Starting /dee2/code/volunteer_pipeline.sh SRR7804189 current disk space = 1525896581120 free memory = 1561361632 SRR7804189 SRAfilesize 4df901b6fc91eec5fe6b297086c4e2ef SRR7804189.sra SRR7804189.sra file validated SRR7804189 is paired end SRR7804189 is conventional basespace SRR7804189 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804189_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.158 37.0 37.0 37.0 37.0 37.0 2 36.163 37.0 37.0 37.0 37.0 37.0 3 36.2995 37.0 37.0 37.0 37.0 37.0 4 36.4115 37.0 37.0 37.0 37.0 37.0 5 36.5065 37.0 37.0 37.0 37.0 37.0 6 36.475 37.0 37.0 37.0 37.0 37.0 7 36.3215 37.0 37.0 37.0 37.0 37.0 8 36.452 37.0 37.0 37.0 37.0 37.0 9 36.3375 37.0 37.0 37.0 37.0 37.0 10-14 36.48950000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4642 37.0 37.0 37.0 37.0 37.0 20-24 36.487700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3859 37.0 37.0 37.0 37.0 37.0 30-34 36.354 37.0 37.0 37.0 37.0 37.0 35-39 36.3607 37.0 37.0 37.0 37.0 37.0 40-44 36.328500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.26129999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.2314 37.0 37.0 37.0 37.0 37.0 55-59 36.1805 37.0 37.0 37.0 37.0 37.0 60-64 36.1961 37.0 37.0 37.0 37.0 37.0 65-69 36.14490000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.0765 37.0 37.0 37.0 37.0 37.0 75-79 36.0546 37.0 37.0 37.0 37.0 37.0 80-84 36.060199999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0358 37.0 37.0 37.0 37.0 37.0 90-94 35.9883 37.0 37.0 37.0 37.0 37.0 95-99 35.8874 37.0 37.0 37.0 37.0 37.0 100-104 35.8515 37.0 37.0 37.0 37.0 37.0 105-109 35.8291 37.0 37.0 37.0 37.0 37.0 110-114 35.8125 37.0 37.0 37.0 37.0 37.0 115-119 35.6996 37.0 37.0 37.0 37.0 37.0 120-124 35.6152 37.0 37.0 37.0 37.0 37.0 125-129 35.645599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.519099999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.3327 37.0 37.0 37.0 34.6 37.0 140-144 35.300200000000004 37.0 37.0 37.0 32.2 37.0 145-149 35.19369999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.47425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 3.0 25 6.0 26 4.0 27 10.0 28 25.0 29 28.0 30 42.0 31 56.0 32 57.0 33 97.0 34 185.0 35 439.0 36 2783.0 37 262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.02710843373494 12.299196787148595 10.21586345381526 39.45783132530121 2 26.1 17.175 34.225 22.5 3 24.474999999999998 23.025000000000002 22.95 29.549999999999997 4 29.575000000000003 27.250000000000004 19.075 24.099999999999998 5 28.475 30.599999999999998 21.349999999999998 19.575 6 21.0 33.425 22.85 22.725 7 17.299999999999997 20.775 40.400000000000006 21.525 8 22.575 17.974999999999998 27.325 32.125 9 23.075000000000003 19.025 29.049999999999997 28.849999999999998 10-14 24.455 25.874999999999996 23.36 26.31 15-19 25.064999999999998 24.125 24.224999999999998 26.584999999999997 20-24 25.245 24.38 24.005000000000003 26.369999999999997 25-29 24.85 25.009999999999998 23.86 26.279999999999998 30-34 25.074999999999996 24.055 24.305 26.565 35-39 25.474999999999998 24.245 24.099999999999998 26.179999999999996 40-44 25.605 23.915 23.72 26.76 45-49 25.795 23.765 23.799999999999997 26.640000000000004 50-54 25.374999999999996 23.044999999999998 23.56 28.02 55-59 24.759999999999998 23.925 23.685000000000002 27.63 60-64 