Starting /dee2/code/volunteer_pipeline.sh SRR7804187 current disk space = 1526045130752 free memory = 1602349100 SRR7804187 SRAfilesize e8c720b4aa8136dc34e774a368f43a96 SRR7804187.sra SRR7804187.sra file validated SRR7804187 is paired end SRR7804187 is conventional basespace SRR7804187 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804187_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.09425 37.0 37.0 37.0 37.0 37.0 2 36.2795 37.0 37.0 37.0 37.0 37.0 3 36.3495 37.0 37.0 37.0 37.0 37.0 4 36.4535 37.0 37.0 37.0 37.0 37.0 5 36.458 37.0 37.0 37.0 37.0 37.0 6 36.51 37.0 37.0 37.0 37.0 37.0 7 36.338 37.0 37.0 37.0 37.0 37.0 8 36.4755 37.0 37.0 37.0 37.0 37.0 9 36.4265 37.0 37.0 37.0 37.0 37.0 10-14 36.4985 37.0 37.0 37.0 37.0 37.0 15-19 36.4411 37.0 37.0 37.0 37.0 37.0 20-24 36.48610000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.376999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.378899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.356100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.2889 37.0 37.0 37.0 37.0 37.0 45-49 36.228500000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2669 37.0 37.0 37.0 37.0 37.0 55-59 36.216699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.2044 37.0 37.0 37.0 37.0 37.0 65-69 36.1664 37.0 37.0 37.0 37.0 37.0 70-74 36.0646 37.0 37.0 37.0 37.0 37.0 75-79 36.113899999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.0587 37.0 37.0 37.0 37.0 37.0 85-89 36.042 37.0 37.0 37.0 37.0 37.0 90-94 35.932 37.0 37.0 37.0 37.0 37.0 95-99 35.8348 37.0 37.0 37.0 37.0 37.0 100-104 35.819900000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.8231 37.0 37.0 37.0 37.0 37.0 110-114 35.7975 37.0 37.0 37.0 37.0 37.0 115-119 35.6166 37.0 37.0 37.0 37.0 37.0 120-124 35.6025 37.0 37.0 37.0 37.0 37.0 125-129 35.590799999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.5164 37.0 37.0 37.0 37.0 37.0 135-139 35.2833 37.0 37.0 37.0 32.2 37.0 140-144 35.3352 37.0 37.0 37.0 34.6 37.0 145-149 35.157 37.0 37.0 37.0 27.4 37.0 150-151 34.602000000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 3.0 25 3.0 26 5.0 27 14.0 28 16.0 29 27.0 30 33.0 31 54.0 32 82.0 33 121.0 34 166.0 35 466.0 36 2786.0 37 222.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.92633425206715 11.676271611125031 11.926835379604109 42.470558757203705 2 25.0 17.424999999999997 35.325 22.25 3 23.95 24.975 23.025000000000002 28.050000000000004 4 26.0 30.575000000000003 17.925 25.5 5 26.25 32.925 20.9 19.925 6 20.599999999999998 33.575 22.55 23.275000000000002 7 17.375 19.825 39.800000000000004 23.0 8 21.65 19.325 26.724999999999998 32.300000000000004 9 21.9 17.925 31.35 28.825 10-14 23.59 25.25 24.4 26.76 15-19 23.669999999999998 24.795 25.255 26.279999999999998 20-24 24.12 25.430000000000003 24.245 26.205000000000002 25-29 23.625 24.959999999999997 24.79 26.625 30-34 24.445 24.64 24.945 25.97 35-39 24.3 25.03 24.95 25.72 40-44 24.5 25.174999999999997 24.265 26.06 45-49 23.925 24.745 24.58 26.75 50-54 24.745 23.65 24.915000000000003 26.69 55-59 24.4 24.19 24.41 27.0 60-64 24.265 24.825 24.099999999999998 26.810000000000002 65-69 24.64 24.785 24.21 26.365 70-74 24.8 23.71 24.485 27.005000000000003 75-79 24.905 24.145 24.18 26.77 80-84 25.155 