Starting /dee2/code/volunteer_pipeline.sh SRR7804190 current disk space = 1526017798144 free memory = 1558102044 SRR7804190 SRAfilesize 84af37cd21af864c7dfbb159145adcb8 SRR7804190.sra SRR7804190.sra file validated SRR7804190 is paired end SRR7804190 is conventional basespace SRR7804190 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804190_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18675 37.0 37.0 37.0 37.0 37.0 2 36.324 37.0 37.0 37.0 37.0 37.0 3 36.3635 37.0 37.0 37.0 37.0 37.0 4 36.4755 37.0 37.0 37.0 37.0 37.0 5 36.5145 37.0 37.0 37.0 37.0 37.0 6 36.6285 37.0 37.0 37.0 37.0 37.0 7 36.4405 37.0 37.0 37.0 37.0 37.0 8 36.5385 37.0 37.0 37.0 37.0 37.0 9 36.5505 37.0 37.0 37.0 37.0 37.0 10-14 36.5554 37.0 37.0 37.0 37.0 37.0 15-19 36.5182 37.0 37.0 37.0 37.0 37.0 20-24 36.4955 37.0 37.0 37.0 37.0 37.0 25-29 36.4544 37.0 37.0 37.0 37.0 37.0 30-34 36.4034 37.0 37.0 37.0 37.0 37.0 35-39 36.3993 37.0 37.0 37.0 37.0 37.0 40-44 36.3513 37.0 37.0 37.0 37.0 37.0 45-49 36.29129999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.2543 37.0 37.0 37.0 37.0 37.0 55-59 36.2073 37.0 37.0 37.0 37.0 37.0 60-64 36.2163 37.0 37.0 37.0 37.0 37.0 65-69 36.200599999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.070299999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0662 37.0 37.0 37.0 37.0 37.0 80-84 36.0755 37.0 37.0 37.0 37.0 37.0 85-89 36.0279 37.0 37.0 37.0 37.0 37.0 90-94 35.9405 37.0 37.0 37.0 37.0 37.0 95-99 35.84119999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.811699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.768 37.0 37.0 37.0 37.0 37.0 110-114 35.7698 37.0 37.0 37.0 37.0 37.0 115-119 35.687 37.0 37.0 37.0 37.0 37.0 120-124 35.5736 37.0 37.0 37.0 37.0 37.0 125-129 35.5947 37.0 37.0 37.0 37.0 37.0 130-134 35.5004 37.0 37.0 37.0 37.0 37.0 135-139 35.4133 37.0 37.0 37.0 37.0 37.0 140-144 35.4013 37.0 37.0 37.0 34.6 37.0 145-149 35.1988 37.0 37.0 37.0 29.8 37.0 150-151 34.727999999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 2.0 25 6.0 26 6.0 27 9.0 28 17.0 29 29.0 30 40.0 31 48.0 32 72.0 33 98.0 34 167.0 35 456.0 36 2789.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.548306148055204 11.493099121706399 11.744040150564619 37.214554579673774 2 26.125 17.150000000000002 32.775 23.95 3 23.875 22.75 24.525 28.849999999999998 4 28.025 29.725 19.025 23.225 5 27.400000000000002 29.575000000000003 21.8 21.224999999999998 6 21.825 32.525 22.125 23.525 7 17.599999999999998 20.974999999999998 40.1 21.325 8 21.325 19.225 27.85 31.6 9 21.825 19.675 29.049999999999997 29.45 10-14 24.45 25.7 24.055 25.795 15-19 24.495 24.075 24.825 26.605 20-24 24.154999999999998 23.855 24.93 27.060000000000002 25-29 24.815 24.395 23.995 26.795 30-34 24.125 24.685000000000002 24.605 26.584999999999997 35-39 24.63 24.959999999999997 23.880000000000003 26.529999999999998 40-44 24.315 24.875 24.22 26.590000000000003 45-49 25.014999999999997 24.240000000000002 24.224999999999998 26.52 50-54 24.6 24.77 23.68 26.950000000000003 55-59 24.45 25.25 23.235 27.065 60-64 24.525 24.55 23.71 27.215 65-69 24.805 23.69 24.12 27.384999999999998 70-74 25.235000000000003 23.95 23.5 