Starting /dee2/code/volunteer_pipeline.sh SRR7804186 current disk space = 1526077464576 free memory = 1558501424 SRR7804186 SRAfilesize 69a4e94be48f343de18c6676d42b23d2 SRR7804186.sra SRR7804186.sra file validated SRR7804186 is paired end SRR7804186 is conventional basespace SRR7804186 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804186_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.16 37.0 37.0 37.0 37.0 37.0 2 36.307 37.0 37.0 37.0 37.0 37.0 3 36.3625 37.0 37.0 37.0 37.0 37.0 4 36.551 37.0 37.0 37.0 37.0 37.0 5 36.4905 37.0 37.0 37.0 37.0 37.0 6 36.44 37.0 37.0 37.0 37.0 37.0 7 36.2665 37.0 37.0 37.0 37.0 37.0 8 36.529 37.0 37.0 37.0 37.0 37.0 9 36.486 37.0 37.0 37.0 37.0 37.0 10-14 36.512899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.4923 37.0 37.0 37.0 37.0 37.0 20-24 36.4653 37.0 37.0 37.0 37.0 37.0 25-29 36.381 37.0 37.0 37.0 37.0 37.0 30-34 36.357099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.3614 37.0 37.0 37.0 37.0 37.0 40-44 36.3164 37.0 37.0 37.0 37.0 37.0 45-49 36.2427 37.0 37.0 37.0 37.0 37.0 50-54 36.2106 37.0 37.0 37.0 37.0 37.0 55-59 36.230000000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.172 37.0 37.0 37.0 37.0 37.0 65-69 36.1556 37.0 37.0 37.0 37.0 37.0 70-74 36.1146 37.0 37.0 37.0 37.0 37.0 75-79 36.0612 37.0 37.0 37.0 37.0 37.0 80-84 36.0667 37.0 37.0 37.0 37.0 37.0 85-89 36.04600000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.958400000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8361 37.0 37.0 37.0 37.0 37.0 100-104 35.9003 37.0 37.0 37.0 37.0 37.0 105-109 35.8133 37.0 37.0 37.0 37.0 37.0 110-114 35.864 37.0 37.0 37.0 37.0 37.0 115-119 35.6998 37.0 37.0 37.0 37.0 37.0 120-124 35.608799999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5984 37.0 37.0 37.0 37.0 37.0 130-134 35.4867 37.0 37.0 37.0 37.0 37.0 135-139 35.3924 37.0 37.0 37.0 37.0 37.0 140-144 35.421400000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.3208 37.0 37.0 37.0 32.2 37.0 150-151 34.56875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 5.0 26 17.0 27 9.0 28 13.0 29 36.0 30 36.0 31 48.0 32 64.0 33 87.0 34 194.0 35 436.0 36 2792.0 37 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.04761904761905 12.907268170426065 10.776942355889723 37.26817042606516 2 26.424999999999997 18.875 33.2 21.5 3 21.625 25.374999999999996 23.0 30.0 4 27.625 30.599999999999998 19.650000000000002 22.125 5 26.474999999999998 32.074999999999996 20.849999999999998 20.599999999999998 6 21.95 32.95 22.675 22.425 7 16.825000000000003 20.7 42.075 20.4 8 20.925 19.85 27.825 31.4 9 21.275 19.475 30.625000000000004 28.625 10-14 23.35 26.529999999999998 24.5 25.619999999999997 15-19 23.985 25.569999999999997 24.625 25.82 20-24 23.645 24.255 25.21 26.889999999999997 25-29 24.015 26.095000000000002 24.685000000000002 25.205 30-34 24.37 24.959999999999997 24.625 26.045 35-39 24.01 25.0 24.735 26.255 40-44 24.095 25.11 24.529999999999998 26.265 45-49 24.52 25.005 24.305 26.169999999999998 50-54 24.58 25.025 24.3 26.095000000000002 55-59 24.645 24.535 24.48 26.340000000000003 60-64 24.11 25.275 23.78 26.834999999999997 65-69 23.915 24.815 24.38 26.889999999999997 70-74 24.16 24.099999999999998 24.62 27.12 75-79 23.645 25.064999999999998 24.560000000000002 26.729999999999997 80-84 24.875 24.865000000000002 23.835 26.424999999999997 85-89 