Starting /dee2/code/volunteer_pipeline.sh SRR7804188 current disk space = 1525976649728 free memory = 1558369212 SRR7804188 SRAfilesize c159d7a27a041a232c368584ca4beb5a SRR7804188.sra SRR7804188.sra file validated SRR7804188 is paired end SRR7804188 is conventional basespace SRR7804188 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804188_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.06625 37.0 37.0 37.0 37.0 37.0 2 36.1625 37.0 37.0 37.0 37.0 37.0 3 36.307 37.0 37.0 37.0 37.0 37.0 4 36.4745 37.0 37.0 37.0 37.0 37.0 5 36.501 37.0 37.0 37.0 37.0 37.0 6 36.5755 37.0 37.0 37.0 37.0 37.0 7 36.2245 37.0 37.0 37.0 37.0 37.0 8 36.486 37.0 37.0 37.0 37.0 37.0 9 36.4165 37.0 37.0 37.0 37.0 37.0 10-14 36.462300000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.4671 37.0 37.0 37.0 37.0 37.0 20-24 36.4182 37.0 37.0 37.0 37.0 37.0 25-29 36.3614 37.0 37.0 37.0 37.0 37.0 30-34 36.367900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3371 37.0 37.0 37.0 37.0 37.0 40-44 36.27290000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.2648 37.0 37.0 37.0 37.0 37.0 50-54 36.238099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.14739999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.1106 37.0 37.0 37.0 37.0 37.0 65-69 36.157799999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.071000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0254 37.0 37.0 37.0 37.0 37.0 80-84 36.0009 37.0 37.0 37.0 37.0 37.0 85-89 35.9594 37.0 37.0 37.0 37.0 37.0 90-94 35.82919999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.809400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7671 37.0 37.0 37.0 37.0 37.0 105-109 35.6955 37.0 37.0 37.0 37.0 37.0 110-114 35.723699999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.5923 37.0 37.0 37.0 37.0 37.0 120-124 35.49679999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.5428 37.0 37.0 37.0 37.0 37.0 130-134 35.3597 37.0 37.0 37.0 32.2 37.0 135-139 35.2723 37.0 37.0 37.0 29.8 37.0 140-144 35.3148 37.0 37.0 37.0 34.6 37.0 145-149 35.072500000000005 37.0 37.0 37.0 27.4 37.0 150-151 34.51625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 2.0 25 5.0 26 4.0 27 16.0 28 27.0 29 19.0 30 46.0 31 55.0 32 81.0 33 115.0 34 210.0 35 452.0 36 2755.0 37 210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.653547254951114 12.033091000250689 10.478816746051642 39.83454499874655 2 24.525 18.775 34.475 22.225 3 23.175 24.099999999999998 23.875 28.849999999999998 4 28.325 29.475 18.6 23.599999999999998 5 28.025 31.1 20.45 20.424999999999997 6 21.825 32.550000000000004 22.2 23.425 7 17.825 19.6 40.150000000000006 22.425 8 20.775 19.35 26.900000000000002 32.975 9 20.525 18.525 31.175000000000004 29.775000000000002 10-14 24.41 25.115 23.645 26.83 15-19 24.015 24.37 24.92 26.695 20-24 24.535 24.035 24.16 27.27 25-29 23.91 24.89 24.349999999999998 26.85 30-34 24.099999999999998 24.14 24.610000000000003 27.150000000000002 35-39 24.404999999999998 24.05 24.66 26.884999999999998 40-44 24.59 24.26 24.415 26.735 45-49 23.990000000000002 24.46 24.215 27.334999999999997 50-54 24.425 24.060000000000002 24.3 27.215 55-59 24.83 24.03 24.355 26.784999999999997 60-64 24.404999999999998 23.57 24.25 27.775 65-69 24.425 24.09 24.085 27.400000000000002 70-74 24.83 23.44 23.9 27.83 75-79 24.93 24.205 23.87 26.995 80-84 24.695 24.099999999999998 23.52 27.685 85-89 25.55 23.485 23.915 27.05 90-94 24.959999999999997 23.419999999999998 24.04 27.58 95-99 25.46 23.435 23.655 27.450000000000003 100-104 25.405 23.47 23.29 27.834999999999997 105-109 25.305 23.16 23.94 27.595 110-114 25.35 23.205000000000002 23.79 27.655 115-119 25.319999999999997 23.315 23.625 27.74 120-124 25.419999999999998 23.150000000000002 23.32 28.110000000000003 125-129 26.415 22.915 23.255 27.415 130-134 26.155 23.055 23.599999999999998 27.189999999999998 135-139 25.89 22.755 23.43 27.925 140-144 26.57 22.66 23.285 27.485 145-149 26.575 23.165 22.73 27.529999999999998 150-151 26.187500000000004 23.0 23.2625 27.