27.315 75-79 25.480000000000004 23.849999999999998 24.12 26.55 80-84 25.455 23.93 23.785 26.83 85-89 24.935 23.24 24.445 27.38 90-94 25.71 23.455000000000002 24.5 26.334999999999997 95-99 25.25 23.68 23.87 27.200000000000003 100-104 25.45 23.325000000000003 23.895 27.33 105-109 25.580000000000002 23.745 23.78 26.895000000000003 110-114 25.624999999999996 23.56 23.59 27.224999999999998 115-119 25.724999999999998 23.65 22.975 27.650000000000002 120-124 25.335 23.605 24.14 26.919999999999998 125-129 25.535000000000004 23.325000000000003 23.78 27.36 130-134 25.735000000000003 22.830000000000002 23.48 27.955000000000002 135-139 26.484999999999996 22.96 23.68 26.875 140-144 26.314999999999998 23.01 23.96 26.715 145-149 25.545 23.705000000000002 23.580000000000002 27.169999999999998 150-151 26.637499999999996 22.5125 23.2125 27.6375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 0.5 24 0.5 25 0.0 26 1.0 27 1.5 28 1.5 29 2.0 30 5.0 31 7.0 32 9.5 33 17.0 34 23.0 35 25.5 36 34.5 37 52.5 38 74.0 39 88.5 40 95.5 41 122.5 42 148.5 43 157.5 44 180.0 45 178.0 46 170.0 47 163.5 48 146.0 49 147.5 50 153.5 51 162.0 52 150.0 53 119.5 54 102.0 55 97.5 56 90.5 57 91.0 58 94.0 59 87.0 60 84.0 61 81.0 62 69.5 63 67.0 64 72.5 65 72.5 66 72.5 67 64.5 68 56.5 69 58.5 70 53.0 71 46.0 72 45.0 73 38.5 74 27.0 75 20.5 76 18.5 77 13.5 78 9.0 79 9.5 80 7.5 81 4.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.04872267579668 90.225 2 4.582565183039241 8.7 3 0.3423755596523571 0.975 4 0.02633658151171978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.4375 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1125 0.0 0.0 0.0 0.0 136-137 1.1375 0.0 0.0 0.0 0.0 138-139 1.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCATGA 10 0.006830828 145.0 1 >>END_MODULE SRR7804190 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804190_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.377 37.0 37.0 37.0 37.0 37.0 2 36.2115 37.0 37.0 37.0 37.0 37.0 3 36.321 37.0 37.0 37.0 37.0 37.0 4 36.2795 37.0 37.0 37.0 37.0 37.0 5 36.373 37.0 37.0 37.0 37.0 37.0 6 36.323 37.0 37.0 37.0 37.0 37.0 7 36.151 37.0 37.0 37.0 37.0 37.0 8 36.3085 37.0 37.0 37.0 37.0 37.0 9 36.331 37.0 37.0 37.0 37.0 37.0 10-14 36.2358 37.0 37.0 37.0 37.0 37.0 15-19 36.153800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1322 37.0 37.0 37.0 37.0 37.0 25-29 36.075 37.0 37.0 37.0 37.0 37.0 30-34 36.0163 37.0 37.0 37.0 37.0 37.0 35-39 36.006299999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.958600000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9486 37.0 37.0 37.0 37.0 37.0 50-54 35.93900000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.8928 37.0 37.0 37.0 37.0 37.0 60-64 35.768100000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8149 37.0 37.0 37.0 37.0 37.0 70-74 35.7284 37.0 37.0 37.0 37.0 37.0 75-79 35.738299999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.5998 37.0 37.0 37.0 37.0 37.0 85-89 35.5099 37.0 37.0 37.0 37.0 37.0 90-94 35.497600000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.37 37.0 37.0 37.0 37.0 37.0 100-104 35.374100000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.3896 