Starting /dee2/code/volunteer_pipeline.sh SRR7804192 current disk space = 1526165827584 free memory = 1602341088 SRR7804192 SRAfilesize d8a2a01e1e1417de54d5928d23786be7 SRR7804192.sra SRR7804192.sra file validated SRR7804192 is paired end SRR7804192 is conventional basespace SRR7804192 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804192_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1375 37.0 37.0 37.0 37.0 37.0 2 36.2895 37.0 37.0 37.0 37.0 37.0 3 36.2935 37.0 37.0 37.0 37.0 37.0 4 36.387 37.0 37.0 37.0 37.0 37.0 5 36.4655 37.0 37.0 37.0 37.0 37.0 6 36.375 37.0 37.0 37.0 37.0 37.0 7 36.311 37.0 37.0 37.0 37.0 37.0 8 36.45 37.0 37.0 37.0 37.0 37.0 9 36.346 37.0 37.0 37.0 37.0 37.0 10-14 36.5086 37.0 37.0 37.0 37.0 37.0 15-19 36.4544 37.0 37.0 37.0 37.0 37.0 20-24 36.4267 37.0 37.0 37.0 37.0 37.0 25-29 36.399800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3672 37.0 37.0 37.0 37.0 37.0 35-39 36.327099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.261700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2814 37.0 37.0 37.0 37.0 37.0 50-54 36.265499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.167500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2101 37.0 37.0 37.0 37.0 37.0 65-69 36.1385 37.0 37.0 37.0 37.0 37.0 70-74 36.055899999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.0909 37.0 37.0 37.0 37.0 37.0 80-84 36.0637 37.0 37.0 37.0 37.0 37.0 85-89 36.016 37.0 37.0 37.0 37.0 37.0 90-94 35.870999999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8786 37.0 37.0 37.0 37.0 37.0 100-104 35.8063 37.0 37.0 37.0 37.0 37.0 105-109 35.803 37.0 37.0 37.0 37.0 37.0 110-114 35.8136 37.0 37.0 37.0 37.0 37.0 115-119 35.6539 37.0 37.0 37.0 37.0 37.0 120-124 35.517700000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.595299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4001 37.0 37.0 37.0 34.6 37.0 135-139 35.3333 37.0 37.0 37.0 34.6 37.0 140-144 35.2961 37.0 37.0 37.0 32.2 37.0 145-149 35.113699999999994 37.0 37.0 37.0 27.4 37.0 150-151 34.557500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 0.0 25 2.0 26 6.0 27 10.0 28 17.0 29 31.0 30 35.0 31 69.0 32 73.0 33 108.0 34 200.0 35 453.0 36 2753.0 37 238.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5060120240481 14.37875751503006 10.92184368737475 34.1933867735471 2 26.275 20.075000000000003 33.225 20.424999999999997 3 20.825 27.825 22.825 28.525 4 25.224999999999998 32.35 19.875 22.55 5 26.1 32.2 21.65 20.05 6 19.7 34.050000000000004 22.675 23.575 7 16.7 19.325 42.175000000000004 21.8 8 21.3 19.275000000000002 26.5 32.925 9 19.525000000000002 20.925 30.349999999999998 29.2 10-14 22.805 26.77 24.585 25.840000000000003 15-19 22.805 25.4 25.165 26.63 20-24 22.825 26.195 24.975 26.005 25-29 23.625 25.8 24.69 25.885 30-34 23.18 25.515 24.765 26.540000000000003 35-39 24.044999999999998 25.319999999999997 25.595000000000002 25.040000000000003 40-44 22.225 25.900000000000002 25.095 26.779999999999998 45-49 22.994999999999997 25.575 25.555 25.874999999999996 50-54 23.3 25.264999999999997 25.080000000000002 26.355 55-59 23.494999999999997 25.41 24.94 26.155 60-64 23.36 25.505 24.905 26.229999999999997 65-69 23.36 25.585 24.805 26.25 70-74 23.385 26.5 