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 1.0 28 1.0 29 2.5 30 6.0 31 11.0 32 18.0 33 20.5 34 24.5 35 37.0 36 48.0 37 57.0 38 62.0 39 67.0 40 93.5 41 119.0 42 138.0 43 155.0 44 157.0 45 158.0 46 161.5 47 159.0 48 144.0 49 138.0 50 143.5 51 136.0 52 127.5 53 113.5 54 112.0 55 119.0 56 116.0 57 120.0 58 114.5 59 120.5 60 108.0 61 92.5 62 87.5 63 73.5 64 70.5 65 69.5 66 70.5 67 61.5 68 51.0 69 44.5 70 40.0 71 37.5 72 40.0 73 34.5 74 26.0 75 23.5 76 18.0 77 14.5 78 12.0 79 10.0 80 6.5 81 2.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57528446679015 89.35 2 5.0542471553320985 9.55 3 0.31754432389521037 0.8999999999999999 4 0.05292405398253506 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.5625 0.0 0.0 0.0 0.0 118-119 0.675 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.3125 0.0 0.0 0.0 0.0 136-137 1.3875 0.0 0.0 0.0 0.0 138-139 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACAT 10 0.006830828 145.0 3 AAACATC 10 0.006830828 145.0 4 GCGAAAC 10 0.006830828 145.0 1 >>END_MODULE SRR7804188 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804188_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3545 37.0 37.0 37.0 37.0 37.0 2 36.0625 37.0 37.0 37.0 37.0 37.0 3 36.0725 37.0 37.0 37.0 37.0 37.0 4 36.1435 37.0 37.0 37.0 37.0 37.0 5 36.233 37.0 37.0 37.0 37.0 37.0 6 36.199 37.0 37.0 37.0 37.0 37.0 7 36.1535 37.0 37.0 37.0 37.0 37.0 8 36.216 37.0 37.0 37.0 37.0 37.0 9 36.187 37.0 37.0 37.0 37.0 37.0 10-14 36.186699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.084199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0666 37.0 37.0 37.0 37.0 37.0 25-29 36.0217 37.0 37.0 37.0 37.0 37.0 30-34 36.023900000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.8956 37.0 37.0 37.0 37.0 37.0 40-44 35.8842 37.0 37.0 37.0 37.0 37.0 45-49 35.832800000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.8288 37.0 37.0 37.0 37.0 37.0 55-59 35.7868 37.0 37.0 37.0 37.0 37.0 60-64 35.698299999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.5933 37.0 37.0 37.0 37.0 37.0 70-74 35.5543 37.0 37.0 37.0 37.0 37.0 75-79 35.4962 37.0 37.0 37.0 37.0 37.0 80-84 35.402699999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.351600000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.3168 37.0 37.0 37.0 37.0 37.0 95-99 35.2284 37.0 37.0 37.0 29.8 37.0 100-104 35.2084 37.0 37.0 37.0 32.2 37.0 105-109 35.201299999999996 37.0 37.0 37.0 29.8 37.0 110-114 34.9553 37.0 37.0 37.0 25.0 37.0 115-119 34.9188 37.0 37.0 37.0 25.0 37.0 120-124 34.9701 37.0 37.0 37.0 25.0 37.0 125-129 34.833600000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.6946 37.0 37.0 37.0 25.0 37.0 135-139 34.583600000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.3209 37.0 37.0 37.0 25.0 37.0 145-149 34.3356 37.0 37.0 37.0 25.0 37.0 150-151 33.52475 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 3.0 16 2.0 17 1.0 18 2.0 19 2.0 20 3.0 21 10.0 22 12.0 23 14.0 24 10.0 25 9.0 26 16.0 27 11.0 28 21.0 29 25.0 30 40.0 31 55.0 32 106.0 33 158.0 34 283.0 35 820.0 36 2294.0 37 98.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.025 11.799999999999999 11.175 38.0 2 29.349999999999998 17.75 29.15 23.75 3 26.674999999999997 22.8 25.275 25.25 4 28.999999999999996 29.45 16.575 24.975 5 30.425 30.475 17.150000000000002 21.95 6 25.124999999999996 32.875 17.775 24.224999999999998 7 21.825 14.825 34.925 28.425 8 22.6 19.775000000000002 20.625 37.0 9 25.45 21.75 24.224999999999998 28.575 10-14 27.12 24.165 21.525 27.189999999999998 15-19 27.439999999999998 23.474999999999998 21.575 27.51 20-24 27.744999999999997 24.16 21.36 26.735 25-29 27.16 23.695 21.884999999999998 27.26 30-34 27.025 23.565 22.009999999999998 27.400000000000002 35-39 27.325 24.240000000000002 21.42 27.015 40-44 27.33 24.154999999999998 21.709999999999997 26.805 45-49 27.805000000000003 23.400000000000002 22.125 26.669999999999998 50-54 27.425 23.54 21.875 27.16 55-59 