37.0 37.0 37.0 37.0 37.0 110-114 35.2177 37.0 37.0 37.0 29.8 37.0 115-119 35.136199999999995 37.0 37.0 37.0 27.4 37.0 120-124 35.0658 37.0 37.0 37.0 25.0 37.0 125-129 34.9658 37.0 37.0 37.0 25.0 37.0 130-134 34.9529 37.0 37.0 37.0 25.0 37.0 135-139 34.7407 37.0 37.0 37.0 25.0 37.0 140-144 34.6301 37.0 37.0 37.0 25.0 37.0 145-149 34.4988 37.0 37.0 37.0 25.0 37.0 150-151 33.8295 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 6.0 15 7.0 16 4.0 17 4.0 18 3.0 19 2.0 20 5.0 21 4.0 22 8.0 23 8.0 24 16.0 25 4.0 26 14.0 27 8.0 28 9.0 29 20.0 30 34.0 31 42.0 32 67.0 33 131.0 34 265.0 35 719.0 36 2516.0 37 101.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.625 13.575000000000001 12.049999999999999 34.75 2 30.475 18.6 28.925 22.0 3 26.450000000000003 21.825 24.65 27.075 4 28.575 30.2 16.875 24.349999999999998 5 29.2 30.85 17.299999999999997 22.650000000000002 6 22.900000000000002 33.95 18.35 24.8 7 22.775000000000002 15.299999999999999 34.675 27.250000000000004 8 23.05 20.849999999999998 21.775 34.325 9 25.424999999999997 20.325 23.325000000000003 30.925000000000004 10-14 27.015 24.58 20.94 27.465 15-19 26.3 24.425 22.575 26.700000000000003 20-24 26.82 24.43 21.46 27.29 25-29 26.924999999999997 24.33 22.040000000000003 26.705000000000002 30-34 26.810000000000002 24.26 22.025 26.905 35-39 27.245 24.165 21.86 26.729999999999997 40-44 26.76 24.055 22.39 26.795 45-49 27.384999999999998 24.15 21.72 26.745 50-54 27.025 24.68 21.78 26.515 55-59 27.62 23.915 21.884999999999998 26.58 60-64 27.52 24.240000000000002 21.64 26.6 65-69 27.16 24.36 22.29 26.19 70-74 26.77 23.91 22.31 27.01 75-79 27.71 23.45 21.94 26.900000000000002 80-84 27.6 24.34 21.775 26.284999999999997 85-89 27.41 24.104999999999997 22.345000000000002 26.14 90-94 27.57 24.02 22.02 26.39 95-99 27.644999999999996 24.585 21.925 25.845000000000002 100-104 27.525 23.905 21.86 26.71 105-109 27.62 24.03 22.41 25.94 110-114 27.72 23.685000000000002 22.12 26.474999999999998 115-119 27.3 24.779999999999998 21.66 26.26 120-124 27.35 24.41 22.125 26.115 125-129 27.694999999999997 24.19 21.990000000000002 26.125 130-134 27.900000000000002 23.75 21.97 26.38 135-139 27.875 24.044999999999998 22.915 25.165 140-144 28.155 23.95 22.295 25.6 145-149 27.825 24.73 21.884999999999998 25.56 150-151 27.6 24.775 22.75 24.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 1.0 28 2.0 29 2.5 30 3.0 31 5.0 32 6.0 33 8.5 34 10.5 35 13.5 36 20.0 37 35.5 38 59.5 39 67.0 40 79.5 41 105.5 42 109.5 43 113.5 44 136.5 45 120.5 46 111.5 47 146.5 48 153.5 49 143.5 50 137.0 51 135.0 52 139.5 53 137.0 54 134.5 55 129.5 56 112.5 57 106.0 58 109.0 59 110.0 60 97.5 61 87.0 62 92.0 63 94.5 64 83.0 65 88.0 66 96.5 67 86.0 68 85.5 69 79.5 70 74.0 71 56.5 72 42.0 73 45.0 74 42.5 75 36.5 76 22.5 77 17.5 78 18.5 79 11.5 80 6.0 81 2.5 82 2.0 83 3.0 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 1.0 95 1.0 96 0.5 97 0.5 98 0.0 99 1.