Starting /dee2/code/volunteer_pipeline.sh SRR7804191 current disk space = 1526028029952 free memory = 1560667648 SRR7804191 SRAfilesize 264cba64d92ac02a9af33c6c8a4aeade SRR7804191.sra SRR7804191.sra file validated SRR7804191 is paired end SRR7804191 is conventional basespace SRR7804191 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804191_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.16075 37.0 37.0 37.0 37.0 37.0 2 36.104 37.0 37.0 37.0 37.0 37.0 3 36.293 37.0 37.0 37.0 37.0 37.0 4 36.5025 37.0 37.0 37.0 37.0 37.0 5 36.4375 37.0 37.0 37.0 37.0 37.0 6 36.4115 37.0 37.0 37.0 37.0 37.0 7 36.3795 37.0 37.0 37.0 37.0 37.0 8 36.4375 37.0 37.0 37.0 37.0 37.0 9 36.3485 37.0 37.0 37.0 37.0 37.0 10-14 36.4924 37.0 37.0 37.0 37.0 37.0 15-19 36.4102 37.0 37.0 37.0 37.0 37.0 20-24 36.425 37.0 37.0 37.0 37.0 37.0 25-29 36.3604 37.0 37.0 37.0 37.0 37.0 30-34 36.3718 37.0 37.0 37.0 37.0 37.0 35-39 36.3528 37.0 37.0 37.0 37.0 37.0 40-44 36.2842 37.0 37.0 37.0 37.0 37.0 45-49 36.2225 37.0 37.0 37.0 37.0 37.0 50-54 36.2196 37.0 37.0 37.0 37.0 37.0 55-59 36.1494 37.0 37.0 37.0 37.0 37.0 60-64 36.1652 37.0 37.0 37.0 37.0 37.0 65-69 36.14620000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.0929 37.0 37.0 37.0 37.0 37.0 75-79 36.02980000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.082800000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.0303 37.0 37.0 37.0 37.0 37.0 90-94 35.939299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.83669999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.7752 37.0 37.0 37.0 37.0 37.0 105-109 35.779999999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.76519999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6742 37.0 37.0 37.0 37.0 37.0 120-124 35.4507 37.0 37.0 37.0 37.0 37.0 125-129 35.5589 37.0 37.0 37.0 37.0 37.0 130-134 35.417199999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.3151 37.0 37.0 37.0 34.6 37.0 140-144 35.383 37.0 37.0 37.0 34.6 37.0 145-149 35.0167 37.0 37.0 37.0 25.0 37.0 150-151 34.42875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 7.0 25 5.0 26 6.0 27 11.0 28 19.0 29 35.0 30 38.0 31 41.0 32 75.0 33 110.0 34 194.0 35 496.0 36 2723.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.499373904332586 12.096168294515403 10.318056599048335 35.08640120210369 2 26.5 16.775000000000002 32.125 24.6 3 23.375 25.324999999999996 22.475 28.825 4 27.700000000000003 31.075000000000003 18.575 22.650000000000002 5 26.85 31.525 21.3 20.325 6 22.7 32.75 22.525000000000002 22.025 7 18.7 20.599999999999998 39.25 21.45 8 22.0 19.7 26.224999999999998 32.074999999999996 9 21.75 20.1 28.999999999999996 29.15 10-14 24.42 25.655 23.64 26.284999999999997 15-19 25.185000000000002 24.67 24.64 25.505 20-24 24.98 24.505 24.3 26.215 25-29 24.455 24.59 24.0 26.955000000000002 30-34 24.575 24.58 24.615000000000002 26.229999999999997 35-39 24.75 24.875 24.23 26.145000000000003 40-44 24.925 24.45 23.775 26.85 45-49 24.825 24.175 23.51 27.49 50-54 25.324999999999996 23.845 23.93 26.900000000000002 55-59 24.955 24.455 23.705000000000002 26.884999999999998 60-64 25.085 23.885 24.265 26.765 65-69 25.119999999999997 23.9 23.815 27.165 