25.330000000000002 23.59 23.335 27.744999999999997 65-69 25.695 23.65 23.665 26.99 70-74 25.535000000000004 23.595 23.54 27.33 75-79 25.55 23.525 23.75 27.175 80-84 24.834999999999997 24.095 24.02 27.05 85-89 25.435000000000002 23.515 23.715 27.334999999999997 90-94 26.135 23.435 23.115 27.315 95-99 26.615 23.11 23.305 26.97 100-104 26.265 23.91 22.869999999999997 26.955000000000002 105-109 26.075 22.955000000000002 23.415 27.555000000000003 110-114 26.105 23.085 23.73 27.08 115-119 26.015 23.169999999999998 23.400000000000002 27.415 120-124 26.395000000000003 22.68 23.145 27.779999999999998 125-129 26.565 22.925 23.01 27.500000000000004 130-134 26.405 22.869999999999997 22.955000000000002 27.77 135-139 26.545 23.235 23.015 27.205000000000002 140-144 26.845000000000002 22.62 23.085 27.450000000000003 145-149 26.765 23.35 22.625 27.26 150-151 26.924999999999997 22.8375 23.150000000000002 27.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 2.0 28 2.5 29 2.5 30 3.5 31 4.5 32 9.0 33 18.5 34 22.0 35 32.0 36 44.5 37 49.5 38 69.0 39 86.0 40 101.5 41 114.0 42 142.0 43 146.5 44 128.0 45 143.5 46 163.0 47 160.0 48 141.0 49 137.0 50 133.5 51 120.0 52 114.5 53 106.5 54 100.5 55 95.0 56 101.0 57 108.5 58 109.5 59 124.0 60 122.5 61 100.0 62 86.5 63 96.5 64 96.0 65 89.5 66 86.5 67 86.0 68 84.5 69 66.5 70 57.0 71 50.5 72 36.5 73 32.0 74 24.0 75 12.5 76 10.0 77 8.0 78 5.0 79 4.0 80 3.5 81 2.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.49287442860984 86.925 2 5.78112395805324 10.75 3 0.5108900242000538 1.425 4 0.18822264049475665 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026888948642108095 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGAAAGGAAAAACGCAAAGCAAAATGCCATGGTTGACGAAACCGGGCT 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138-139 1.2999999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804189 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804189_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2815 37.0 37.0 37.0 37.0 37.0 2 35.888 37.0 37.0 37.0 37.0 37.0 3 35.9515 37.0 37.0 37.0 37.0 37.0 4 36.0535 37.0 37.0 37.0 37.0 37.0 5 36.1395 37.0 37.0 37.0 37.0 37.0 6 36.1385 37.0 37.0 37.0 37.0 37.0 7 36.0485 37.0 37.0 37.0 37.0 37.0 8 36.1225 37.0 37.0 37.0 37.0 37.0 9 36.169 37.0 37.0 37.0 37.0 37.0 10-14 36.092600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.0303 37.0 37.0 37.0 37.0 37.0 20-24 36.0223 37.0 37.0 37.0 37.0 37.0 25-29 35.9837 37.0 37.0 37.0 37.0 37.0 30-34 35.975199999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.8458 37.0 37.0 37.0 37.0 37.0 40-44 35.8146 37.0 37.0 37.0 37.0 37.0 45-49 35.7586 37.0 37.0 37.0 37.0 37.0 50-54 35.7296 37.0 37.0 37.0 37.0 37.0 55-59 35.749900000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.5876 37.0 37.0 37.0 37.0 37.0 65-69 35.5715 37.0 37.0 37.0 37.0 37.0 70-74 35.5631 37.0 37.0 37.0 37.0 37.0 75-79 35.441 37.0 37.0 37.0 37.0 37.0 80-84 35.3212 37.0 37.0 37.0 32.2 37.0 85-89 35.291000000000004 37.0 37.0 37.0 29.8 37.0 90-94 35.261 37.0 37.0 37.0 32.2 37.0 95-99 35.1586 37.0 37.0 37.0 25.0 37.0 100-104 35.080200000000005 37.0 37.0 37.0 25.0 37.0 105-109 35.0111 37.0 37.0 37.0 25.0 37.0 110-114 34.8746 37.0 37.0 37.0 25.0 37.0 115-119 34.7584 37.0 37.0 37.0 25.0 37.0 120-124 34.685199999999995 37.0 37.0 37.0 25.0 37.0 125-129 34.6524 37.0 37.0 37.0 25.0 37.0 130-134 34.4513 37.0 37.0 37.0 25.0 37.0 135-139 34.306799999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.0797 37.0 37.0 37.0 25.0 37.0 145-149 34.0542 37.0 37.0 37.0 25.0 37.0 150-151 33.292249999999996 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 0.0 16 2.0 17 0.0 18 1.0 19 1.0 20 2.0 21 5.0 22 4.0 23 12.0 24 5.0 25 18.0 26 9.0 27 23.0 28 29.0 29 45.0 30 45.0 31 60.0 32 109.0 33 196.0 34 353.0 35 992.0 36 2027.0 37 59.