24.385 23.89 26.57 85-89 24.965 23.895 23.915 27.224999999999998 90-94 24.625 24.38 24.51 26.484999999999996 95-99 25.495 24.205 23.73 26.57 100-104 25.705 24.0 23.86 26.435 105-109 25.15 24.235 23.674999999999997 26.939999999999998 110-114 26.19 24.13 23.84 25.840000000000003 115-119 25.305 24.245 23.830000000000002 26.619999999999997 120-124 25.135 23.755000000000003 23.919999999999998 27.189999999999998 125-129 26.055 23.200000000000003 24.07 26.674999999999997 130-134 25.6 23.799999999999997 23.815 26.784999999999997 135-139 25.474999999999998 23.375 24.104999999999997 27.045 140-144 26.005 23.59 23.57 26.834999999999997 145-149 25.919999999999998 23.400000000000002 23.98 26.700000000000003 150-151 25.662499999999998 23.45 23.375 27.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 1.5 28 2.5 29 4.0 30 8.0 31 13.0 32 12.5 33 17.5 34 30.0 35 34.5 36 38.5 37 52.0 38 71.0 39 87.5 40 114.5 41 140.0 42 151.0 43 161.0 44 174.0 45 173.0 46 182.0 47 183.5 48 156.0 49 153.5 50 148.0 51 137.5 52 133.5 53 118.5 54 99.5 55 90.0 56 93.0 57 88.5 58 85.5 59 84.5 60 86.5 61 88.0 62 74.0 63 79.0 64 70.5 65 63.5 66 80.0 67 70.5 68 51.5 69 48.5 70 50.0 71 40.5 72 34.5 73 31.0 74 22.5 75 16.0 76 13.5 77 12.5 78 7.5 79 3.0 80 4.5 81 4.0 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.325 #Duplication Level Percentage of deduplicated Percentage of total 1 96.26265247858812 92.72500000000001 2 3.6594861147158055 7.049999999999999 3 0.07786140669608098 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0125 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.037500000000000006 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.0625 0.0 0.0 0.0 0.025 94-95 0.075 0.0 0.0 0.0 0.025 96-97 0.075 0.0 0.0 0.0 0.025 98-99 0.075 0.0 0.0 0.0 0.025 100-101 0.075 0.0 0.0 0.0 0.025 102-103 0.1125 0.0 0.0 0.0 0.025 104-105 0.125 0.0 0.0 0.0 0.025 106-107 0.175 0.0 0.0 0.0 0.025 108-109 0.21250000000000002 0.0 0.0 0.0 0.025 110-111 0.2375 0.0 0.0 0.0 0.025 112-113 0.275 0.0 0.0 0.0 0.025 114-115 0.3125 0.0 0.0 0.0 0.025 116-117 0.3875 0.0 0.0 0.0 0.025 118-119 0.4 0.0 0.0 0.0 0.025 120-121 0.44999999999999996 0.0 0.0 0.0 0.025 122-123 0.5 0.0 0.0 0.0 0.025 124-125 0.6 0.0 0.0 0.0 0.025 126-127 0.65 0.0 0.0 0.0 0.025 128-129 0.7375 0.0 0.0 0.0 0.025 130-131 0.8374999999999999 0.0 0.0 0.0 0.025 132-133 0.925 0.0 0.0 0.0 0.025 134-135 1.1 0.0 0.0 0.0 0.025 136-137 1.2 0.0 0.0 0.0 0.025 138-139 1.3375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAGGT 10 0.006830828 145.0 1 >>END_MODULE SRR7804187 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804187_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.538 37.0 37.0 37.0 37.0 37.0 2 36.402 37.0 37.0 37.0 37.0 37.0 3 36.4295 37.0 37.0 37.0 37.0 37.0 4 36.406 37.0 37.0 37.0 37.0 37.0 5 36.46 37.0 37.0 37.0 37.0 37.0 6 36.278 37.0 37.0 37.0 37.0 37.0 7 36.4725 37.0 37.0 37.0 37.0 37.0 8 36.3965 37.0 37.0 37.0 37.0 37.0 9 36.4845 37.0 37.0 37.0 37.0 37.0 10-14 36.479 37.0 37.0 37.0 37.0 37.0 15-19 36.3931 37.0 37.0 37.0 37.0 37.0 20-24 36.3771 37.0 37.0 37.0 37.0 37.0 25-29 36.3449 37.0 37.0 37.0 37.0 37.0 30-34 36.3362 37.0 37.0 37.0 37.0 37.0 35-39 