24.14 25.974999999999998 75-79 23.48 25.56 24.224999999999998 26.735 80-84 24.145 24.990000000000002 24.57 26.295 85-89 23.68 25.185000000000002 24.740000000000002 26.395000000000003 90-94 24.04 24.605 25.224999999999998 26.13 95-99 23.865 25.47 24.834999999999997 25.83 100-104 24.63 25.259999999999998 24.060000000000002 26.05 105-109 24.93 25.074999999999996 23.78 26.215 110-114 23.474999999999998 25.259999999999998 24.575 26.69 115-119 24.335 25.305 24.169999999999998 26.19 120-124 23.965 25.335 24.29 26.41 125-129 24.93 24.465 24.315 26.290000000000003 130-134 24.145 25.430000000000003 23.865 26.56 135-139 24.69 24.735 24.305 26.27 140-144 23.715 25.05 24.16 27.075 145-149 24.75 24.740000000000002 24.425 26.085 150-151 25.2 23.6875 25.5625 25.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 3.0 28 5.5 29 4.0 30 10.0 31 14.0 32 13.5 33 19.5 34 29.0 35 38.5 36 50.5 37 66.0 38 76.5 39 102.0 40 127.5 41 133.0 42 150.0 43 163.5 44 177.0 45 184.0 46 188.5 47 195.0 48 198.5 49 198.0 50 176.5 51 156.5 52 141.5 53 133.0 54 128.0 55 110.5 56 93.5 57 84.5 58 78.5 59 69.5 60 60.5 61 63.5 62 61.5 63 55.0 64 56.5 65 60.5 66 56.5 67 45.5 68 37.5 69 34.5 70 26.0 71 21.0 72 22.5 73 19.0 74 16.0 75 15.0 76 11.0 77 6.0 78 3.5 79 2.5 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.47120418848168 91.175 2 4.345549738219896 8.3 3 0.18324607329842932 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.2125 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.44999999999999996 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.6375 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.7375 0.0 0.0 0.0 0.0 134-135 0.8375 0.0 0.0 0.0 0.0 136-137 0.9750000000000001 0.0 0.0 0.0 0.0 138-139 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAATG 10 0.006830828 145.0 7 CTATCAG 10 0.006830828 145.0 4 >>END_MODULE SRR7804192 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804192_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.215 37.0 37.0 37.0 37.0 37.0 2 36.076 37.0 37.0 37.0 37.0 37.0 3 36.084 37.0 37.0 37.0 37.0 37.0 4 36.217 37.0 37.0 37.0 37.0 37.0 5 36.254 37.0 37.0 37.0 37.0 37.0 6 36.1055 37.0 37.0 37.0 37.0 37.0 7 36.0875 37.0 37.0 37.0 37.0 37.0 8 36.217 37.0 37.0 37.0 37.0 37.0 9 36.165 37.0 37.0 37.0 37.0 37.0 10-14 36.1539 37.0 37.0 37.0 37.0 37.0 15-19 36.0752 37.0 37.0 37.0 37.0 37.0 20-24 36.0034 37.0 37.0 37.0 37.0 37.0 25-29 35.9784 37.0 37.0 37.0 37.0 37.0 30-34 35.8943 37.0 37.0 37.0 37.0 37.0 35-39 35.834199999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.8302 37.0 37.0 37.0 37.0 37.0 45-49 35.7137 37.0 37.0 37.0 37.0 37.0 50-54 35.7372 37.0 37.0 37.0 37.0 37.0 55-59 35.67959999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.554899999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.5721 37.0 37.0 37.0 37.0 37.0 70-74 35.5498 37.0 37.0 37.0 37.0 37.0 75-79 35.4876 37.0 37.0 37.0 37.0 37.0 80-84 35.4707 37.0 37.0 37.0 37.0 37.0 85-89 35.3097 37.0 37.0 37.0 37.0 37.0 90-94 35.2495 37.0 37.0 37.0 34.6 37.0 95-99 35.1985 37.0 37.0 37.0 29.8 37.0 100-104 35.132 37.0 37.0 37.0 27.4 37.0 105-109 35.1357 37.0 37.0 37.0 27.4 37.0 110-114 34.9134 37.0 37.0 37.0 25.0 37.0 115-119 34.8343 37.0 37.0 37.0 25.0 37.0 120-124 34.8414 