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.425000000000004 12.525 12.0 39.050000000000004 2 29.45 17.05 28.775000000000002 24.725 3 24.425 21.25 27.025 27.3 4 28.050000000000004 29.125 16.3 26.525 5 29.25 29.925 17.65 23.175 6 23.65 31.65 18.425 26.275 7 22.325 13.775 35.85 28.050000000000004 8 22.725 18.0 22.2 37.075 9 24.925 19.650000000000002 25.25 30.175 10-14 26.715 23.125 21.665 28.494999999999997 15-19 26.884999999999998 23.435 21.915000000000003 27.765 20-24 27.24 23.29 21.945 27.525 25-29 26.645000000000003 23.51 21.825 28.02 30-34 26.979999999999997 23.68 21.91 27.43 35-39 27.235 23.505000000000003 21.36 27.900000000000002 40-44 27.255000000000003 23.105 21.64 28.000000000000004 45-49 27.38 22.735 21.275 28.610000000000003 50-54 27.05 22.89 22.075 27.985 55-59 27.935 22.32 21.875 27.87 60-64 27.375 22.134999999999998 21.765 28.725 65-69 27.07 22.825 21.98 28.125 70-74 27.310000000000002 22.02 21.8 28.87 75-79 27.139999999999997 22.455 21.68 28.725 80-84 27.855 22.375 21.73 28.04 85-89 27.74 22.650000000000002 21.88 27.73 90-94 27.83 22.189999999999998 21.94 28.04 95-99 27.725 22.14 21.95 28.185 100-104 27.644999999999996 22.56 21.84 27.955000000000002 105-109 27.43 22.85 21.87 27.85 110-114 28.015 22.155 21.985 27.845 115-119 27.755000000000003 22.475 22.15 27.62 120-124 27.584999999999997 22.895 21.515 28.005000000000003 125-129 28.04 22.720000000000002 21.615000000000002 27.625 130-134 28.185 22.55 22.009999999999998 27.255000000000003 135-139 27.12 23.244999999999997 22.005 27.63 140-144 28.78 22.735 21.32 27.165 145-149 28.294999999999998 22.925 21.795 26.985 150-151 28.1375 23.2125 22.0 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.5 27 2.0 28 2.0 29 3.0 30 4.0 31 3.5 32 6.0 33 9.5 34 11.0 35 19.5 36 29.5 37 37.0 38 43.5 39 56.0 40 76.0 41 84.0 42 93.0 43 110.5 44 113.0 45 112.0 46 114.5 47 110.0 48 114.0 49 124.0 50 113.0 51 101.5 52 103.0 53 95.5 54 97.5 55 112.0 56 104.0 57 109.0 58 122.0 59 119.0 60 113.0 61 117.0 62 145.5 63 151.5 64 124.0 65 105.5 66 103.0 67 103.5 68 104.5 69 100.0 70 90.0 71 84.5 72 77.0 73 60.5 74 43.5 75 34.5 76 24.5 77 11.5 78 12.0 79 10.5 80 7.0 81 6.0 82 3.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.125 #Duplication Level Percentage of deduplicated Percentage of total 1 93.48710990502035 86.125 2 5.400271370420624 9.950000000000001 3 0.7598371777476255 2.1 4 0.16282225237449116 0.6 5 0.054274084124830396 0.25 6 0.054274084124830396 0.3 7 0.027137042062415198 0.17500000000000002 8 0.0 0.0 9 0.027137042062415198 0.22499999999999998 >10 0.027137042062415198 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 11 0.27499999999999997 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 9 0.22499999999999998 No Hit CCGGACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCA 7 