Starting /dee2/code/volunteer_pipeline.sh SRR7804193 current disk space = 1526179377152 free memory = 1602329184 SRR7804193 SRAfilesize 87f674ca38d6c892be77bf76348ede73 SRR7804193.sra SRR7804193.sra file validated SRR7804193 is paired end SRR7804193 is conventional basespace SRR7804193 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804193_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.108 37.0 37.0 37.0 37.0 37.0 2 36.267 37.0 37.0 37.0 37.0 37.0 3 36.4165 37.0 37.0 37.0 37.0 37.0 4 36.498 37.0 37.0 37.0 37.0 37.0 5 36.5735 37.0 37.0 37.0 37.0 37.0 6 36.518 37.0 37.0 37.0 37.0 37.0 7 36.4335 37.0 37.0 37.0 37.0 37.0 8 36.5045 37.0 37.0 37.0 37.0 37.0 9 36.5165 37.0 37.0 37.0 37.0 37.0 10-14 36.5523 37.0 37.0 37.0 37.0 37.0 15-19 36.5539 37.0 37.0 37.0 37.0 37.0 20-24 36.51520000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4825 37.0 37.0 37.0 37.0 37.0 30-34 36.4271 37.0 37.0 37.0 37.0 37.0 35-39 36.402300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3638 37.0 37.0 37.0 37.0 37.0 45-49 36.281 37.0 37.0 37.0 37.0 37.0 50-54 36.2778 37.0 37.0 37.0 37.0 37.0 55-59 36.2059 37.0 37.0 37.0 37.0 37.0 60-64 36.208 37.0 37.0 37.0 37.0 37.0 65-69 36.181599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0722 37.0 37.0 37.0 37.0 37.0 75-79 36.098800000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0745 37.0 37.0 37.0 37.0 37.0 85-89 36.0219 37.0 37.0 37.0 37.0 37.0 90-94 36.0237 37.0 37.0 37.0 37.0 37.0 95-99 35.8778 37.0 37.0 37.0 37.0 37.0 100-104 35.8824 37.0 37.0 37.0 37.0 37.0 105-109 35.869600000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.856199999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.7812 37.0 37.0 37.0 37.0 37.0 120-124 35.6571 37.0 37.0 37.0 37.0 37.0 125-129 35.6396 37.0 37.0 37.0 37.0 37.0 130-134 35.4882 37.0 37.0 37.0 37.0 37.0 135-139 35.4159 37.0 37.0 37.0 37.0 37.0 140-144 35.4481 37.0 37.0 37.0 34.6 37.0 145-149 35.224199999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.59725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 5.0 26 8.0 27 11.0 28 17.0 29 25.0 30 30.0 31 52.0 32 57.0 33 86.0 34 187.0 35 473.0 36 2800.0 37 246.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.036108324974926 12.988966900702106 9.90471414242728 40.070210631895684 2 25.35 19.950000000000003 34.375 20.325 3 22.325 27.175 22.825 27.675 4 25.4 32.15 19.225 23.225 5 25.624999999999996 33.324999999999996 20.95 20.1 6 20.65 32.525 22.55 24.275 7 15.7 21.349999999999998 40.300000000000004 22.650000000000002 8 21.25 20.575 26.5 31.674999999999997 9 20.175 20.549999999999997 29.375 29.9 10-14 23.474999999999998 26.345000000000002 24.335 25.845000000000002 15-19 23.485 25.69 24.81 26.015 20-24 23.78 25.540000000000003 25.05 25.629999999999995 25-29 23.175 25.61 24.735 26.479999999999997 30-34 22.939999999999998 25.89 25.040000000000003 26.13 35-39 23.825 25.240000000000002 24.740000000000002 26.195 40-44 23.21 25.585 24.725 26.479999999999997 45-49 23.355 25.77 25.135 25.740000000000002 50-54 23.915 25.080000000000002 24.765 26.240000000000002 55-59 23.97 24.92 24.545 26.565 60-64 23.615 25.165 24.895 26.325 65-69 23.575 24.745 25.085 26.595000000000002 70-74 24.51 25.755 23.990000000000002 25.745 75-79 23.580000000000002 25.259999999999998 24.915000000000003 26.245 80-84 24.240000000000002 25.495 24.755 25.509999999999998 85-89 24.09 25.1 24.48 26.33 90-94 23.525 25.314999999999998 24.240000000000002 26.919999999999998 95-99 23.94 25.869999999999997 24.02 26.169999999999998 100-104 23.974999999999998 25.230000000000004 24.349999999999998 26.445 105-109 24.325 25.27 24.555 25.85 110-114 24.44 24.795 24.69 26.075 115-119 24.4 24.104999999999997 24.445 27.05 120-124 24.385 24.58 24.59 26.445 125-129 24.47 24.12 24.47 26.939999999999998 130-134 24.884999999999998 24.265 23.65 27.200000000000003 135-139 25.345000000000002 24.415 23.895 26.345000000000002 140-144 24.485 24.77 24.525 