36.248200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.21210000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.199600000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.19970000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.143100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0235 37.0 37.0 37.0 37.0 37.0 65-69 35.9863 37.0 37.0 37.0 37.0 37.0 70-74 35.916199999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8913 37.0 37.0 37.0 37.0 37.0 80-84 35.9034 37.0 37.0 37.0 37.0 37.0 85-89 35.79280000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.7221 37.0 37.0 37.0 37.0 37.0 95-99 35.6284 37.0 37.0 37.0 37.0 37.0 100-104 35.633900000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.5951 37.0 37.0 37.0 37.0 37.0 110-114 35.3837 37.0 37.0 37.0 37.0 37.0 115-119 35.3767 37.0 37.0 37.0 37.0 37.0 120-124 35.319399999999995 37.0 37.0 37.0 34.6 37.0 125-129 35.2162 37.0 37.0 37.0 27.4 37.0 130-134 35.1767 37.0 37.0 37.0 25.0 37.0 135-139 34.9476 37.0 37.0 37.0 25.0 37.0 140-144 34.8447 37.0 37.0 37.0 25.0 37.0 145-149 34.7201 37.0 37.0 37.0 25.0 37.0 150-151 34.086 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 3.0 19 1.0 20 3.0 21 1.0 22 1.0 23 4.0 24 5.0 25 14.0 26 5.0 27 10.0 28 20.0 29 21.0 30 28.0 31 38.0 32 69.0 33 130.0 34 235.0 35 706.0 36 2556.0 37 148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.175 12.325 13.575000000000001 41.925000000000004 2 30.15 17.7 30.5 21.65 3 24.5 22.6 25.900000000000002 27.0 4 27.700000000000003 30.325000000000003 17.875 24.099999999999998 5 29.75 30.7 17.825 21.725 6 21.325 34.825 18.4 25.45 7 21.9 14.124999999999998 36.6 27.375 8 22.425 20.65 22.225 34.699999999999996 9 24.95 20.75 24.675 29.625 10-14 26.8 23.805 22.21 27.185 15-19 26.19 24.16 22.805 26.845000000000002 20-24 26.279999999999998 24.255 22.495 26.97 25-29 26.095000000000002 24.099999999999998 22.645 27.16 30-34 26.435 23.5 22.74 27.325 35-39 26.755000000000003 24.03 22.435 26.779999999999998 40-44 26.8 23.74 22.515 26.945000000000004 45-49 27.045 23.995 21.85 27.11 50-54 26.185000000000002 24.145 21.98 27.689999999999998 55-59 27.26 23.435 22.625 26.68 60-64 27.105 23.755000000000003 22.689999999999998 26.450000000000003 65-69 26.61 23.115 22.900000000000002 27.375 70-74 27.37 23.09 22.765 26.775 75-79 27.02 23.715 22.830000000000002 26.435 80-84 27.57 22.79 22.8 26.840000000000003 85-89 27.095000000000002 23.41 22.564999999999998 26.93 90-94 26.575 23.91 22.795 26.72 95-99 27.689999999999998 23.03 22.64 26.640000000000004 100-104 26.979999999999997 23.555 22.625 26.840000000000003 105-109 26.700000000000003 23.94 22.6 26.76 110-114 27.589999999999996 23.855 22.12 26.435 115-119 27.315 23.294999999999998 23.24 26.150000000000002 120-124 27.355 23.965 22.68 26.0 125-129 27.76 23.805 22.37 26.064999999999998 130-134 27.295 24.25 22.314999999999998 26.14 135-139 27.26 24.19 22.685 25.865 140-144 27.765 23.685000000000002 22.935 25.615 145-149 28.365000000000002 23.119999999999997 22.805 25.71 150-151 26.7625 24.6 22.787499999999998 25.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 1.0 27 0.0 28 0.5 29 4.0 30 6.0 31 4.0 32 9.5 33 13.5 34 12.5 35 25.0 36 34.0 37 35.0 38 47.5 39 72.0 40 89.0 41 102.0 42 120.5 43 124.0 44 130.5 45 143.5 46 140.0 47 143.5 48 157.0 49 151.0 50 139.0 51 113.0 52 92.0 53 108.5 54 121.0 55 107.5 56 90.0 57 87.0 58 94.5 59 101.5 60 106.5 61 110.0 62 111.5 63 107.5 64 98.5 65 91.5 66 93.0 67 98.5 68 84.0 69 82.0 70 78.0 71 62.5 72 57.0 73 53.0 74 41.5 75 29.5 76 23.5 77 13.5 78 10.0 79 8.5 80 6.5 81 2.0 82 1.0 83 1.0 84 1.