70-74 25.66 23.68 23.935000000000002 26.724999999999998 75-79 25.305 23.75 23.830000000000002 27.115000000000002 80-84 25.055 23.945 23.68 27.32 85-89 25.665 23.435 24.495 26.405 90-94 25.705 23.605 24.15 26.540000000000003 95-99 25.795 23.830000000000002 23.599999999999998 26.775 100-104 25.935000000000002 23.599999999999998 23.39 27.075 105-109 25.935000000000002 23.369999999999997 23.47 27.224999999999998 110-114 25.72 23.855 23.585 26.840000000000003 115-119 25.130000000000003 23.915 23.29 27.665 120-124 26.334999999999997 23.87 22.905 26.889999999999997 125-129 25.779999999999998 23.505000000000003 23.474999999999998 27.24 130-134 26.68 23.325000000000003 23.599999999999998 26.395000000000003 135-139 26.215 23.585 23.275000000000002 26.924999999999997 140-144 26.450000000000003 23.095 23.11 27.345000000000002 145-149 26.625 23.22 23.580000000000002 26.575 150-151 25.8625 23.375 23.1125 27.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 1.5 29 6.0 30 9.5 31 10.5 32 14.0 33 19.5 34 22.5 35 30.5 36 39.5 37 49.5 38 74.0 39 93.5 40 103.0 41 112.5 42 134.5 43 153.5 44 169.0 45 170.5 46 158.5 47 156.5 48 150.5 49 140.0 50 133.5 51 137.5 52 129.0 53 117.0 54 109.5 55 94.0 56 95.0 57 108.5 58 101.0 59 96.5 60 92.5 61 97.5 62 88.0 63 63.5 64 70.5 65 76.5 66 78.0 67 74.0 68 70.0 69 64.5 70 58.5 71 51.0 72 37.0 73 34.0 74 26.0 75 17.5 76 15.0 77 9.0 78 9.0 79 8.5 80 4.5 81 2.0 82 2.5 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.85759493670885 89.925 2 4.825949367088608 9.15 3 0.290084388185654 0.8250000000000001 4 0.026371308016877634 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.3125 0.0 0.0 0.0 0.0 126-127 0.3625 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.5625 0.0 0.0 0.0 0.0 134-135 0.65 0.0 0.0 0.0 0.0 136-137 0.75 0.0 0.0 0.0 0.0 138-139 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804191 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804191_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.298 37.0 37.0 37.0 37.0 37.0 2 36.045 37.0 37.0 37.0 37.0 37.0 3 36.0435 37.0 37.0 37.0 37.0 37.0 4 36.2045 37.0 37.0 37.0 37.0 37.0 5 36.189 37.0 37.0 37.0 37.0 37.0 6 36.0385 37.0 37.0 37.0 37.0 37.0 7 36.0145 37.0 37.0 37.0 37.0 37.0 8 36.0875 37.0 37.0 37.0 37.0 37.0 9 36.081 37.0 37.0 37.0 37.0 37.0 10-14 35.9766 37.0 37.0 37.0 37.0 37.0 15-19 35.9486 37.0 37.0 37.0 37.0 37.0 20-24 35.9266 37.0 37.0 37.0 37.0 37.0 25-29 35.8572 37.0 37.0 37.0 37.0 37.0 30-34 35.858599999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.772000000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.697300000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.714600000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.669 37.0 37.0 37.0 37.0 37.0 55-59 35.6738 37.0 37.0 37.0 37.0 37.0 60-64 35.5904 37.0 37.0 37.0 37.0 37.0 65-69 35.5213 37.0 37.0 37.0 37.0 37.0 70-74 35.4431 37.0 37.0 37.0 37.0 37.0 75-79 35.487 37.0 37.0 37.0 37.0 37.0 80-84 35.3519 37.0 37.0 37.0 37.0 37.0 85-89 35.312799999999996 37.0 37.0 37.0 34.6 37.0 90-94 35.2285 37.0 37.0 37.0 29.8 37.0 95-99 35.104299999999995 37.0 37.0 37.0 25.0 37.0 100-104 35.050799999999995 37.0 37.0 37.0 25.0 37.0 