26.22 145-149 24.895 24.665 24.060000000000002 26.38 150-151 25.2625 23.8875 23.799999999999997 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 1.0 28 1.5 29 2.0 30 4.5 31 9.5 32 13.5 33 17.5 34 24.5 35 37.0 36 60.5 37 74.0 38 73.5 39 89.5 40 113.0 41 144.5 42 158.0 43 156.5 44 174.0 45 192.5 46 189.5 47 187.0 48 191.0 49 186.5 50 169.5 51 138.0 52 135.5 53 140.5 54 129.5 55 117.0 56 110.0 57 103.5 58 82.5 59 66.0 60 67.0 61 69.5 62 60.5 63 55.5 64 52.5 65 47.0 66 50.0 67 47.5 68 43.5 69 37.0 70 29.0 71 28.5 72 21.0 73 18.5 74 21.5 75 14.5 76 11.0 77 12.0 78 8.0 79 3.0 80 1.5 81 1.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 95.0039442545359 90.325 2 4.811990533789114 9.15 3 0.18406521167499343 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.07500000000000001 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375000000000001 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.9874999999999999 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804193 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804193_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4085 37.0 37.0 37.0 37.0 37.0 2 36.144 37.0 37.0 37.0 37.0 37.0 3 36.202 37.0 37.0 37.0 37.0 37.0 4 36.204 37.0 37.0 37.0 37.0 37.0 5 36.3285 37.0 37.0 37.0 37.0 37.0 6 36.131 37.0 37.0 37.0 37.0 37.0 7 36.2025 37.0 37.0 37.0 37.0 37.0 8 36.291 37.0 37.0 37.0 37.0 37.0 9 36.3375 37.0 37.0 37.0 37.0 37.0 10-14 36.269400000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.206 37.0 37.0 37.0 37.0 37.0 20-24 36.167500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.101800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0971 37.0 37.0 37.0 37.0 37.0 35-39 36.0108 37.0 37.0 37.0 37.0 37.0 40-44 36.0033 37.0 37.0 37.0 37.0 37.0 45-49 35.9651 37.0 37.0 37.0 37.0 37.0 50-54 35.9209 37.0 37.0 37.0 37.0 37.0 55-59 35.9119 37.0 37.0 37.0 37.0 37.0 60-64 35.7544 37.0 37.0 37.0 37.0 37.0 65-69 35.7299 37.0 37.0 37.0 37.0 37.0 70-74 35.7086 37.0 37.0 37.0 37.0 37.0 75-79 35.680400000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.568 37.0 37.0 37.0 37.0 37.0 85-89 35.477999999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.4346 37.0 37.0 37.0 37.0 37.0 95-99 35.332 37.0 37.0 37.0 34.6 37.0 100-104 35.3303 37.0 37.0 37.0 34.6 37.0 105-109 35.3183 37.0 37.0 37.0 37.0 37.0 110-114 35.102999999999994 37.0 37.0 37.0 25.0 37.0 115-119 35.079899999999995 37.0 37.0 37.0 25.0 37.0 120-124 35.016299999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.907500000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.8761 37.0 37.0 37.0 25.0 37.0 135-139 34.7043 37.0 37.0 37.0 25.0 37.0 140-144 34.57900000000001 37.0 37.0 37.0 25.0 37.0 145-149 34.4451 37.0 37.0 37.0 25.0 37.0 150-151 33.847 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 6.0 15 0.0 16 2.0 17 2.0 18 2.0 19 1.0 20 1.0 21 3.0 22 12.0 23 4.0 24 2.0 25 12.0 26 11.0 27 19.0 28 17.0 29 20.0 30 30.0 31 61.0 32 88.0 33 164.0 34 285.0 35 834.0 36 2346.0 37 77.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.825 11.774999999999999 14.649999999999999 36.75 2 30.099999999999998 18.625 29.725 21.55 3 23.925 22.55 28.575 24.95 4 27.925 29.225 16.575 26.275 5 27.150000000000002 32.9 17.974999999999998 21.975 6 21.725 32.625 21.3 24.349999999999998 7 19.975 15.425 36.675000000000004 27.925 8 23.325000000000003 20.325 21.875 34.475 9 25.224999999999998 20.674999999999997 24.474999999999998 29.625 10-14 25.415 24.505 23.02 27.060000000000002 15-19 25.995 23.72 23.665 26.619999999999997 20-24 25.365 23.985 23.74 26.91 25-29 26.205000000000002 23.635 23.525 26.634999999999998 30-34 25.52 24.005000000000003 23.990000000000002 26.484999999999996 35-39 26.27 23.84 23.505000000000003 26.384999999999998 40-44 26.174999999999997 24.165 23.505000000000003 26.155 45-49 26.745 24.26 23.205000000000002 25.790000000000003 50-54 26.36 24.25 23.59 25.8 55-59 26.405 24.759999999999998 22.75 26.085 60-64 