24.79 24.535 24.005000000000003 26.669999999999998 90-94 24.77 24.685000000000002 24.240000000000002 26.305 95-99 24.865000000000002 24.775 23.935000000000002 26.424999999999997 100-104 25.319999999999997 24.095 24.255 26.33 105-109 24.779999999999998 24.605 23.845 26.77 110-114 24.95 24.29 24.16 26.6 115-119 25.174999999999997 24.36 23.815 26.650000000000002 120-124 25.83 24.285 23.26 26.625 125-129 25.264999999999997 24.465 23.724999999999998 26.545 130-134 25.505 24.01 24.0 26.484999999999996 135-139 25.724999999999998 24.11 24.060000000000002 26.105 140-144 25.805 23.93 23.995 26.27 145-149 25.355 24.075 23.77 26.8 150-151 25.162499999999998 22.8875 24.474999999999998 27.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 1.0 26 1.0 27 2.0 28 4.0 29 4.5 30 6.5 31 12.5 32 15.5 33 24.5 34 32.5 35 37.0 36 54.5 37 72.5 38 80.5 39 88.0 40 113.5 41 146.5 42 162.0 43 158.5 44 162.5 45 167.0 46 175.5 47 172.5 48 157.0 49 152.5 50 147.5 51 137.0 52 127.5 53 124.5 54 104.5 55 82.0 56 75.0 57 89.0 58 90.5 59 88.5 60 96.5 61 87.0 62 75.5 63 72.0 64 75.5 65 79.0 66 64.5 67 44.0 68 39.0 69 47.5 70 52.5 71 42.0 72 33.5 73 26.0 74 19.0 75 19.5 76 13.0 77 7.0 78 7.0 79 5.5 80 6.5 81 5.5 82 2.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 95.81699346405229 91.625 2 3.895424836601307 7.449999999999999 3 0.20915032679738566 0.6 4 0.052287581699346414 0.2 5 0.026143790849673207 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGAAGAAGGCCTCCTCCACACCATCTCCATGGTGGACATCAATGTCTACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.21250000000000002 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.55 0.0 0.0 0.0 0.0 130-131 0.6375 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.825 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCGGT 10 0.006830828 145.0 9 TGGTAGC 10 0.006830828 145.0 6 ACACTTG 10 0.006830828 145.0 4 ATGGTAG 10 0.006830828 145.0 5 GTTCATG 10 0.006830828 145.0 1 GTAGCGG 10 0.006830828 145.0 8 >>END_MODULE SRR7804186 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804186_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3605 37.0 37.0 37.0 37.0 37.0 2 36.0525 37.0 37.0 37.0 37.0 37.0 3 36.245 37.0 37.0 37.0 37.0 37.0 4 36.212 37.0 37.0 37.0 37.0 37.0 5 36.3685 37.0 37.0 37.0 37.0 37.0 6 36.0755 37.0 37.0 37.0 37.0 37.0 7 36.151 37.0 37.0 37.0 37.0 37.0 8 36.2845 37.0 37.0 37.0 37.0 37.0 9 36.229 37.0 37.0 37.0 37.0 37.0 10-14 36.192499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.1157 37.0 37.0 37.0 37.0 37.0 20-24 36.12519999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.0372 37.0 37.0 37.0 37.0 37.0 30-34 36.003699999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.882999999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9098 37.0 37.0 37.0 37.0 37.0 45-49 35.8591 37.0 37.0 37.0 37.0 37.0 50-54 35.838499999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.805400000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.6708 37.0 37.0 37.0 37.0 37.0 65-69 35.666 37.0 37.0 37.0 37.0 37.0 70-74 35.6305 37.0 37.0 37.0 37.0 37.0 75-79 35.5869 37.0 37.0 37.0 37.0 37.0 80-84 35.506299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.4871 37.0 37.0 37.0 37.0 37.0 90-94 35.4263 37.0 37.0 37.0 37.0 37.0 95-99 35.2949 37.0 37.0 37.0 34.6 37.0 100-104 35.227000000000004 37.0 37.0 37.0 32.2 37.0 105-109 35.2053 