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.70058293587705 89.35 2 4.769475357710652 9.0 3 0.45045045045045046 1.275 4 0.026497085320614733 0.1 5 0.026497085320614733 0.125 6 0.026497085320614733 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0125 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.6625000000000001 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.1124999999999998 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGAGG 10 0.006830828 145.0 6 >>END_MODULE Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014023 spots for SRR7804190.sra Written 2014023 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra Read 2014019 spots for SRR7804190.sra Written 2014019 spots for SRR7804190.sra SRR ids: ['SRR7804190.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eui_g4_0 SRR7804190.sra spots: 40280384 blocks: [[1, 2014019], [2014020, 4028038], [4028039, 6042057], [6042058, 8056076], [8056077, 10070095], [10070096, 12084114], [12084115, 14098133], [14098134, 16112152], [16112153, 18126171], [18126172, 20140190], [20140191, 22154209], [22154210, 24168228], [24168229, 26182247], [26182248, 28196266], [28196267, 30210285], [30210286, 32224304], [32224305, 34238323], [34238324, 36252342], [36252343, 38266361], [38266362, 40280384]] SRR7804190 file size 13628000 SRR7804190 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804190 SRR7804190_1.fastq SRR7804190_2.fastq Input file: SRR7804190_1.fastq Paired file: SRR7804190_2.fastq trimmed: SRR7804190-trimmed-pair1.fastq, SRR7804190-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:41:20 2024 >> started Tue Dec 10 03:43:55 2024 >> done (155.424s) 40280384 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 8169 ( 0.02%) empty read pairs filtered out after trimming by size control 40272120 (99.98%) read pairs available; of these: 1227093 ( 3.05%) trimmed read pairs available after processing 39045027 (96.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 18 0.00% 20 23 0.00% 21 25 0.00% 22 41 0.00% 23 28 0.00% 24 30 0.00% 25 44 0.00% 26 36 0.00% 27 44 0.00% 28 52 0.00% 29 40 0.00% 30 64 0.00% 31 55 0.00% 32 73 0.00% 33 68 0.00% 34 75 0.00% 35 88 0.00% 36 89 0.00% 37 82 0.00% 38 99 0.00% 39 88 0.00% 40 87 0.00% 41 89 0.00% 42 114 0.00% 43 105 0.00% 44 97 0.00% 45 79 0.00% 46 111 0.00% 47 113 0.00% 48 116 0.00% 49 123 0.00% 50 115 0.00% 51 125 0.00% 52 123 0.00% 53 144 0.00% 54 148 0.00% 55 153 0.00% 56 134 0.00% 57 136 0.00% 58 144 0.00% 59 148 0.00% 60 178 0.00% 61 204 0.00% 62 166 0.00% 63 203 0.00% 64 173 0.00% 65 182 0.00% 66 202 0.00% 67 230 0.00% 68 212 0.00% 69 257 0.00% 70 239 0.00% 71 248 0.00% 72 302 0.00% 73 340 0.00% 74 337 0.00% 75 348 0.00% 76 365 0.00% 77 396 0.00% 78 421 0.00% 79 496 0.00% 80 535 0.00% 81 533 0.00% 82 678 0.00% 83 651 0.00% 84 802 0.00% 85 853 0.00% 86 1072 0.00% 87 1072 0.00% 88 1173 0.00% 89 1328 0.00% 90 1438 0.00% 91 1659 0.00% 92 1934 0.00% 93 2011 0.00% 94 2283 0.01% 95 2621 0.01% 96 2785 0.01% 97 3071 0.01% 98 3318 0.01% 99 3608 0.01% 100 3909 0.01% 101 4243 0.01% 102 4772 0.01% 103 5074 0.01% 104 5538 0.01% 105 6102 0.02% 106 6620 0.02% 107 7104 0.02% 108 7351 0.02% 109 7812 0.02% 110 8346 0.02% 111 8920 0.02% 112 9740 0.02% 113 10391 0.03% 114 11515 0.03% 115 12131 0.03% 116 12727 0.03% 117 13184 0.03% 118 14306 0.04% 119 14682 0.04% 120 15507 0.04% 121 16554 0.04% 122 17470 0.04% 