37.0 37.0 37.0 25.0 37.0 125-129 34.715599999999995 37.0 37.0 37.0 25.0 37.0 130-134 34.76899999999999 37.0 37.0 37.0 25.0 37.0 135-139 34.4775 37.0 37.0 37.0 25.0 37.0 140-144 34.3278 37.0 37.0 37.0 25.0 37.0 145-149 34.259299999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.65075 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 5.0 15 3.0 16 2.0 17 1.0 18 3.0 19 2.0 20 1.0 21 4.0 22 10.0 23 11.0 24 10.0 25 13.0 26 12.0 27 14.0 28 21.0 29 40.0 30 38.0 31 74.0 32 89.0 33 151.0 34 346.0 35 792.0 36 2272.0 37 81.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.525 13.05 13.350000000000001 34.075 2 30.049999999999997 17.925 29.15 22.875 3 23.95 22.3 27.875 25.874999999999996 4 28.199999999999996 30.425 16.6 24.775 5 29.975 31.075000000000003 17.05 21.9 6 21.05 33.575 19.725 25.650000000000002 7 19.875 15.875 38.125 26.125 8 22.525000000000002 19.075 22.225 36.175000000000004 9 23.825 20.4 24.325 31.45 10-14 25.53 24.474999999999998 22.985 27.01 15-19 26.46 23.57 23.080000000000002 26.889999999999997 20-24 26.005 24.19 23.59 26.215 25-29 26.090000000000003 24.18 22.99 26.740000000000002 30-34 26.06 24.935 23.195 25.81 35-39 26.474999999999998 24.67 23.255 25.6 40-44 26.715 23.95 23.32 26.015 45-49 26.450000000000003 23.685000000000002 23.849999999999998 26.015 50-54 26.72 24.125 23.485 25.669999999999998 55-59 27.195000000000004 23.674999999999997 23.02 26.11 60-64 26.47 24.93 23.369999999999997 25.230000000000004 65-69 27.24 24.4 23.62 24.740000000000002 70-74 26.974999999999998 23.775 23.745 25.505 75-79 26.43 24.21 23.51 25.85 80-84 26.97 24.755 23.14 25.135 85-89 26.369999999999997 24.355 23.585 25.69 90-94 27.029999999999998 24.46 23.28 25.230000000000004 95-99 27.284999999999997 24.42 23.165 25.130000000000003 100-104 26.740000000000002 24.26 23.665 25.335 105-109 26.974999999999998 24.240000000000002 23.669999999999998 25.115 110-114 27.08 25.040000000000003 22.795 25.085 115-119 26.865 24.34 23.79 25.005 120-124 26.490000000000002 24.955 23.35 25.205 125-129 26.5 24.735 23.72 25.045 130-134 27.145000000000003 24.965 23.445 24.445 135-139 26.790000000000003 24.79 23.41 25.009999999999998 140-144 27.150000000000002 24.785 23.655 24.41 145-149 26.945000000000004 24.26 23.794999999999998 25.0 150-151 26.5375 24.95 23.45 25.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.5 28 1.5 29 2.5 30 4.0 31 6.5 32 10.0 33 8.0 34 12.5 35 19.5 36 25.5 37 40.0 38 52.0 39 67.0 40 81.5 41 99.0 42 122.0 43 141.0 44 159.5 45 160.5 46 163.0 47 175.0 48 174.0 49 172.5 50 164.5 51 155.0 52 139.5 53 132.5 54 127.5 55 106.0 56 104.0 57 98.5 58 92.0 59 92.0 60 89.5 61 86.0 62 83.0 63 74.5 64 68.5 65 79.5 66 87.0 67 80.0 68 76.0 69 67.5 70 46.5 71 37.5 72 41.0 73 39.5 74 33.0 75 29.0 76 21.0 77 13.0 78 6.0 79 4.5 80 3.5 81 2.0 82 1.5 83 0.