37.0 37.0 37.0 27.4 37.0 110-114 35.0377 37.0 37.0 37.0 25.0 37.0 115-119 35.0382 37.0 37.0 37.0 25.0 37.0 120-124 34.9661 37.0 37.0 37.0 25.0 37.0 125-129 34.9296 37.0 37.0 37.0 25.0 37.0 130-134 34.8594 37.0 37.0 37.0 25.0 37.0 135-139 34.573 37.0 37.0 37.0 25.0 37.0 140-144 34.4138 37.0 37.0 37.0 25.0 37.0 145-149 34.3089 37.0 37.0 37.0 25.0 37.0 150-151 33.83475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 4.0 15 5.0 16 5.0 17 1.0 18 2.0 19 1.0 20 4.0 21 5.0 22 5.0 23 5.0 24 5.0 25 10.0 26 15.0 27 15.0 28 20.0 29 28.0 30 42.0 31 59.0 32 78.0 33 137.0 34 302.0 35 819.0 36 2344.0 37 84.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.224999999999994 13.900000000000002 12.675 35.199999999999996 2 29.525000000000002 18.975 28.675 22.825 3 24.525 21.825 27.650000000000002 26.0 4 28.325 30.45 17.474999999999998 23.75 5 28.725 30.725 18.0 22.55 6 23.35 32.35 18.375 25.924999999999997 7 22.35 14.424999999999999 36.275 26.950000000000003 8 24.85 19.375 20.75 35.025 9 25.25 20.625 24.65 29.475 10-14 26.455000000000002 24.125 22.1 27.32 15-19 26.11 24.22 22.48 27.189999999999998 20-24 25.97 23.96 22.975 27.095000000000002 25-29 26.87 24.035 22.32 26.775 30-34 26.935 23.68 22.645 26.740000000000002 35-39 26.805 24.255 22.715 26.224999999999998 40-44 26.88 24.13 22.264999999999997 26.724999999999998 45-49 27.16 24.044999999999998 22.015 26.779999999999998 50-54 26.56 24.47 22.295 26.674999999999997 55-59 27.650000000000002 23.400000000000002 22.470000000000002 26.479999999999997 60-64 27.07 23.830000000000002 22.035 27.065 65-69 26.229999999999997 23.915 23.189999999999998 26.665 70-74 27.245 22.884999999999998 22.99 26.88 75-79 26.645000000000003 24.345 22.855 26.155 80-84 27.265 23.544999999999998 22.945 26.245 85-89 27.785 22.615 22.82 26.779999999999998 90-94 27.650000000000002 23.925 22.695 25.729999999999997 95-99 27.224999999999998 23.565 22.66 26.55 100-104 27.224999999999998 23.77 22.875 26.13 105-109 27.235 23.84 22.825 26.1 110-114 27.139999999999997 24.14 22.79 25.929999999999996 115-119 26.8 23.79 23.29 26.119999999999997 120-124 26.955000000000002 23.625 23.48 25.94 125-129 27.215 23.669999999999998 23.275000000000002 25.840000000000003 130-134 27.029999999999998 23.835 23.165 25.97 135-139 26.82 24.545 22.965 25.669999999999998 140-144 27.595 24.445 22.88 25.080000000000002 145-149 27.665 24.15 22.855 25.330000000000002 150-151 27.025 24.837500000000002 22.775000000000002 25.362499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 1.0 8 0.5 9 1.0 10 1.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 2.0 29 4.0 30 8.0 31 8.0 32 9.5 33 16.5 34 24.5 35 28.0 36 36.5 37 47.5 38 52.5 39 63.5 40 79.0 41 106.5 42 123.5 43 118.0 44 137.5 45 156.5 46 139.0 47 130.5 48 144.0 49 146.0 50 130.5 51 112.5 52 113.0 53 113.0 54 94.5 55 78.0 56 80.5 57 89.5 58 96.0 59 110.5 60 111.5 61 100.0 62 102.0 63 116.0 64 116.0 65 92.5 66 76.0 67 81.5 68 87.5 69 86.0 70 77.5 71 70.5 72 58.5 73 50.5 74 51.0 75 37.5 76 21.5 77 16.5 78 10.5 79 3.5 80 2.5 81 3.0 82 4.0 83 4.0 84 2.5 85 1.