27.705000000000002 23.189999999999998 21.675 27.43 60-64 27.735 23.11 22.259999999999998 26.895000000000003 65-69 27.650000000000002 23.400000000000002 22.08 26.87 70-74 27.055 23.435 22.03 27.48 75-79 28.139999999999997 23.055 21.865000000000002 26.939999999999998 80-84 28.325 23.035 22.085 26.555 85-89 27.644999999999996 23.435 22.035 26.884999999999998 90-94 28.12 23.315 21.82 26.745 95-99 27.77 23.25 22.21 26.77 100-104 28.095 23.21 21.97 26.724999999999998 105-109 27.54 23.549999999999997 22.12 26.790000000000003 110-114 28.285 23.44 22.009999999999998 26.265 115-119 27.755000000000003 23.544999999999998 21.865000000000002 26.834999999999997 120-124 28.665000000000003 23.005 22.245 26.085 125-129 27.67 23.625 22.08 26.625 130-134 28.720000000000002 22.82 22.525000000000002 25.935000000000002 135-139 27.62 24.215 22.1 26.064999999999998 140-144 27.779999999999998 24.82 21.815 25.585 145-149 28.915000000000003 23.68 21.85 25.555 150-151 28.999999999999996 24.637500000000003 21.1875 25.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 1.0 12 1.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 0.5 27 1.0 28 2.0 29 1.5 30 1.5 31 4.0 32 9.0 33 8.5 34 14.0 35 25.5 36 23.0 37 28.0 38 37.5 39 58.5 40 77.5 41 79.0 42 92.0 43 104.0 44 133.0 45 134.0 46 121.5 47 145.5 48 143.5 49 123.0 50 127.5 51 127.0 52 128.5 53 126.5 54 126.0 55 136.5 56 119.0 57 105.5 58 109.5 59 112.5 60 112.5 61 102.5 62 96.5 63 104.0 64 101.0 65 93.5 66 89.5 67 82.5 68 83.0 69 79.5 70 73.0 71 66.5 72 64.5 73 60.5 74 46.5 75 38.0 76 26.5 77 21.0 78 18.0 79 11.5 80 5.5 81 5.5 82 4.5 83 0.5 84 0.0 85 1.0 86 1.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 1.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.65425531914894 88.97500000000001 2 4.707446808510638 8.85 3 0.5053191489361702 1.425 4 0.07978723404255318 0.3 5 0.026595744680851064 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026595744680851064 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.2625 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830639 spots for SRR7804188.sra Written 1830639 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra Read 1830623 spots for SRR7804188.sra Written 1830623 spots for SRR7804188.sra SRR ids: ['SRR7804188.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r0di7mv4 SRR7804188.sra spots: 36612476 blocks: [[1, 1830623], [1830624, 3661246], [3661247, 5491869], [5491870, 7322492], [7322493, 9153115], [9153116, 10983738], [10983739, 12814361], [12814362, 14644984], [14644985, 16475607], [16475608, 18306230], [18306231, 20136853], [20136854, 21967476], [21967477, 23798099], [23798100, 25628722], [25628723, 27459345], [27459346, 29289968], [29289969, 31120591], [31120592, 32951214], [32951215, 34781837], [34781838, 36612476]] SRR7804188 file size 12385066 SRR7804188 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804188 SRR7804188_1.fastq SRR7804188_2.fastq Input file: SRR7804188_1.fastq Paired file: SRR7804188_2.fastq trimmed: SRR7804188-trimmed-pair1.fastq, SRR7804188-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:34:25 2024 >> started Tue Dec 10 03:35:17 2024 >> done (51.982s) 36612476 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 1039 ( 0.00%) empty read pairs filtered out after trimming by size control 36611351 (100.00%) read pairs available; of these: 1080388 ( 2.95%) trimmed read pairs available after processing 35530963 (97.