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 95.34944823962165 90.725 2 4.387808723068839 8.35 3 0.18392012611665792 0.525 4 0.0 0.0 5 0.05254860746190226 0.25 6 0.02627430373095113 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGAAACCCAGAAACCAGATCCCCAAATCTCAAAACCCTAGCGCCGGCGA 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.0625 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.275 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.675 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.7875000000000001 0.0 0.0 0.0 0.0 134-135 0.8625 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138-139 1.1749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCATC 10 0.006830828 145.0 7 >>END_MODULE Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354580 spots for SRR7804192.sra Written 1354580 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra Read 1354570 spots for SRR7804192.sra Written 1354570 spots for SRR7804192.sra SRR ids: ['SRR7804192.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ns79y2w8 SRR7804192.sra spots: 27091410 blocks: [[1, 1354570], [1354571, 2709140], [2709141, 4063710], [4063711, 5418280], [5418281, 6772850], [6772851, 8127420], [8127421, 9481990], [9481991, 10836560], [10836561, 12191130], [12191131, 13545700], [13545701, 14900270], [14900271, 16254840], [16254841, 17609410], [17609411, 18963980], [18963981, 20318550], [20318551, 21673120], [21673121, 23027690], [23027691, 24382260], [24382261, 25736830], [25736831, 27091410]] SRR7804192 file size 9158689 SRR7804192 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804192 SRR7804192_1.fastq SRR7804192_2.fastq Input file: SRR7804192_1.fastq Paired file: SRR7804192_2.fastq trimmed: SRR7804192-trimmed-pair1.fastq, SRR7804192-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:45:57 2024 >> started Tue Dec 10 03:46:31 2024 >> done (33.500s) 27091410 read pairs processed; of these: 89 ( 0.00%) short read pairs filtered out after trimming by size control 696 ( 0.00%) empty read pairs filtered out after trimming by size control 27090625 (100.00%) read pairs available; of these: 499932 ( 1.85%) trimmed read pairs available after processing 26590693 (98.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 13 0.00% 21 12 0.00% 22 24 0.00% 23 15 0.00% 24 25 0.00% 25 17 0.00% 26 21 0.00% 27 32 0.00% 28 31 0.00% 29 26 0.00% 30 41 0.00% 31 30 0.00% 32 42 0.00% 33 32 0.00% 34 28 0.00% 35 44 0.00% 36 41 0.00% 37 52 0.00% 38 46 0.00% 39 46 0.00% 40 43 0.00% 41 54 0.00% 42 57 0.00% 43 42 0.00% 44 47 0.00% 45 57 0.00% 46 72 0.00% 47 47 0.00% 48 52 0.00% 49 67 0.00% 50 80 0.00% 51 52 0.00% 52 46 0.00% 53 90 0.00% 54 58 0.00% 55 70 0.00% 56 110 0.00% 57 73 0.00% 58 99 0.00% 59 71 0.00% 60 87 0.00% 61 106 0.00% 62 100 0.00% 63 104 0.00% 64 103 0.00% 65 95 0.00% 66 122 0.00% 67 105 0.00% 68 122 0.00% 69 139 0.00% 70 147 0.00% 71 174 0.00% 72 173 0.00% 73 171 0.00% 74 169 0.00% 75 164 0.00% 76 211 0.00% 77 193 0.00% 78 266 0.00% 79 273 0.00% 80 305 0.00% 81 333 0.00% 82 381 0.00% 83 382 0.00% 84 431 0.00% 85 510 0.00% 86 524 0.00% 87 562 0.00% 88 747 0.00% 89 681 0.00% 90 708 0.00% 91 835 0.00% 92 930 0.00% 93 1029 0.00% 94 1139 0.00% 95 1264 0.00% 96 1373 0.01% 97 1402 0.01% 98 1529 0.01% 99 1690 0.01% 100 1881 0.01% 101 1865 0.01% 102 2213 0.01% 103 2397 0.01% 104 2499 0.01% 105 2832 0.01% 106 2858 0.01% 107 2969 0.01% 108 3170 0.01% 109 3538 0.01% 110 3680 0.01% 111 3914 0.01% 112 4202 0.02% 113 4350 0.02% 114 4717 0.02% 115 5037 0.02% 116 5250 0.02% 117 5536 0.02% 118 5776 0.02% 119 5971 0.02% 120 6170 0.02% 121 6903 0.03% 122 7147 0.03% 123 7344 0.03% 124 7941 0.03% 125 8212 0.03% 