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.29442691903259 90.625 2 4.311251314405888 8.200000000000001 3 0.34174553101997895 0.975 4 0.052576235541535225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0125 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.05 0.0 0.025 0.0 0.0 88-89 0.05 0.0 0.025 0.0 0.0 90-91 0.05 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.05 0.0 0.025 0.0 0.0 96-97 0.05 0.0 0.025 0.0 0.0 98-99 0.05 0.0 0.025 0.0 0.0 100-101 0.05 0.0 0.025 0.0 0.0 102-103 0.07500000000000001 0.0 0.025 0.0 0.0 104-105 0.1 0.0 0.025 0.0 0.0 106-107 0.1 0.0 0.025 0.0 0.0 108-109 0.1 0.0 0.025 0.0 0.0 110-111 0.125 0.0 0.025 0.0 0.0 112-113 0.15 0.0 0.025 0.0 0.0 114-115 0.21250000000000002 0.0 0.025 0.0 0.0 116-117 0.2375 0.0 0.025 0.0 0.0 118-119 0.3 0.0 0.025 0.0 0.0 120-121 0.35 0.0 0.025 0.0 0.0 122-123 0.3875 0.0 0.025 0.0 0.0 124-125 0.4625 0.0 0.025 0.0 0.0 126-127 0.5 0.0 0.025 0.0 0.0 128-129 0.55 0.0 0.025 0.0 0.0 130-131 0.6375 0.0 0.025 0.0 0.0 132-133 0.75 0.0 0.025 0.0 0.0 134-135 0.8 0.0 0.025 0.0 0.0 136-137 0.925 0.0 0.025 0.0 0.0 138-139 1.125 0.0 0.025 0.0 0.0125 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337670 spots for SRR7804186.sra Written 1337670 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra Read 1337666 spots for SRR7804186.sra Written 1337666 spots for SRR7804186.sra SRR ids: ['SRR7804186.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wkk8ft7b SRR7804186.sra spots: 26753324 blocks: [[1, 1337666], [1337667, 2675332], [2675333, 4012998], [4012999, 5350664], [5350665, 6688330], [6688331, 8025996], [8025997, 9363662], [9363663, 10701328], [10701329, 12038994], [12038995, 13376660], [13376661, 14714326], [14714327, 16051992], [16051993, 17389658], [17389659, 18727324], [18727325, 20064990], [20064991, 21402656], [21402657, 22740322], [22740323, 24077988], [24077989, 25415654], [25415655, 26753324]] SRR7804186 file size 9044123 SRR7804186 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804186 SRR7804186_1.fastq SRR7804186_2.fastq Input file: SRR7804186_1.fastq Paired file: SRR7804186_2.fastq trimmed: SRR7804186-trimmed-pair1.fastq, SRR7804186-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:29:16 2024 >> started Tue Dec 10 03:29:48 2024 >> done (31.681s) 26753324 read pairs processed; of these: 43 ( 0.00%) short read pairs filtered out after trimming by size control 678 ( 0.00%) empty read pairs filtered out after trimming by size control 26752603 (100.00%) read pairs available; of these: 569942 ( 2.13%) trimmed read pairs available after processing 26182661 (97.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 10 0.00% 20 11 0.00% 21 11 0.00% 22 26 0.00% 23 17 0.00% 24 20 0.00% 25 25 0.00% 26 12 0.00% 27 34 0.00% 28 25 0.00% 29 32 0.00% 30 19 0.00% 31 30 0.00% 32 27 0.00% 33 28 0.00% 34 31 0.00% 35 39 0.00% 36 39 0.00% 37 28 0.00% 38 41 0.00% 39 36 0.00% 40 37 0.00% 41 42 0.00% 42 55 0.00% 43 42 0.00% 44 38 0.00% 45 40 0.00% 46 56 0.00% 47 35 0.00% 48 59 0.00% 49 55 0.00% 50 61 0.00% 51 47 0.00% 52 57 0.00% 53 54 0.00% 54 68 0.00% 55 73 0.00% 56 54 0.00% 57 77 0.00% 58 70 0.00% 59 88 0.00% 60 93 0.00% 61 82 0.00% 62 79 0.00% 63 83 0.00% 64 92 0.00% 65 82 0.00% 66 91 0.00% 67 94 0.00% 68 133 0.00% 69 99 0.00% 70 130 0.00% 71 116 0.00% 72 158 0.00% 73 159 0.00% 74 152 0.00% 75 181 0.00% 76 209 0.00% 77 209 0.00% 78 230 0.00% 79 251 0.00% 80 263 0.00% 81 287 0.00% 82 353 0.00% 83 418 0.00% 84 470 0.00% 85 456 0.00% 86 532 0.00% 87 558 0.00% 88 632 0.00% 89 720 0.00% 90 804 0.00% 91 850 0.00% 92 945 0.00% 93 1064 0.00% 94 1272 0.00% 95 1385 0.01% 96 1405 0.01% 