 373 0.00% 77 360 0.00% 78 445 0.00% 79 438 0.00% 80 454 0.00% 81 509 0.00% 82 648 0.00% 83 688 0.00% 84 828 0.00% 85 872 0.00% 86 937 0.00% 87 1024 0.00% 88 1115 0.00% 89 1227 0.00% 90 1364 0.00% 91 1605 0.00% 92 1755 0.00% 93 2015 0.00% 94 2208 0.00% 95 2380 0.01% 96 2626 0.01% 97 2835 0.01% 98 2968 0.01% 99 3210 0.01% 100 3339 0.01% 101 3601 0.01% 102 4127 0.01% 103 4535 0.01% 104 4858 0.01% 105 5389 0.01% 106 5610 0.01% 107 6031 0.01% 108 6014 0.01% 109 6643 0.01% 110 7029 0.02% 111 7420 0.02% 112 8031 0.02% 113 8582 0.02% 114 9066 0.02% 115 9826 0.02% 116 10209 0.02% 117 10668 0.02% 118 10942 0.02% 119 11524 0.03% 120 11955 0.03% 121 12615 0.03% 122 13306 0.03% 123 14161 0.03% 124 14970 0.03% 125 15939 0.04% 126 16612 0.04% 127 17512 0.04% 128 17852 0.04% 129 18533 0.04% 130 18993 0.04% 131 19800 0.04% 132 20987 0.05% 133 21999 0.05% 134 23465 0.05% 135 24180 0.05% 136 25295 0.06% 137 26284 0.06% 138 27124 0.06% 139 28078 0.06% 140 28939 0.06% 141 29443 0.07% 142 30434 0.07% 143 31994 0.07% 144 33506 0.08% 145 35111 0.08% 146 35936 0.08% 147 37575 0.08% 148 39131 0.09% 149 39511 0.09% 150 40486 0.09% 151 43692068 97.86% 44645843 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=11 prefix-density=1.02 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTATGAGAGGGTCTC criterion=fanout-score sequence-density=0.21 sequence-density-rank=27 fanout-score=15.93 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=5.0 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGACAGGTGGTCGGCCAGGTTCTCGAG criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=11 prefix-density=1.05 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=183.18 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=9.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804185 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:37:33 Started mapping on | Dec 12 03:37:33 Finished on | Dec 12 03:42:37 Mapping speed, Million of reads per hour | 528.70 Number of input reads | 44645843 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 42698423 Uniquely mapped reads % | 95.64% Average mapped length | 300.24 Number of splices: Total | 44743060 Number of splices: Annotated (sjdb) | 42333966 Number of splices: GT/AG | 44137963 Number of splices: GC/AG | 531725 Number of splices: AT/AC | 19258 Number of splices: Non-canonical | 54114 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424583 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 34660 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1522837 1522837 1522837 N_multimapping 424583 424583 424583 N_noFeature 1016889 41481227 1311153 N_ambiguous 1140161 6550 218185 UnstrandedReadsAssigned:40541373 PositiveStrandReadsAssigned:1210646 NegativeStrandReadsAssigned:41169085 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804185 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804185-trimmed-pair1.fastq SRR7804185-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,645,843 reads, 41,370,895 reads pseudoaligned [quant] estimated average fragment length: 336.92 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR7804185.ke.tsv 35125 SRR7804185.se.tsv 88098 total ==> SRR7804185.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 601.185 0 0 PNS24247 1044 708.08 74.4969 3.11329 PNS24249 1928 1592.08 228.131 4.24016 PNS24246 1044 708.08 74.4969 3.11329 PNS24248 1044 708.08 74.4969 3.11329 PNS24244 1471 1135.08 95.3786 2.4865 PNS24243 293 68.9893 0 0 KQK14069 1603 1267.08 1149.93 26.8554 KQK14071 474 185.115 1.7674 0.282525 ==> SRR7804185.se.tsv <== BRADI_1g14170v3 1250 BRADI_1g53295v3 194 BRADI_1g59795v3 1207 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 6367 BRADI_1g74790v3 296 BRADI_1g09890v3 21 BRADI_1g77505v3 579 BRADI_1g48960v3 0 SRR7804185 completed mapping pipeline successfully