126 8715 0.03% 127 8994 0.03% 128 9286 0.03% 129 9665 0.04% 130 10050 0.04% 131 10393 0.04% 132 10880 0.04% 133 11619 0.04% 134 12210 0.05% 135 12558 0.05% 136 13298 0.05% 137 13487 0.05% 138 13942 0.05% 139 14558 0.05% 140 14824 0.05% 141 15549 0.06% 142 16127 0.06% 143 16745 0.06% 144 17878 0.07% 145 18365 0.07% 146 19034 0.07% 147 19522 0.07% 148 20139 0.07% 149 20497 0.08% 150 21522 0.08% 151 26590693 98.15% 27090625 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=12.91 fanout-score-rank=16 prefix-density=0.32 prefix-fanout=6.7 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCGGCAAACTTCACGGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTGAGATCCTTCACAGCAACGTTCTTGACGTTGAAGCCAACATTGTCACCAGGAAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=385.86 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=29.7 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=36 prefix-density=0.51 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=785.10 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=20.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804192 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:47:24 Started mapping on | Dec 10 03:47:24 Finished on | Dec 10 03:51:17 Mapping speed, Million of reads per hour | 418.57 Number of input reads | 27090625 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 25471477 Uniquely mapped reads % | 94.02% Average mapped length | 300.13 Number of splices: Total | 27616719 Number of splices: Annotated (sjdb) | 26033586 Number of splices: GT/AG | 27246097 Number of splices: GC/AG | 315382 Number of splices: AT/AC | 20441 Number of splices: Non-canonical | 34799 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.72 Insertion rate per base | 0.01% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379578 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 21264 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1239570 1239570 1239570 N_multimapping 379578 379578 379578 N_noFeature 571981 24811941 807051 N_ambiguous 502801 4102 80245 UnstrandedReadsAssigned:24396695 PositiveStrandReadsAssigned:655434 NegativeStrandReadsAssigned:24584181 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804192 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804192-trimmed-pair1.fastq SRR7804192-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,090,625 reads, 24,920,705 reads pseudoaligned [quant] estimated average fragment length: 347.679 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52973 SRR7804192.ke.tsv 35125 SRR7804192.se.tsv 88098 total ==> SRR7804192.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 590.757 0 0 PNS24247 1044 697.321 73.5974 5.48211 PNS24249 1928 1581.32 233.678 7.67568 PNS24246 1044 697.321 73.5974 5.48211 PNS24248 1044 697.321 73.5974 5.48211 PNS24244 1471 1124.32 105.53 4.87531 PNS24243 293 68.3436 1 0.760011 KQK14069 1603 1256.32 7537.7 311.642 KQK14071 474 181.631 50.1553 14.3432 ==> SRR7804192.se.tsv <== BRADI_1g14170v3 7910 BRADI_1g53295v3 189 BRADI_1g59795v3 455 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 2833 BRADI_1g74790v3 44 BRADI_1g09890v3 0 BRADI_1g77505v3 218 BRADI_1g48960v3 0 SRR7804192 completed mapping pipeline successfully