0.17500000000000002 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 6 0.15 No Hit GCCAACTGGTGCTACGCAACCGTCGCGCCCCGCGCTAAGAGCGTCGTCGT 5 0.125 No Hit AAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.8875 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138-139 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTAG 10 0.006830828 145.0 4 CTCTTGT 10 0.006830828 145.0 1 TGTTAGC 10 0.006830828 145.0 5 TCTTGTT 10 0.006830828 145.0 2 CTTGTTA 10 0.006830828 145.0 3 >>END_MODULE Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177190 spots for SRR7804189.sra Written 2177190 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra Read 2177188 spots for SRR7804189.sra Written 2177188 spots for SRR7804189.sra SRR ids: ['SRR7804189.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g69olzy0 SRR7804189.sra spots: 43543762 blocks: [[1, 2177188], [2177189, 4354376], [4354377, 6531564], [6531565, 8708752], [8708753, 10885940], [10885941, 13063128], [13063129, 15240316], [15240317, 17417504], [17417505, 19594692], [19594693, 21771880], [21771881, 23949068], [23949069, 26126256], [26126257, 28303444], [28303445, 30480632], [30480633, 32657820], [32657821, 34835008], [34835009, 37012196], [37012197, 39189384], [39189385, 41366572], [41366573, 43543762]] SRR7804189 file size 14733851 SRR7804189 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804189 SRR7804189_1.fastq SRR7804189_2.fastq Input file: SRR7804189_1.fastq Paired file: SRR7804189_2.fastq trimmed: SRR7804189-trimmed-pair1.fastq, SRR7804189-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:43:14 2024 >> started Tue Dec 10 03:44:03 2024 >> done (48.687s) 43543762 read pairs processed; of these: 119 ( 0.00%) short read pairs filtered out after trimming by size control 1559 ( 0.00%) empty read pairs filtered out after trimming by size control 43542084 (100.00%) read pairs available; of these: 1207975 ( 2.77%) trimmed read pairs available after processing 42334109 (97.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 19 0.00% 20 22 0.00% 21 25 0.00% 22 35 0.00% 23 41 0.00% 24 37 0.00% 25 52 0.00% 26 36 0.00% 27 36 0.00% 28 57 0.00% 29 43 0.00% 30 54 0.00% 31 53 0.00% 32 66 0.00% 33 44 0.00% 34 57 0.00% 35 66 0.00% 36 58 0.00% 37 59 0.00% 38 61 0.00% 39 62 0.00% 40 64 0.00% 41 73 0.00% 42 71 0.00% 43 72 0.00% 44 70 0.00% 45 82 0.00% 46 59 0.00% 47 77 0.00% 48 86 0.00% 49 111 0.00% 50 70 0.00% 51 89 0.00% 52 98 0.00% 53 104 0.00% 54 115 0.00% 55 94 0.00% 56 93 0.00% 57 124 0.00% 58 132 0.00% 59 123 0.00% 60 129 0.00% 61 130 0.00% 62 135 0.00% 63 162 0.00% 64 161 0.00% 65 176 0.00% 66 175 0.00% 67 191 0.00% 68 203 0.00% 69 224 0.00% 70 246 0.00% 71 290 0.00% 72 283 0.00% 73 301 0.00% 74 331 0.00% 75 347 0.00% 76 412 0.00% 77 423 0.00% 78 483 0.00% 79 519 0.00% 80 590 0.00% 81 643 0.00% 82 814 0.00% 83 855 0.00% 84 907 0.00% 85 1168 0.00% 86 1219 0.00% 87 1278 0.00% 88 1451 0.00% 89 1564 0.00% 90 1761 0.00% 91 1995 0.00% 92 2238 0.01% 93 2409 0.01% 94 2678 0.01% 95 3071 0.01% 96 3237 0.01% 97 3548 0.01% 98 3963 0.01% 99 4137 0.01% 100 4494 0.01% 101 4943 0.01% 102 5361 0.01% 103 5642 0.01% 104 6143 0.01% 105 6656 0.02% 106 7271 0.02% 107 7561 0.02% 108 7955 0.02% 109 8614 0.02% 110 9171 0.02% 111 9613 0.02% 112 10293 0.02% 113 11015 0.03% 114 11527 0.03% 115 12361 