Starting /dee2/code/volunteer_pipeline.sh SRR7804194 current disk space = 1526190182400 free memory = 1556905296 SRR7804194 SRAfilesize 10a035de366290a2a0fd207bc6b05b5e SRR7804194.sra SRR7804194.sra file validated SRR7804194 is paired end SRR7804194 is conventional basespace SRR7804194 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804194_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.20475 37.0 37.0 37.0 37.0 37.0 2 36.2255 37.0 37.0 37.0 37.0 37.0 3 36.319 37.0 37.0 37.0 37.0 37.0 4 36.4655 37.0 37.0 37.0 37.0 37.0 5 36.475 37.0 37.0 37.0 37.0 37.0 6 36.4575 37.0 37.0 37.0 37.0 37.0 7 36.2565 37.0 37.0 37.0 37.0 37.0 8 36.518 37.0 37.0 37.0 37.0 37.0 9 36.4495 37.0 37.0 37.0 37.0 37.0 10-14 36.48049999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.469800000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4639 37.0 37.0 37.0 37.0 37.0 25-29 36.41609999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3863 37.0 37.0 37.0 37.0 37.0 35-39 36.3729 37.0 37.0 37.0 37.0 37.0 40-44 36.313599999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.2397 37.0 37.0 37.0 37.0 37.0 50-54 36.208299999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.236399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.2072 37.0 37.0 37.0 37.0 37.0 65-69 36.2006 37.0 37.0 37.0 37.0 37.0 70-74 36.1157 37.0 37.0 37.0 37.0 37.0 75-79 36.0004 37.0 37.0 37.0 37.0 37.0 80-84 36.1211 37.0 37.0 37.0 37.0 37.0 85-89 36.0208 37.0 37.0 37.0 37.0 37.0 90-94 35.92450000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8173 37.0 37.0 37.0 37.0 37.0 100-104 35.832 37.0 37.0 37.0 37.0 37.0 105-109 35.8069 37.0 37.0 37.0 37.0 37.0 110-114 35.7909 37.0 37.0 37.0 37.0 37.0 115-119 35.5715 37.0 37.0 37.0 37.0 37.0 120-124 35.561899999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.596700000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.4651 37.0 37.0 37.0 37.0 37.0 135-139 35.2786 37.0 37.0 37.0 34.6 37.0 140-144 35.3356 37.0 37.0 37.0 34.6 37.0 145-149 35.1797 37.0 37.0 37.0 29.8 37.0 150-151 34.418000000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 7.0 26 9.0 27 12.0 28 18.0 29 30.0 30 41.0 31 47.0 32 71.0 33 98.0 34 197.0 35 463.0 36 2770.0 37 234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.32165206508135 11.76470588235294 11.614518147684606 39.2991239048811 2 24.6 17.625 35.15 22.625 3 24.25 23.275000000000002 23.599999999999998 28.875 4 25.974999999999998 30.0 19.45 24.575 5 26.025 33.050000000000004 21.625 19.3 6 20.875 33.175 22.5 23.45 7 17.95 19.625 41.625 20.8 8 19.35 21.25 26.974999999999998 32.425 9 20.4 19.725 31.0 28.875 10-14 23.305 26.540000000000003 24.44 25.715 15-19 23.345 25.919999999999998 24.88 25.855 20-24 23.05 25.35 24.875 26.724999999999998 25-29 23.745 25.264999999999997 25.2 25.790000000000003 30-34 22.985 25.245 25.03 26.740000000000002 35-39 23.72 24.759999999999998 24.775 26.745 40-44 23.915 24.975 24.825 26.284999999999997 45-49 23.89 25.595000000000002 25.055 25.46 50-54 23.765 25.405 24.66 26.169999999999998 55-59 24.02 25.759999999999998 23.665 26.555 60-64 24.315 25.555 24.044999999999998 26.085 65-69 23.94 25.064999999999998 24.855 26.14 70-74 23.794999999999998 25.240000000000002 24.685000000000002 26.279999999999998 75-79 24.04 24.695 24.709999999999997 26.555 80-84 24.19 24.905 24.79 