Starting /dee2/code/volunteer_pipeline.sh SRR7804195 current disk space = 1526217453568 free memory = 1425409412 SRR7804195 SRAfilesize 869d8d9ff04c3d3947ac08e61ae41310 SRR7804195.sra SRR7804195.sra file validated SRR7804195 is paired end SRR7804195 is conventional basespace SRR7804195 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804195_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.14475 37.0 37.0 37.0 37.0 37.0 2 36.1715 37.0 37.0 37.0 37.0 37.0 3 36.351 37.0 37.0 37.0 37.0 37.0 4 36.3995 37.0 37.0 37.0 37.0 37.0 5 36.4685 37.0 37.0 37.0 37.0 37.0 6 36.548 37.0 37.0 37.0 37.0 37.0 7 36.33 37.0 37.0 37.0 37.0 37.0 8 36.419 37.0 37.0 37.0 37.0 37.0 9 36.384 37.0 37.0 37.0 37.0 37.0 10-14 36.453199999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.4618 37.0 37.0 37.0 37.0 37.0 20-24 36.441900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.3678 37.0 37.0 37.0 37.0 37.0 30-34 36.408699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.3146 37.0 37.0 37.0 37.0 37.0 40-44 36.2821 37.0 37.0 37.0 37.0 37.0 45-49 36.241200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.2277 37.0 37.0 37.0 37.0 37.0 55-59 36.1518 37.0 37.0 37.0 37.0 37.0 60-64 36.1586 37.0 37.0 37.0 37.0 37.0 65-69 36.1334 37.0 37.0 37.0 37.0 37.0 70-74 35.9889 37.0 37.0 37.0 37.0 37.0 75-79 36.0604 37.0 37.0 37.0 37.0 37.0 80-84 35.996900000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9651 37.0 37.0 37.0 37.0 37.0 90-94 35.960300000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8106 37.0 37.0 37.0 37.0 37.0 100-104 35.8066 37.0 37.0 37.0 37.0 37.0 105-109 35.8087 37.0 37.0 37.0 37.0 37.0 110-114 35.7973 37.0 37.0 37.0 37.0 37.0 115-119 35.6571 37.0 37.0 37.0 37.0 37.0 120-124 35.5399 37.0 37.0 37.0 37.0 37.0 125-129 35.5715 37.0 37.0 37.0 37.0 37.0 130-134 35.394400000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.3158 37.0 37.0 37.0 34.6 37.0 140-144 35.3417 37.0 37.0 37.0 32.2 37.0 145-149 35.1266 37.0 37.0 37.0 27.4 37.0 150-151 34.631 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 1.0 24 2.0 25 5.0 26 13.0 27 15.0 28 26.0 29 14.0 30 37.0 31 61.0 32 73.0 33 109.0 34 174.0 35 452.0 36 2795.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.53543701477586 12.021036814425244 11.119459053343352 42.32406711745555 2 24.875 17.575 35.225 22.325 3 23.775 23.325000000000003 22.75 30.15 4 26.625 30.075000000000003 18.775 24.525 5 25.75 32.675 20.775 20.8 6 19.950000000000003 33.125 24.0 22.925 7 16.675 19.8 40.925 22.6 8 21.099999999999998 20.375 27.375 31.15 9 21.075 19.575 31.424999999999997 27.925 10-14 23.555 26.895000000000003 24.099999999999998 25.45 15-19 23.32 25.319999999999997 25.430000000000003 25.929999999999996 20-24 23.685000000000002 25.755 24.795 25.765 25-29 23.599999999999998 25.11 25.095 26.195 30-34 23.28 25.919999999999998 24.575 26.224999999999998 35-39 23.185 25.069999999999997 25.39 26.355 40-44 23.330000000000002 25.624999999999996 24.75 26.295 45-49 23.64 25.474999999999998 25.41 25.474999999999998 50-54 23.59 25.455 24.73 26.224999999999998 55-59 24.255 25.06 25.27 25.415 60-64 23.785 25.21 25.14 25.865 65-69 24.05 25.535000000000004 24.09 26.325 70-74 24.310000000000002 24.385 24.725 26.58 75-79 24.69 25.095 23.95 26.265 80-84 24.46 25.069999999999997 24.73 25.740000000000002 85-89 24.765 24.77 24.15 26.314999999999998 90-94 24.365000000000002 24.93 24.69 26.015 95-99 24.315 24.805 24.425 26.455000000000002 100-104 24.725 24.779999999999998 24.115000000000002 26.38 105-109 24.32 25.19 24.57 25.919999999999998 110-114 24.404999999999998 24.47 24.25 26.875 115-119 24.72 25.025 23.599999999999998 26.655 120-124 25.095 24.834999999999997 23.9 26.169999999999998 125-129 24.94 24.834999999999997 23.73 26.495 130-134 24.66 24.785 24.11 26.445 135-139 24.58 24.69 24.465 26.265 140-144 24.415 25.005 23.785 26.795 145-149 25.06 24.015 23.96 26.965 150-151 25.05 24.349999999999998 24.462500000000002 26.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 1.5 26 0.5 27 1.5 28 3.0 29 4.0 30 5.5 31 8.0 32 13.5 33 23.5 34 30.0 35 43.0 36 53.0 37 66.0 38 82.0 39 104.0 40 126.0 41 134.5 42 146.0 43 162.5 44 174.0 45 191.0 46 203.0 47 177.5 48 163.0 49 170.0 50 167.5 51 147.0 52 138.5 53 135.5 54 108.0 55 99.5 56 96.5 57 87.5 58 78.5 59 78.5 60 80.0 61 63.5 62 54.0 63 55.0 64 66.5 65 69.5 66 60.5 67 50.5 68 41.0 69 40.0 70 37.0 71 30.0 72 29.0 73 23.0 74 16.5 75 15.5 76 11.0 77 7.5 78 6.0 79 2.5 80 2.5 81 5.0 82 4.