0.03% 116 13069 0.03% 117 13558 0.03% 118 14380 0.03% 119 15003 0.03% 120 15465 0.04% 121 16581 0.04% 122 17309 0.04% 123 18408 0.04% 124 19500 0.04% 125 20702 0.05% 126 21346 0.05% 127 21965 0.05% 128 22366 0.05% 129 23792 0.05% 130 24315 0.06% 131 25649 0.06% 132 27180 0.06% 133 28015 0.06% 134 29778 0.07% 135 31025 0.07% 136 31752 0.07% 137 32690 0.08% 138 33902 0.08% 139 36012 0.08% 140 35928 0.08% 141 37578 0.09% 142 38331 0.09% 143 39922 0.09% 144 41895 0.10% 145 43335 0.10% 146 45255 0.10% 147 47329 0.11% 148 48929 0.11% 149 48743 0.11% 150 50690 0.12% 151 42334109 97.23% 43542084 reads passed initial QC criterion=sequence-density sequence-density=1.77 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=21 prefix-density=1.81 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=53.97 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.1 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=1.41 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=22 prefix-density=1.50 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=98.64 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.2 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804189 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:44:53 Started mapping on | Dec 10 03:44:53 Finished on | Dec 10 03:52:20 Mapping speed, Million of reads per hour | 350.67 Number of input reads | 43542084 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 40838352 Uniquely mapped reads % | 93.79% Average mapped length | 299.91 Number of splices: Total | 41460409 Number of splices: Annotated (sjdb) | 39360708 Number of splices: GT/AG | 40920664 Number of splices: GC/AG | 483599 Number of splices: AT/AC | 9032 Number of splices: Non-canonical | 47114 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 448202 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 65680 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.93% % of reads unmapped: other | 1.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2255530 2255530 2255530 N_multimapping 448202 448202 448202 N_noFeature 1054482 39583036 1312216 N_ambiguous 1219663 5657 224670 UnstrandedReadsAssigned:38564207 PositiveStrandReadsAssigned:1249659 NegativeStrandReadsAssigned:39301466 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804189 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804189-trimmed-pair1.fastq SRR7804189-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,542,084 reads, 39,465,359 reads pseudoaligned [quant] estimated average fragment length: 327.26 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52973 SRR7804189.ke.tsv 35125 SRR7804189.se.tsv 88098 total ==> SRR7804189.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 611.053 0 0 PNS24247 1044 717.74 60.3336 2.49644 PNS24249 1928 1601.74 132.51 2.45689 PNS24246 1044 717.74 60.3336 2.49644 PNS24248 1044 717.74 60.3336 2.49644 PNS24244 1471 1144.74 98.4888 2.5551 PNS24243 293 73.4583 0 0 KQK14069 1603 1276.74 7231.57 168.213 KQK14071 474 192.813 109.311 16.8366 ==> SRR7804189.se.tsv <== BRADI_1g14170v3 7777 BRADI_1g53295v3 161 BRADI_1g59795v3 1638 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 377 BRADI_1g74790v3 153 BRADI_1g09890v3 0 BRADI_1g77505v3 428 BRADI_1g48960v3 0 SRR7804189 completed mapping pipeline successfully