26.695 23.865 23.974999999999998 25.465 65-69 26.86 24.435000000000002 23.355 25.35 70-74 26.56 23.95 24.0 25.490000000000002 75-79 26.87 24.310000000000002 23.3 25.52 80-84 27.1 24.365000000000002 23.380000000000003 25.155 85-89 27.67 24.195 23.064999999999998 25.069999999999997 90-94 26.665 23.96 23.535 25.840000000000003 95-99 27.345000000000002 24.295 23.16 25.2 100-104 27.38 24.145 23.155 25.319999999999997 105-109 26.729999999999997 24.165 23.315 25.790000000000003 110-114 26.895000000000003 24.62 23.27 25.215 115-119 26.525 24.615000000000002 24.060000000000002 24.8 120-124 26.955000000000002 24.455 23.455000000000002 25.135 125-129 27.455000000000002 24.81 23.365 24.37 130-134 27.250000000000004 24.415 23.794999999999998 24.54 135-139 27.595 23.990000000000002 23.474999999999998 24.94 140-144 27.68 24.474999999999998 22.96 24.884999999999998 145-149 27.21 24.465 23.685000000000002 24.64 150-151 27.462500000000002 23.7625 24.0125 24.762500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 1.5 25 0.5 26 1.0 27 2.5 28 3.0 29 1.5 30 3.5 31 8.5 32 11.5 33 14.0 34 17.5 35 22.0 36 28.5 37 42.0 38 58.5 39 69.0 40 86.0 41 102.5 42 118.5 43 138.0 44 141.0 45 153.0 46 170.0 47 174.0 48 159.0 49 137.5 50 152.0 51 167.0 52 164.0 53 143.5 54 118.5 55 108.5 56 96.5 57 91.0 58 92.5 59 99.5 60 89.5 61 78.0 62 88.5 63 83.0 64 76.5 65 79.5 66 81.0 67 79.0 68 78.0 69 68.5 70 51.5 71 53.0 72 54.0 73 42.0 74 26.0 75 17.5 76 18.0 77 10.5 78 6.0 79 7.5 80 3.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.99077247561297 90.075 2 4.640126548905879 8.799999999999999 3 0.3163722646981281 0.8999999999999999 4 0.02636435539151068 0.1 5 0.02636435539151068 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.1124999999999998 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138-139 1.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGACCC 10 0.006830828 145.0 1 >>END_MODULE Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032430 spots for SRR7804193.sra Written 2032430 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra Read 2032414 spots for SRR7804193.sra Written 2032414 spots for SRR7804193.sra SRR ids: ['SRR7804193.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y_gya4nu SRR7804193.sra spots: 40648296 blocks: [[1, 2032414], [2032415, 4064828], [4064829, 6097242], [6097243, 8129656], [8129657, 10162070], [10162071, 12194484], [12194485, 14226898], [14226899, 16259312], [16259313, 18291726], [18291727, 20324140], [20324141, 22356554], [22356555, 24388968], [24388969, 26421382], [26421383, 28453796], [28453797, 30486210], [30486211, 32518624], [32518625, 34551038], [34551039, 36583452], [36583453, 38615866], [38615867, 40648296]] SRR7804193 file size 13752673 SRR7804193 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804193 SRR7804193_1.fastq SRR7804193_2.fastq Input file: SRR7804193_1.fastq Paired file: SRR7804193_2.fastq trimmed: SRR7804193-trimmed-pair1.fastq, SRR7804193-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:48:06 2024 >> started Tue Dec 10 03:49:09 2024 >> done (63.250s) 40648296 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 1511 ( 0.00%) empty read pairs filtered out after trimming by size control 40646707 (100.00%) read pairs available; of these: 865730 ( 2.13%) trimmed read pairs available after processing 39780977 (97.