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 9 0.00% 20 17 0.00% 21 11 0.00% 22 16 0.00% 23 19 0.00% 24 24 0.00% 25 30 0.00% 26 29 0.00% 27 25 0.00% 28 24 0.00% 29 28 0.00% 30 36 0.00% 31 38 0.00% 32 36 0.00% 33 37 0.00% 34 34 0.00% 35 48 0.00% 36 49 0.00% 37 42 0.00% 38 62 0.00% 39 46 0.00% 40 40 0.00% 41 44 0.00% 42 49 0.00% 43 54 0.00% 44 43 0.00% 45 71 0.00% 46 67 0.00% 47 45 0.00% 48 59 0.00% 49 73 0.00% 50 61 0.00% 51 66 0.00% 52 71 0.00% 53 65 0.00% 54 79 0.00% 55 91 0.00% 56 90 0.00% 57 85 0.00% 58 79 0.00% 59 114 0.00% 60 95 0.00% 61 95 0.00% 62 118 0.00% 63 123 0.00% 64 107 0.00% 65 110 0.00% 66 134 0.00% 67 142 0.00% 68 162 0.00% 69 169 0.00% 70 159 0.00% 71 198 0.00% 72 189 0.00% 73 249 0.00% 74 249 0.00% 75 265 0.00% 76 316 0.00% 77 310 0.00% 78 375 0.00% 79 437 0.00% 80 459 0.00% 81 525 0.00% 82 621 0.00% 83 627 0.00% 84 780 0.00% 85 844 0.00% 86 879 0.00% 87 954 0.00% 88 1120 0.00% 89 1138 0.00% 90 1300 0.00% 91 1518 0.00% 92 1766 0.00% 93 1990 0.01% 94 2125 0.01% 95 2395 0.01% 96 2657 0.01% 97 2819 0.01% 98 3065 0.01% 99 3247 0.01% 100 3620 0.01% 101 3925 0.01% 102 4398 0.01% 103 4826 0.01% 104 5195 0.01% 105 5793 0.02% 106 6160 0.02% 107 6507 0.02% 108 6873 0.02% 109 7416 0.02% 110 7640 0.02% 111 8320 0.02% 112 8877 0.02% 113 9563 0.03% 114 10157 0.03% 115 11034 0.03% 116 11590 0.03% 117 12101 0.03% 118 12440 0.03% 119 13183 0.04% 120 13774 0.04% 121 14575 0.04% 122 15246 0.04% 123 16465 0.04% 124 17536 0.05% 125 18541 0.05% 126 19423 0.05% 127 19729 0.05% 128 20641 0.06% 129 20772 0.06% 130 21997 0.06% 131 23080 0.06% 132 23950 0.07% 133 25503 0.07% 134 26910 0.07% 135 27944 0.08% 136 29455 0.08% 137 30283 0.08% 138 31262 0.09% 139 32137 0.09% 140 32542 0.09% 141 34124 0.09% 142 35222 0.10% 143 36052 0.10% 144 37957 0.10% 145 40140 0.11% 146 41005 0.11% 147 42724 0.12% 148 44202 0.12% 149 44661 0.12% 150 46066 0.13% 151 35530963 97.05% 36611351 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=31 prefix-density=0.86 prefix-fanout=1.9 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=27.26 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=GGAGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGA criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=9 prefix-density=1.00 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=19.05 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804188 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:35:58 Started mapping on | Dec 10 03:35:58 Finished on | Dec 10 03:40:12 Mapping speed, Million of reads per hour | 518.90 Number of input reads | 36611351 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 32100589 Uniquely mapped reads % | 87.68% Average mapped length | 299.97 Number of splices: Total | 32382807 Number of splices: Annotated (sjdb) | 30710162 Number of splices: GT/AG | 31928655 Number of splices: GC/AG | 402362 Number of splices: AT/AC | 10348 Number of splices: Non-canonical | 41442 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1304820 % of reads mapped to multiple loci | 3.56% Number of reads mapped to too many loci | 190780 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 4.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3205942 3205942 3205942 N_multimapping 1304820 1304820 1304820 N_noFeature 2041836 31140252 2235010 N_ambiguous 951971 4650 187011 UnstrandedReadsAssigned:29106782 PositiveStrandReadsAssigned:955687 NegativeStrandReadsAssigned:29678568 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804188 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804188-trimmed-pair1.fastq SRR7804188-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,611,351 reads, 30,285,991 reads pseudoaligned [quant] estimated average fragment length: 317.482 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR7804188.ke.tsv 35125 SRR7804188.se.tsv 88098 total ==> SRR7804188.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 620.258 0 0 PNS24247 1044 727.518 54.5527 2.79159 PNS24249 1928 1611.52 149.277 3.44857 PNS24246 1044 727.518 54.5527 2.79159 PNS24248 1044 727.518 54.5527 2.79159 PNS24244 1471 1154.52 121.065 3.90388 PNS24243 293 73.8437 0 0 KQK14069 1603 1286.52 4633.12 134.072 KQK14071 474 195.43 49.1392 9.36086 ==> SRR7804188.se.tsv <== BRADI_1g14170v3 4793 BRADI_1g53295v3 173 BRADI_1g59795v3 417 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 306 BRADI_1g74790v3 569 BRADI_1g09890v3 0 BRADI_1g77505v3 573 BRADI_1g48960v3 0 SRR7804188 completed mapping pipeline successfully