105-109 34.969 37.0 37.0 37.0 25.0 37.0 110-114 34.8563 37.0 37.0 37.0 25.0 37.0 115-119 34.8706 37.0 37.0 37.0 25.0 37.0 120-124 34.6801 37.0 37.0 37.0 25.0 37.0 125-129 34.6383 37.0 37.0 37.0 25.0 37.0 130-134 34.646699999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.3422 37.0 37.0 37.0 25.0 37.0 140-144 34.207 37.0 37.0 37.0 25.0 37.0 145-149 34.0683 37.0 37.0 37.0 25.0 37.0 150-151 33.4895 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 5.0 15 3.0 16 2.0 17 7.0 18 4.0 19 3.0 20 3.0 21 7.0 22 8.0 23 7.0 24 10.0 25 9.0 26 21.0 27 12.0 28 27.0 29 28.0 30 40.0 31 64.0 32 116.0 33 163.0 34 339.0 35 867.0 36 2171.0 37 78.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.550000000000004 13.05 12.0 34.4 2 29.675 18.4 28.025 23.9 3 25.4 21.95 26.85 25.8 4 28.225 30.025000000000002 15.825 25.924999999999997 5 29.099999999999998 30.725 16.8 23.375 6 22.475 33.25 18.5 25.775 7 22.400000000000002 15.15 34.2 28.249999999999996 8 23.5 19.575 20.8 36.125 9 23.7 20.625 23.95 31.724999999999998 10-14 26.815 24.37 21.15 27.665 15-19 26.634999999999998 23.97 21.834999999999997 27.560000000000002 20-24 27.060000000000002 23.1 21.84 28.000000000000004 25-29 26.700000000000003 23.745 22.455 27.1 30-34 27.334999999999997 23.974999999999998 21.9 26.790000000000003 35-39 27.05 23.205000000000002 21.65 28.095 40-44 27.365000000000002 23.84 21.595 27.200000000000003 45-49 27.605 23.21 21.95 27.235 50-54 27.255000000000003 23.405 21.905 27.435 55-59 27.37 22.925 22.11 27.595 60-64 26.825 22.665 22.33 28.18 65-69 26.965 23.625 21.935 27.474999999999998 70-74 26.924999999999997 22.97 21.905 28.199999999999996 75-79 27.115000000000002 23.25 22.015 27.62 80-84 27.634999999999998 23.36 21.52 27.485 85-89 28.235 22.735 21.675 27.355 90-94 27.11 23.61 21.91 27.37 95-99 27.405 23.315 21.765 27.515 100-104 27.66 23.005 22.25 27.084999999999997 105-109 28.194999999999997 23.515 21.675 26.615 110-114 27.37 23.86 21.78 26.99 115-119 27.935 23.405 21.82 26.840000000000003 120-124 27.605 23.419999999999998 22.185 26.790000000000003 125-129 27.644999999999996 23.25 22.025 27.08 130-134 27.57 23.78 21.745 26.905 135-139 28.055000000000003 23.84 21.695 26.41 140-144 27.88 23.535 22.155 26.43 145-149 27.57 23.785 22.384999999999998 26.26 150-151 27.737499999999997 23.5625 21.975 26.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 1.0 12 0.5 13 1.0 14 1.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 2.5 28 2.0 29 2.5 30 4.5 31 7.0 32 8.5 33 9.0 34 12.5 35 15.0 36 18.5 37 32.5 38 50.0 39 61.0 40 77.0 41 94.0 42 113.5 43 118.0 44 106.5 45 126.5 46 148.5 47 136.5 48 121.5 49 122.5 50 125.0 51 118.5 52 107.0 53 99.0 54 96.0 55 94.5 56 102.5 57 107.5 58 116.0 59 120.5 60 116.0 61 113.0 62 119.5 63 119.0 64 106.0 65 97.5 66 89.0 67 92.5 68 96.0 69 94.0 70 88.0 71 81.5 72 68.5 73 55.0 74 45.0 75 37.0 76 30.0 77 20.0 78 14.0 79 8.0 80 6.0 81 4.5 82 0.5 83 1.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 1.