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 19 0.00% 20 13 0.00% 21 27 0.00% 22 22 0.00% 23 33 0.00% 24 40 0.00% 25 47 0.00% 26 38 0.00% 27 34 0.00% 28 53 0.00% 29 42 0.00% 30 55 0.00% 31 62 0.00% 32 65 0.00% 33 65 0.00% 34 76 0.00% 35 61 0.00% 36 58 0.00% 37 64 0.00% 38 70 0.00% 39 95 0.00% 40 75 0.00% 41 57 0.00% 42 90 0.00% 43 81 0.00% 44 89 0.00% 45 97 0.00% 46 79 0.00% 47 85 0.00% 48 98 0.00% 49 85 0.00% 50 91 0.00% 51 105 0.00% 52 84 0.00% 53 136 0.00% 54 149 0.00% 55 137 0.00% 56 126 0.00% 57 128 0.00% 58 108 0.00% 59 150 0.00% 60 136 0.00% 61 158 0.00% 62 132 0.00% 63 147 0.00% 64 158 0.00% 65 162 0.00% 66 179 0.00% 67 174 0.00% 68 183 0.00% 69 188 0.00% 70 201 0.00% 71 248 0.00% 72 269 0.00% 73 296 0.00% 74 312 0.00% 75 298 0.00% 76 331 0.00% 77 361 0.00% 78 381 0.00% 79 460 0.00% 80 465 0.00% 81 512 0.00% 82 597 0.00% 83 661 0.00% 84 713 0.00% 85 797 0.00% 86 866 0.00% 87 879 0.00% 88 1011 0.00% 89 1131 0.00% 90 1177 0.00% 91 1395 0.00% 92 1616 0.00% 93 1755 0.00% 94 1980 0.00% 95 2139 0.01% 96 2227 0.01% 97 2402 0.01% 98 2529 0.01% 99 2783 0.01% 100 2893 0.01% 101 3259 0.01% 102 3520 0.01% 103 3899 0.01% 104 4299 0.01% 105 4611 0.01% 106 4836 0.01% 107 4970 0.01% 108 5185 0.01% 109 5768 0.01% 110 6001 0.01% 111 6511 0.02% 112 7020 0.02% 113 7520 0.02% 114 8210 0.02% 115 8576 0.02% 116 8842 0.02% 117 9233 0.02% 118 9571 0.02% 119 10072 0.02% 120 10807 0.03% 121 11292 0.03% 122 12111 0.03% 123 12771 0.03% 124 13495 0.03% 125 14598 0.04% 126 15133 0.04% 127 15503 0.04% 128 16160 0.04% 129 16754 0.04% 130 17121 0.04% 131 17619 0.04% 132 19250 0.05% 133 19717 0.05% 134 20812 0.05% 135 22466 0.06% 136 23539 0.06% 137 24138 0.06% 138 24436 0.06% 139 25160 0.06% 140 25815 0.06% 141 26738 0.07% 142 28215 0.07% 143 29361 0.07% 144 30976 0.08% 145 32686 0.08% 146 33923 0.08% 147 35118 0.09% 148 35863 0.09% 149 36351 0.09% 150 37498 0.09% 151 39780977 97.87% 40646707 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=15.13 fanout-score-rank=9 prefix-density=0.31 prefix-fanout=7.2 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=367.73 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=31.1 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=33 prefix-density=0.65 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=689.85 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=20.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804193 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:49:58 Started mapping on | Dec 10 03:49:58 Finished on | Dec 10 03:55:50 Mapping speed, Million of reads per hour | 415.70 Number of input reads | 40646707 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 38322907 Uniquely mapped reads % | 94.28% Average mapped length | 300.14 Number of splices: Total | 41063830 Number of splices: Annotated (sjdb) | 38566547 Number of splices: GT/AG | 40500908 Number of splices: GC/AG | 480957 Number of splices: AT/AC | 30161 Number of splices: Non-canonical | 51804 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.75 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 536565 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 35625 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1787235 1787235 1787235 N_multimapping 536565 536565 536565 N_noFeature 919884 37323265 1267299 N_ambiguous 774380 6078 125145 UnstrandedReadsAssigned:36628643 PositiveStrandReadsAssigned:993564 NegativeStrandReadsAssigned:36930463 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804193 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804193-trimmed-pair1.fastq SRR7804193-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,646,707 reads, 37,391,091 reads pseudoaligned [quant] estimated average fragment length: 335.559 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52973 SRR7804193.ke.tsv 35125 SRR7804193.se.tsv 88098 total ==> SRR7804193.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 602.886 0 0 PNS24247 1044 709.441 96.4383 4.68893 PNS24249 1928 1593.44 351.72 7.61379 PNS24246 1044 709.441 96.4383 4.68893 PNS24248 1044 709.441 96.4383 4.68893 PNS24244 1471 1136.44 198.965 6.03907 PNS24243 293 69.4099 0 0 KQK14069 1603 1268.44 17882.9 486.303 KQK14071 474 187.561 144.408 26.5575 ==> SRR7804193.se.tsv <== BRADI_1g14170v3 18927 BRADI_1g53295v3 312 BRADI_1g59795v3 757 BRADI_1g07683v3 0 BRADI_1g00485v3 146 BRADI_1g20270v3 3388 BRADI_1g74790v3 110 BRADI_1g09890v3 0 BRADI_1g77505v3 354 BRADI_1g48960v3 1 SRR7804193 completed mapping pipeline successfully