26.115 85-89 23.595 25.169999999999998 23.990000000000002 27.245 90-94 23.885 25.0 24.435000000000002 26.68 95-99 24.0 25.180000000000003 24.615000000000002 26.205000000000002 100-104 24.135 25.330000000000002 24.215 26.32 105-109 24.62 24.485 24.349999999999998 26.545 110-114 24.58 24.545 24.695 26.179999999999996 115-119 24.685000000000002 24.485 24.7 26.13 120-124 24.495 24.87 24.310000000000002 26.325 125-129 24.915000000000003 24.865000000000002 23.855 26.365 130-134 24.73 24.8 23.915 26.555 135-139 24.79 24.875 24.605 25.729999999999997 140-144 25.22 24.529999999999998 24.104999999999997 26.145000000000003 145-149 25.005 24.375 24.115000000000002 26.505000000000003 150-151 24.775 24.775 24.2625 26.187500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 0.5 27 0.5 28 3.0 29 3.5 30 4.0 31 8.5 32 17.0 33 24.0 34 34.0 35 41.5 36 55.0 37 67.0 38 74.0 39 100.0 40 118.0 41 132.0 42 155.0 43 165.5 44 172.5 45 186.0 46 191.0 47 181.0 48 175.0 49 163.5 50 150.5 51 155.5 52 147.0 53 133.0 54 128.0 55 115.0 56 91.5 57 78.0 58 79.0 59 70.5 60 64.0 61 65.0 62 63.0 63 60.0 64 64.5 65 65.5 66 57.0 67 54.0 68 50.5 69 42.5 70 35.5 71 27.0 72 22.5 73 22.5 74 17.5 75 17.0 76 15.0 77 9.5 78 7.0 79 4.5 80 3.0 81 3.0 82 2.5 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30553370049829 90.85 2 4.484657749803304 8.55 3 0.2098085496984002 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0125 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.05 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.05 0.0 0.0 0.0 0.025 96-97 0.075 0.0 0.0 0.0 0.025 98-99 0.075 0.0 0.0 0.0 0.025 100-101 0.075 0.0 0.0 0.0 0.025 102-103 0.075 0.0 0.0 0.0 0.025 104-105 0.0875 0.0 0.0 0.0 0.025 106-107 0.125 0.0 0.0 0.0 0.025 108-109 0.16249999999999998 0.0 0.0 0.0 0.025 110-111 0.1875 0.0 0.0 0.0 0.025 112-113 0.21250000000000002 0.0 0.0 0.0 0.025 114-115 0.225 0.0 0.0 0.0 0.025 116-117 0.2375 0.0 0.0 0.0 0.025 118-119 0.25 0.0 0.0 0.0 0.025 120-121 0.2625 0.0 0.0 0.0 0.025 122-123 0.325 0.0 0.0 0.0 0.025 124-125 0.375 0.0 0.0 0.0 0.025 126-127 0.4375 0.0 0.0 0.0 0.025 128-129 0.55 0.0 0.0 0.0 0.025 130-131 0.6125 0.0 0.0 0.0 0.025 132-133 0.675 0.0 0.0 0.0 0.025 134-135 0.7625 0.0 0.0 0.0 0.025 136-137 0.8374999999999999 0.0 0.0 0.0 0.025 138-139 1.0125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804194 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804194_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1085 37.0 37.0 37.0 37.0 37.0 2 35.842 37.0 37.0 37.0 37.0 37.0 3 35.8375 37.0 37.0 37.0 37.0 37.0 4 36.032 37.0 37.0 37.0 37.0 37.0 5 36.037 37.0 37.0 37.0 37.0 37.0 6 35.9565 37.0 37.0 37.0 37.0 37.0 7 36.019 37.0 37.0 37.0 37.0 37.0 8 36.0505 37.0 37.0 37.0 37.0 37.0 9 36.0935 37.0 37.0 37.0 37.0 37.0 10-14 36.043099999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.9813 37.0 37.0 37.0 37.0 37.0 20-24 35.9072 37.0 37.0 37.0 37.0 37.0 25-29 35.897800000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.8827 37.0 37.0 37.0 37.0 37.0 35-39 35.6806 37.0 37.0 37.0 37.0 37.0 40-44 35.698800000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.651300000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.6097 37.0 37.0 37.0 37.0 37.0 55-59 35.6492 37.0 37.0 37.0 37.0 37.0 60-64 35.4581 37.0 37.0 37.0 37.0 37.0 65-69 35.4107 37.0 37.0 