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.77592150623177 89.35 2 4.746751524794484 8.95 3 0.3447361442588173 0.975 4 0.05303632988597189 0.2 5 0.0 0.0 6 0.05303632988597189 0.3 7 0.0 0.0 8 0.0 0.0 9 0.026518164942985947 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 9 0.22499999999999998 No Hit GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.3125 0.0 0.0 0.0 0.0 126-127 0.3625 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.525 0.0 0.0 0.0 0.0 132-133 0.5625 0.0 0.0 0.0 0.0 134-135 0.6375 0.0 0.0 0.0 0.0 136-137 0.7625 0.0 0.0 0.0 0.0 138-139 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTACC 10 0.006830828 145.0 5 >>END_MODULE Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357140 spots for SRR7804191.sra Written 1357140 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra Read 1357127 spots for SRR7804191.sra Written 1357127 spots for SRR7804191.sra SRR ids: ['SRR7804191.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i5uvwnx5 SRR7804191.sra spots: 27142553 blocks: [[1, 1357127], [1357128, 2714254], [2714255, 4071381], [4071382, 5428508], [5428509, 6785635], [6785636, 8142762], [8142763, 9499889], [9499890, 10857016], [10857017, 12214143], [12214144, 13571270], [13571271, 14928397], [14928398, 16285524], [16285525, 17642651], [17642652, 18999778], [18999779, 20356905], [20356906, 21714032], [21714033, 23071159], [23071160, 24428286], [24428287, 25785413], [25785414, 27142553]] SRR7804191 file size 9176020 SRR7804191 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804191 SRR7804191_1.fastq SRR7804191_2.fastq Input file: SRR7804191_1.fastq Paired file: SRR7804191_2.fastq trimmed: SRR7804191-trimmed-pair1.fastq, SRR7804191-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:39:15 2024 >> started Tue Dec 10 03:39:50 2024 >> done (35.078s) 27142553 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 764 ( 0.00%) empty read pairs filtered out after trimming by size control 27141711 (100.00%) read pairs available; of these: 529991 ( 1.95%) trimmed read pairs available after processing 26611720 (98.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 15 0.00% 21 16 0.00% 22 21 0.00% 23 11 0.00% 24 24 0.00% 25 26 0.00% 26 21 0.00% 27 32 0.00% 28 23 0.00% 29 48 0.00% 30 39 0.00% 31 58 0.00% 32 44 0.00% 33 31 0.00% 34 48 0.00% 35 52 0.00% 36 53 0.00% 37 55 0.00% 38 62 0.00% 39 44 0.00% 40 52 0.00% 41 62 0.00% 42 55 0.00% 43 49 0.00% 44 58 0.00% 45 59 0.00% 46 56 0.00% 47 64 0.00% 48 59 0.00% 49 69 0.00% 50 61 0.00% 51 54 0.00% 52 77 0.00% 53 79 0.00% 54 84 0.00% 55 105 0.00% 56 92 0.00% 57 77 0.00% 58 71 0.00% 59 77 0.00% 60 88 0.00% 61 104 0.00% 62 104 0.00% 63 98 0.00% 64 115 0.00% 65 115 0.00% 66 100 0.00% 67 119 0.00% 68 120 0.00% 69 122 0.00% 70 98 0.00% 71 136 0.00% 72 154 0.00% 73 158 0.00% 74 141 0.00% 75 178 0.00% 76 165 0.00% 77 167 0.00% 78 220 0.00% 79 238 0.00% 80 227 0.00% 81 239 0.00% 82 269 0.00% 83 288 0.00% 84 327 0.00% 85 354 0.00% 86 421 0.00% 87 438 0.00% 88 512 0.00% 89 533 0.00% 90 563 0.00% 91 665 0.00% 92 703 0.00% 93 814 0.00% 94 906 0.00% 95 1046 0.00% 96 1133 0.00% 97 1250 0.00% 98 1278 0.00% 99 1472 0.01% 100 1601 0.01% 101 1733 0.01% 102 1896 0.01% 103 2057 0.01% 104 2218 0.01% 105 2522 0.01% 106 2743 0.01% 107 2779 0.01% 108 3111 0.01% 109 3194 0.01% 110 3624 0.01% 111 3753 0.01% 112 4024 0.01% 113 4515 0.02% 114 