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.92689295039165 91.85 2 3.7859007832898173 7.249999999999999 3 0.20887728459530025 0.6 4 0.0783289817232376 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.42500000000000004 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.7875000000000001 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.175 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610323 spots for SRR7804187.sra Written 1610323 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra Read 1610313 spots for SRR7804187.sra Written 1610313 spots for SRR7804187.sra SRR ids: ['SRR7804187.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xgiy_y0i SRR7804187.sra spots: 32206270 blocks: [[1, 1610313], [1610314, 3220626], [3220627, 4830939], [4830940, 6441252], [6441253, 8051565], [8051566, 9661878], [9661879, 11272191], [11272192, 12882504], [12882505, 14492817], [14492818, 16103130], [16103131, 17713443], [17713444, 19323756], [19323757, 20934069], [20934070, 22544382], [22544383, 24154695], [24154696, 25765008], [25765009, 27375321], [27375322, 28985634], [28985635, 30595947], [30595948, 32206270]] SRR7804187 file size 10891947 SRR7804187 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804187 SRR7804187_1.fastq SRR7804187_2.fastq Input file: SRR7804187_1.fastq Paired file: SRR7804187_2.fastq trimmed: SRR7804187-trimmed-pair1.fastq, SRR7804187-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:34:44 2024 >> started Tue Dec 10 03:35:21 2024 >> done (36.158s) 32206270 read pairs processed; of these: 87 ( 0.00%) short read pairs filtered out after trimming by size control 419 ( 0.00%) empty read pairs filtered out after trimming by size control 32205764 (100.00%) read pairs available; of these: 856446 ( 2.66%) trimmed read pairs available after processing 31349318 (97.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 11 0.00% 21 20 0.00% 22 19 0.00% 23 17 0.00% 24 24 0.00% 25 20 0.00% 26 32 0.00% 27 29 0.00% 28 42 0.00% 29 35 0.00% 30 44 0.00% 31 43 0.00% 32 51 0.00% 33 46 0.00% 34 36 0.00% 35 49 0.00% 36 44 0.00% 37 44 0.00% 38 59 0.00% 39 58 0.00% 40 57 0.00% 41 56 0.00% 42 58 0.00% 43 59 0.00% 44 71 0.00% 45 70 0.00% 46 70 0.00% 47 58 0.00% 48 69 0.00% 49 75 0.00% 50 77 0.00% 51 76 0.00% 52 63 0.00% 53 96 0.00% 54 74 0.00% 55 92 0.00% 56 91 0.00% 57 75 0.00% 58 87 0.00% 59 100 0.00% 60 126 0.00% 61 114 0.00% 62 125 0.00% 63 106 0.00% 64 108 0.00% 65 124 0.00% 66 134 0.00% 67 109 0.00% 68 147 0.00% 69 179 0.00% 70 163 0.00% 71 203 0.00% 72 220 0.00% 73 205 0.00% 74 183 0.00% 75 242 0.00% 76 260 0.00% 77 303 0.00% 78 333 0.00% 79 400 0.00% 80 395 0.00% 81 431 0.00% 82 535 0.00% 83 592 0.00% 84 633 0.00% 85 724 0.00% 86 793 0.00% 87 879 0.00% 88 975 0.00% 89 1072 0.00% 90 1143 0.00% 91 1334 0.00% 92 1503 0.00% 93 1675 0.01% 94 1862 0.01% 95 2028 0.01% 96 2313 0.01% 97 2444 0.01% 98 2689 0.01% 99 2745 0.01% 100 3081 0.01% 101 3402 0.01% 102 3606 0.01% 103 3905 0.01% 104 4365 0.01% 105 