37.0 37.0 37.0 70-74 35.307 37.0 37.0 37.0 34.6 37.0 75-79 35.3082 37.0 37.0 37.0 37.0 37.0 80-84 35.3215 37.0 37.0 37.0 34.6 37.0 85-89 35.229 37.0 37.0 37.0 32.2 37.0 90-94 35.2193 37.0 37.0 37.0 32.2 37.0 95-99 35.05159999999999 37.0 37.0 37.0 25.0 37.0 100-104 34.9616 37.0 37.0 37.0 25.0 37.0 105-109 34.9632 37.0 37.0 37.0 25.0 37.0 110-114 34.7496 37.0 37.0 37.0 25.0 37.0 115-119 34.7201 37.0 37.0 37.0 25.0 37.0 120-124 34.688500000000005 37.0 37.0 37.0 25.0 37.0 125-129 34.52419999999999 37.0 37.0 37.0 25.0 37.0 130-134 34.4519 37.0 37.0 37.0 25.0 37.0 135-139 34.2666 37.0 37.0 37.0 25.0 37.0 140-144 34.0914 37.0 37.0 37.0 25.0 37.0 145-149 33.961999999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.19925 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 4.0 15 2.0 16 1.0 17 0.0 18 1.0 19 1.0 20 3.0 21 5.0 22 2.0 23 12.0 24 6.0 25 12.0 26 14.0 27 21.0 28 34.0 29 37.0 30 51.0 31 77.0 32 128.0 33 206.0 34 404.0 35 910.0 36 2007.0 37 58.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.575 13.8 14.924999999999999 35.699999999999996 2 29.599999999999998 18.775 29.675 21.95 3 25.45 21.175 27.450000000000003 25.924999999999997 4 28.299999999999997 30.15 17.1 24.45 5 28.825 31.075000000000003 17.925 22.175 6 22.8 34.849999999999994 18.0 24.349999999999998 7 22.5 14.174999999999999 37.65 25.674999999999997 8 21.55 21.099999999999998 23.599999999999998 33.75 9 24.625 20.05 24.575 30.75 10-14 25.47 24.335 22.88 27.315 15-19 25.419999999999998 24.195 24.03 26.355 20-24 26.090000000000003 24.345 23.585 25.979999999999997 25-29 26.1 24.39 23.25 26.26 30-34 26.229999999999997 24.035 23.585 26.150000000000002 35-39 25.86 24.635 22.805 26.700000000000003 40-44 26.345000000000002 24.154999999999998 23.32 26.179999999999996 45-49 26.275 24.055 23.735 25.935000000000002 50-54 27.05 24.805 23.18 24.965 55-59 26.545 24.715 23.115 25.624999999999996 60-64 27.034999999999997 24.66 23.1 25.205 65-69 26.645000000000003 24.5 23.31 25.545 70-74 26.845000000000002 24.759999999999998 22.86 25.535000000000004 75-79 26.765 24.725 23.47 25.040000000000003 80-84 27.500000000000004 24.310000000000002 22.825 25.365 85-89 27.015 24.240000000000002 23.3 25.445 90-94 27.375 23.97 23.715 24.94 95-99 27.12 24.77 23.119999999999997 24.990000000000002 100-104 27.605 24.279999999999998 23.29 24.825 105-109 26.775 23.945 23.925 25.355 110-114 27.169999999999998 24.525 23.380000000000003 24.925 115-119 26.090000000000003 25.105 23.375 25.430000000000003 120-124 26.755000000000003 24.59 23.46 25.195 125-129 27.034999999999997 24.610000000000003 23.294999999999998 25.06 130-134 27.229999999999997 24.735 23.3 24.735 135-139 26.815 24.255 23.745 25.185000000000002 140-144 27.13 24.474999999999998 23.585 24.81 145-149 27.985 24.295 23.075000000000003 24.645 150-151 27.737499999999997 24.887500000000003 22.537499999999998 24.837500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.0 28 2.0 29 4.0 30 5.0 31 8.5 32 7.5 33 8.5 34 14.0 35 25.0 36 35.0 37 45.5 38 65.5 39 75.5 40 90.0 41 115.5 42 129.5 43 150.5 44 170.0 45 173.0 46 169.0 47 167.5 48 159.0 49 154.0 50 157.0 51 143.5 52 125.5 53 116.0 54 107.5 55 103.0 56 100.0 57 93.0 58 90.0 59 86.0 60 82.5 61 77.5 62 76.5 63 78.0 64 75.0 65 78.0 66 71.5 67 68.0 68 77.5 69 69.5 70 59.5 71 59.0 72 50.5 73 37.0 74 32.0 75 24.0 76 16.5 77 17.0 78 14.5 79 8.0 80 5.5 81 4.0 82 2.5 83 2.0 84 1.5 85 1.