97 1608 0.01% 98 1703 0.01% 99 1926 0.01% 100 2037 0.01% 101 2132 0.01% 102 2484 0.01% 103 2569 0.01% 104 2808 0.01% 105 2897 0.01% 106 3180 0.01% 107 3357 0.01% 108 3648 0.01% 109 3892 0.01% 110 4097 0.02% 111 4280 0.02% 112 4568 0.02% 113 5010 0.02% 114 5216 0.02% 115 5708 0.02% 116 5855 0.02% 117 6258 0.02% 118 6468 0.02% 119 6786 0.03% 120 7054 0.03% 121 7562 0.03% 122 7927 0.03% 123 8524 0.03% 124 9018 0.03% 125 9437 0.04% 126 9745 0.04% 127 10267 0.04% 128 10683 0.04% 129 11046 0.04% 130 11457 0.04% 131 12055 0.05% 132 12633 0.05% 133 13398 0.05% 134 14100 0.05% 135 14484 0.05% 136 15194 0.06% 137 15713 0.06% 138 16136 0.06% 139 17060 0.06% 140 17157 0.06% 141 17947 0.07% 142 18652 0.07% 143 19317 0.07% 144 20194 0.08% 145 21011 0.08% 146 21834 0.08% 147 22893 0.09% 148 23374 0.09% 149 23942 0.09% 150 24842 0.09% 151 26182661 97.87% 26752603 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=21 prefix-density=0.90 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=13.17 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.4 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=12 prefix-density=0.75 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=158.95 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804186 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:30:51 Started mapping on | Dec 10 03:30:52 Finished on | Dec 10 03:34:29 Mapping speed, Million of reads per hour | 443.82 Number of input reads | 26752603 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 25278072 Uniquely mapped reads % | 94.49% Average mapped length | 300.14 Number of splices: Total | 25908820 Number of splices: Annotated (sjdb) | 24391166 Number of splices: GT/AG | 25546620 Number of splices: GC/AG | 317826 Number of splices: AT/AC | 10962 Number of splices: Non-canonical | 33412 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254089 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 19301 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.99% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1220442 1220442 1220442 N_multimapping 254089 254089 254089 N_noFeature 737962 24505514 935852 N_ambiguous 712093 4100 137635 UnstrandedReadsAssigned:23828017 PositiveStrandReadsAssigned:768458 NegativeStrandReadsAssigned:24204585 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804186 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804186-trimmed-pair1.fastq SRR7804186-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,752,603 reads, 24,391,800 reads pseudoaligned [quant] estimated average fragment length: 337.591 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 SRR7804186.ke.tsv 35125 SRR7804186.se.tsv 88098 total ==> SRR7804186.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 600.6 0 0 PNS24247 1044 707.409 66.0306 4.78812 PNS24249 1928 1591.41 124.479 4.01242 PNS24246 1044 707.409 66.0306 4.78812 PNS24248 1044 707.409 66.0306 4.78812 PNS24244 1471 1134.41 123.429 5.58133 PNS24243 293 70.0203 0 0 KQK14069 1603 1266.41 547.329 22.17 KQK14071 474 185.923 10.6851 2.94805 ==> SRR7804186.se.tsv <== BRADI_1g14170v3 587 BRADI_1g53295v3 328 BRADI_1g59795v3 972 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 2643 BRADI_1g74790v3 701 BRADI_1g09890v3 16 BRADI_1g77505v3 398 BRADI_1g48960v3 0 SRR7804186 completed mapping pipeline successfully