4571 0.01% 106 4988 0.02% 107 5300 0.02% 108 5613 0.02% 109 5979 0.02% 110 6268 0.02% 111 6831 0.02% 112 7346 0.02% 113 7589 0.02% 114 8193 0.03% 115 8938 0.03% 116 9264 0.03% 117 9614 0.03% 118 9973 0.03% 119 10608 0.03% 120 11128 0.03% 121 11820 0.04% 122 12499 0.04% 123 13021 0.04% 124 13702 0.04% 125 14388 0.04% 126 15076 0.05% 127 15779 0.05% 128 15981 0.05% 129 16475 0.05% 130 17262 0.05% 131 18209 0.06% 132 19320 0.06% 133 19826 0.06% 134 20973 0.07% 135 21957 0.07% 136 22706 0.07% 137 23516 0.07% 138 24381 0.08% 139 25113 0.08% 140 26153 0.08% 141 26537 0.08% 142 28160 0.09% 143 28862 0.09% 144 29648 0.09% 145 30929 0.10% 146 31731 0.10% 147 33192 0.10% 148 34630 0.11% 149 35015 0.11% 150 36263 0.11% 151 31349318 97.34% 32205764 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=19 prefix-density=0.88 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=8.29 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.5 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=20 prefix-density=0.79 prefix-fanout=2.9 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=169.53 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.4 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804187 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:36:12 Started mapping on | Dec 10 03:36:12 Finished on | Dec 10 03:40:52 Mapping speed, Million of reads per hour | 414.07 Number of input reads | 32205764 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30789365 Uniquely mapped reads % | 95.60% Average mapped length | 300.10 Number of splices: Total | 32144285 Number of splices: Annotated (sjdb) | 30327538 Number of splices: GT/AG | 31698538 Number of splices: GC/AG | 391567 Number of splices: AT/AC | 14027 Number of splices: Non-canonical | 40153 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308914 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 21823 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1107485 1107485 1107485 N_multimapping 308914 308914 308914 N_noFeature 830399 29838840 1076819 N_ambiguous 852524 4640 148784 UnstrandedReadsAssigned:29106442 PositiveStrandReadsAssigned:945885 NegativeStrandReadsAssigned:29563762 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804187 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804187-trimmed-pair1.fastq SRR7804187-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,205,764 reads, 29,654,159 reads pseudoaligned [quant] estimated average fragment length: 331.058 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR7804187.ke.tsv 35125 SRR7804187.se.tsv 88098 total ==> SRR7804187.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 607.09 0 0 PNS24247 1044 713.942 72.4497 4.25107 PNS24249 1928 1597.94 174.631 4.5781 PNS24246 1044 713.942 72.4497 4.25107 PNS24248 1044 713.942 72.4497 4.25107 PNS24244 1471 1140.94 130.02 4.77387 PNS24243 293 71.8814 0 0 KQK14069 1603 1272.94 600.161 19.7508 KQK14071 474 190.044 6.18347 1.36302 ==> SRR7804187.se.tsv <== BRADI_1g14170v3 655 BRADI_1g53295v3 311 BRADI_1g59795v3 1174 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 3549 BRADI_1g74790v3 1071 BRADI_1g09890v3 15 BRADI_1g77505v3 473 BRADI_1g48960v3 0 SRR7804187 completed mapping pipeline successfully