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.40320462306278 90.8 2 4.281586551090097 8.15 3 0.2626740215392698 0.75 4 0.0 0.0 5 0.026267402153926978 0.125 6 0.0 0.0 7 0.026267402153926978 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.42500000000000004 0.0 0.0 0.0 0.0 126-127 0.4875 0.0 0.0 0.0 0.0 128-129 0.6 0.0 0.0 0.0 0.0 130-131 0.6375 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.7875 0.0 0.0 0.0 0.0 136-137 0.8625 0.0 0.0 0.0 0.0 138-139 1.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCTCG 10 0.006830828 145.0 5 >>END_MODULE Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578672 spots for SRR7804194.sra Written 1578672 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra Read 1578657 spots for SRR7804194.sra Written 1578657 spots for SRR7804194.sra SRR ids: ['SRR7804194.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qq17t_rw SRR7804194.sra spots: 31573155 blocks: [[1, 1578657], [1578658, 3157314], [3157315, 4735971], [4735972, 6314628], [6314629, 7893285], [7893286, 9471942], [9471943, 11050599], [11050600, 12629256], [12629257, 14207913], [14207914, 15786570], [15786571, 17365227], [17365228, 18943884], [18943885, 20522541], [20522542, 22101198], [22101199, 23679855], [23679856, 25258512], [25258513, 26837169], [26837170, 28415826], [28415827, 29994483], [29994484, 31573155]] SRR7804194 file size 10677405 SRR7804194 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804194 SRR7804194_1.fastq SRR7804194_2.fastq Input file: SRR7804194_1.fastq Paired file: SRR7804194_2.fastq trimmed: SRR7804194-trimmed-pair1.fastq, SRR7804194-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:51:25 2024 >> started Tue Dec 10 03:52:01 2024 >> done (36.451s) 31573155 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 898 ( 0.00%) empty read pairs filtered out after trimming by size control 31572171 (100.00%) read pairs available; of these: 660147 ( 2.09%) trimmed read pairs available after processing 30912024 (97.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 25 0.00% 20 24 0.00% 21 33 0.00% 22 22 0.00% 23 31 0.00% 24 35 0.00% 25 34 0.00% 26 31 0.00% 27 45 0.00% 28 43 0.00% 29 44 0.00% 30 62 0.00% 31 66 0.00% 32 69 0.00% 33 51 0.00% 34 71 0.00% 35 65 0.00% 36 67 0.00% 37 70 0.00% 38 76 0.00% 39 74 0.00% 40 92 0.00% 41 92 0.00% 42 93 0.00% 43 78 0.00% 44 91 0.00% 45 79 0.00% 46 106 0.00% 47 115 0.00% 48 113 0.00% 49 102 0.00% 50 116 0.00% 51 119 0.00% 52 113 0.00% 53 127 0.00% 54 126 0.00% 55 132 0.00% 56 139 0.00% 57 131 0.00% 58 143 0.00% 59 122 0.00% 60 153 0.00% 61 144 0.00% 62 153 0.00% 63 155 0.00% 64 141 0.00% 65 126 0.00% 66 145 0.00% 67 172 0.00% 68 178 0.00% 69 170 0.00% 70 203 0.00% 71 206 0.00% 72 250 0.00% 73 218 0.00% 74 229 0.00% 75 238 0.00% 76 280 0.00% 77 283 0.00% 78 318 0.00% 79 320 0.00% 80 383 0.00% 81 395 0.00% 82 480 0.00% 83 545 0.00% 84 528 0.00% 85 614 0.00% 86 634 0.00% 87 748 0.00% 88 844 0.00% 89 855 0.00% 90 962 0.00% 91 1018 0.00% 92 1221 0.00% 93 1313 0.00% 94 1491 0.00% 95 1551 0.00% 96 1739 0.01% 97 1911 0.01% 98 1957 0.01% 99 2170 0.01% 100 2349 0.01% 101 2537 0.01% 102 2775 0.01% 103 2887 0.01% 104 3146 0.01% 105 3524 0.01% 106 3687 0.01% 107 3921 0.01% 108 4136 0.01% 109 4435 0.01% 110 4691 