4616 0.02% 115 5160 0.02% 116 5365 0.02% 117 5521 0.02% 118 5999 0.02% 119 6231 0.02% 120 6412 0.02% 121 6935 0.03% 122 7212 0.03% 123 7798 0.03% 124 8302 0.03% 125 8687 0.03% 126 9060 0.03% 127 9557 0.04% 128 9724 0.04% 129 10195 0.04% 130 10617 0.04% 131 10945 0.04% 132 12022 0.04% 133 12408 0.05% 134 13095 0.05% 135 13962 0.05% 136 14366 0.05% 137 14896 0.05% 138 15387 0.06% 139 16115 0.06% 140 16054 0.06% 141 16961 0.06% 142 17757 0.07% 143 18284 0.07% 144 19054 0.07% 145 20266 0.07% 146 21097 0.08% 147 21965 0.08% 148 22846 0.08% 149 22990 0.08% 150 24077 0.09% 151 26611720 98.05% 27141711 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=22 prefix-density=0.98 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=13.54 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.5 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=19 prefix-density=0.91 prefix-fanout=2.8 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=88.27 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.7 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804191 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:40:45 Started mapping on | Dec 10 03:40:46 Finished on | Dec 10 03:45:48 Mapping speed, Million of reads per hour | 323.54 Number of input reads | 27141711 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 24910952 Uniquely mapped reads % | 91.78% Average mapped length | 300.18 Number of splices: Total | 25354964 Number of splices: Annotated (sjdb) | 23995024 Number of splices: GT/AG | 25008518 Number of splices: GC/AG | 302504 Number of splices: AT/AC | 10717 Number of splices: Non-canonical | 33225 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286280 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 28050 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.23% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1944479 1944479 1944479 N_multimapping 286280 286280 286280 N_noFeature 585562 24181196 747654 N_ambiguous 702538 3898 135731 UnstrandedReadsAssigned:23622852 PositiveStrandReadsAssigned:725858 NegativeStrandReadsAssigned:24027567 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804191 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804191-trimmed-pair1.fastq SRR7804191-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,141,711 reads, 24,359,590 reads pseudoaligned [quant] estimated average fragment length: 341.171 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR7804191.ke.tsv 35125 SRR7804191.se.tsv 88098 total ==> SRR7804191.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 596.812 32.4093 2.66471 PNS24247 1044 703.829 31.5011 2.19622 PNS24249 1928 1587.83 153.635 4.74792 PNS24246 1044 703.829 31.5011 2.19622 PNS24248 1044 703.829 31.5011 2.19622 PNS24244 1471 1130.83 71.4529 3.10057 PNS24243 293 69.3226 0 0 KQK14069 1603 1262.83 301.47 11.7143 KQK14071 474 183.874 1.65338 0.441237 ==> SRR7804191.se.tsv <== BRADI_1g14170v3 316 BRADI_1g53295v3 211 BRADI_1g59795v3 522 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 3850 BRADI_1g74790v3 182 BRADI_1g09890v3 11 BRADI_1g77505v3 354 BRADI_1g48960v3 0 SRR7804191 completed mapping pipeline successfully