123 18325 0.05% 124 19289 0.05% 125 20716 0.05% 126 21965 0.05% 127 22287 0.06% 128 22520 0.06% 129 24244 0.06% 130 25345 0.06% 131 25986 0.06% 132 27488 0.07% 133 29176 0.07% 134 30478 0.08% 135 31885 0.08% 136 33597 0.08% 137 34293 0.09% 138 35618 0.09% 139 36375 0.09% 140 37319 0.09% 141 38659 0.10% 142 40452 0.10% 143 41512 0.10% 144 44180 0.11% 145 46286 0.11% 146 47887 0.12% 147 49296 0.12% 148 50379 0.13% 149 51697 0.13% 150 53342 0.13% 151 39045027 96.95% 40272120 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=2.8 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCTTCGGTCGAGTGCTCGAACTTGCTTAGGAAGAAGATTAAGCTGAAGGCTTCTAGGCTTGTGTGTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=109.72 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=22.2 sequence=CGGCGGCGGCCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.89 fanout-score-rank=19 prefix-density=0.40 prefix-fanout=3.8 sequence=GGCAAGACCATCACCCTTGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=111.68 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804190 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:45:03 Started mapping on | Dec 10 03:45:04 Finished on | Dec 10 03:56:21 Mapping speed, Million of reads per hour | 214.15 Number of input reads | 40272120 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 36233574 Uniquely mapped reads % | 89.97% Average mapped length | 299.88 Number of splices: Total | 36249999 Number of splices: Annotated (sjdb) | 34257706 Number of splices: GT/AG | 35789257 Number of splices: GC/AG | 398018 Number of splices: AT/AC | 12612 Number of splices: Non-canonical | 50112 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 725619 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 42254 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.18% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3312927 3312927 3312927 N_multimapping 725619 725619 725619 N_noFeature 974816 35218056 1320632 N_ambiguous 789716 5336 120385 UnstrandedReadsAssigned:34469042 PositiveStrandReadsAssigned:1010182 NegativeStrandReadsAssigned:34792557 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804190 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804190-trimmed-pair1.fastq SRR7804190-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,272,120 reads, 35,519,225 reads pseudoaligned [quant] estimated average fragment length: 313.202 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR7804190.ke.tsv 35125 SRR7804190.se.tsv 88098 total ==> SRR7804190.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 624.58 17.4555 0.959968 PNS24247 1044 731.798 55.4043 2.60054 PNS24249 1928 1615.8 364.409 7.74664 PNS24246 1044 731.798 55.4043 2.60054 PNS24248 1044 731.798 55.4043 2.60054 PNS24244 1471 1158.8 34.9231 1.03518 PNS24243 293 74.055 1 0.463828 KQK14069 1603 1290.8 206.911 5.506 KQK14071 474 196.703 0 0 ==> SRR7804190.se.tsv <== BRADI_1g14170v3 210 BRADI_1g53295v3 19 BRADI_1g59795v3 261 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1502 BRADI_1g74790v3 1805 BRADI_1g09890v3 0 BRADI_1g77505v3 143 BRADI_1g48960v3 0 SRR7804190 completed mapping pipeline successfully