0.01% 111 5134 0.02% 112 5304 0.02% 113 5819 0.02% 114 6140 0.02% 115 6453 0.02% 116 6888 0.02% 117 7218 0.02% 118 7543 0.02% 119 7871 0.02% 120 8367 0.03% 121 8915 0.03% 122 9176 0.03% 123 9601 0.03% 124 10397 0.03% 125 10955 0.03% 126 11479 0.04% 127 11849 0.04% 128 12085 0.04% 129 12746 0.04% 130 13069 0.04% 131 13610 0.04% 132 14438 0.05% 133 15464 0.05% 134 15765 0.05% 135 16867 0.05% 136 17723 0.06% 137 18137 0.06% 138 18719 0.06% 139 19128 0.06% 140 19843 0.06% 141 20362 0.06% 142 21295 0.07% 143 22137 0.07% 144 23373 0.07% 145 24357 0.08% 146 25342 0.08% 147 26044 0.08% 148 27203 0.09% 149 27700 0.09% 150 28821 0.09% 151 30912024 97.91% 31572171 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=3.2 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=198.13 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=23.3 sequence=GCAGCAGCAGCA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=31 prefix-density=0.75 prefix-fanout=2.3 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=844.44 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=22.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAG SRR7804194 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:52:58 Started mapping on | Dec 10 03:52:58 Finished on | Dec 10 03:59:36 Mapping speed, Million of reads per hour | 285.58 Number of input reads | 31572171 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 29073490 Uniquely mapped reads % | 92.09% Average mapped length | 300.01 Number of splices: Total | 28643108 Number of splices: Annotated (sjdb) | 26804406 Number of splices: GT/AG | 28258962 Number of splices: GC/AG | 321328 Number of splices: AT/AC | 19796 Number of splices: Non-canonical | 43022 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 3.03 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362491 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 24594 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.03% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2136190 2136190 2136190 N_multimapping 362491 362491 362491 N_noFeature 705669 28163365 1043049 N_ambiguous 677683 5375 107439 UnstrandedReadsAssigned:27690138 PositiveStrandReadsAssigned:904750 NegativeStrandReadsAssigned:27923002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804194 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804194-trimmed-pair1.fastq SRR7804194-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,572,171 reads, 28,333,458 reads pseudoaligned [quant] estimated average fragment length: 338.543 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,283 rounds 52973 SRR7804194.ke.tsv 35125 SRR7804194.se.tsv 88098 total ==> SRR7804194.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 599.594 0 0 PNS24247 1044 706.457 80.5315 5.13885 PNS24249 1928 1590.46 299.68 8.49419 PNS24246 1044 706.457 80.5315 5.13885 PNS24248 1044 706.457 80.5315 5.13885 PNS24244 1471 1133.46 101.725 4.04584 PNS24243 293 69.184 4 2.60639 KQK14069 1603 1265.46 14072.4 501.311 KQK14071 474 184.834 104.746 25.5472 ==> SRR7804194.se.tsv <== BRADI_1g14170v3 14750 BRADI_1g53295v3 274 BRADI_1g59795v3 563 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 1166 BRADI_1g74790v3 181 BRADI_1g09890v3 0 BRADI_1g77505v3 289 BRADI_1g48960v3 0 SRR7804194 completed mapping pipeline successfully