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.36929460580913 92.9 2 3.5269709543568464 6.800000000000001 3 0.1037344398340249 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.2999999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCACT 10 0.006830828 145.0 1 >>END_MODULE SRR7804195 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804195_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5845 37.0 37.0 37.0 37.0 37.0 2 36.2965 37.0 37.0 37.0 37.0 37.0 3 36.44 37.0 37.0 37.0 37.0 37.0 4 36.502 37.0 37.0 37.0 37.0 37.0 5 36.5175 37.0 37.0 37.0 37.0 37.0 6 36.3735 37.0 37.0 37.0 37.0 37.0 7 36.381 37.0 37.0 37.0 37.0 37.0 8 36.415 37.0 37.0 37.0 37.0 37.0 9 36.4645 37.0 37.0 37.0 37.0 37.0 10-14 36.422000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3526 37.0 37.0 37.0 37.0 37.0 20-24 36.37070000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.34140000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2653 37.0 37.0 37.0 37.0 37.0 35-39 36.29260000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.216899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.1437 37.0 37.0 37.0 37.0 37.0 50-54 36.1234 37.0 37.0 37.0 37.0 37.0 55-59 36.122400000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.0647 37.0 37.0 37.0 37.0 37.0 65-69 35.992900000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0058 37.0 37.0 37.0 37.0 37.0 75-79 35.9214 37.0 37.0 37.0 37.0 37.0 80-84 35.937400000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.761100000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.7572 37.0 37.0 37.0 37.0 37.0 95-99 35.67379999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.563900000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.567099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.4591 37.0 37.0 37.0 37.0 37.0 115-119 35.4651 37.0 37.0 37.0 37.0 37.0 120-124 35.355900000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.2297 37.0 37.0 37.0 29.8 37.0 130-134 35.239999999999995 37.0 37.0 37.0 34.6 37.0 135-139 35.0072 37.0 37.0 37.0 25.0 37.0 140-144 34.885200000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.7252 37.0 37.0 37.0 25.0 37.0 150-151 34.1175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 2.0 16 1.0 17 2.0 18 0.0 19 0.0 20 2.0 21 2.0 22 3.0 23 1.0 24 7.0 25 8.0 26 7.0 27 10.0 28 17.0 29 17.0 30 23.0 31 36.0 32 74.0 33 112.0 34 248.0 35 712.0 36 2587.0 37 127.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.75 12.925 14.549999999999999 39.775 2 27.175 19.275000000000002 31.724999999999998 21.825 3 24.725 21.8 27.575 25.900000000000002 4 26.125 29.125 17.825 26.924999999999997 5 28.65 31.3 18.0 22.05 6 22.025 33.375 18.725 25.874999999999996 7 21.075 15.1 36.4 27.425 8 23.325000000000003 19.650000000000002 23.724999999999998 33.300000000000004 9 24.75 20.1 25.025 30.125 10-14 25.71 25.52 21.705 27.065 15-19 26.395000000000003 23.745 23.395 26.465 20-24 25.814999999999998 24.25 23.145 26.790000000000003 25-29 25.595000000000002 24.26 23.465 26.68 30-34 26.025 24.135 23.125 26.715 35-39 26.529999999999998 23.965 23.305 26.200000000000003 40-44 26.575 23.61 23.44 26.375 45-49 26.735 23.875 23.330000000000002 26.06 50-54 26.735 24.02 23.315 25.929999999999996 55-59 27.125 24.355 23.11 25.41 60-64 27.310000000000002 23.86 23.27 25.56 65-69 26.855 24.01 23.085 26.05 70-74 27.245 24.165 23.325000000000003 25.264999999999997 75-79 26.91 23.635 23.215 26.240000000000002 80-84 27.0 24.215 23.275000000000002 25.509999999999998 85-89 26.775 24.03 22.865 26.33 90-94 26.615 24.355 23.615 25.415 95-99 27.334999999999997 24.22 22.855 25.590000000000003 100-104 27.365000000000002 24.33 23.244999999999997 25.06 105-109 26.86 24.19 23.585 25.365 110-114 26.955000000000002 24.884999999999998 23.47 24.69 115-119 27.200000000000003 24.69 23.474999999999998 24.635 120-124 27.125 24.44 23.255 25.180000000000003 125-129 26.935 24.565 23.580000000000002 24.92 130-134 27.650000000000002 24.005000000000003 23.195 25.15 135-139 27.07 24.9 23.244999999999997 24.785 140-144 27.61 24.165 23.585 24.64 145-149 27.445000000000004 24.11 23.599999999999998 24.845 150-151 26.487500000000004 24.4875 24.1875 24.837500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 0.5 28 2.0 29 4.0 30 4.5 31 5.5 32 10.0 33 14.0 34 16.0 35 23.0 36 33.5 37 41.0 38 57.0 39 82.0 40 92.5 41 100.0 42 123.0 43 140.5 44 151.5 45 163.0 46 166.0 47 163.5 48 143.0 49 139.0 50 140.0 51 124.5 52 129.5 53 126.5 54 116.5 55 108.0 56 98.5 57 90.5 58 102.0 59 116.5 60 105.5 61 98.5 62 93.5 63 85.0 64 81.0 65 81.0 66 76.5 67 70.5 68 74.5 69 74.0 70 62.0 71 47.5 72 46.5 73 43.0 74 29.5 75 25.5 76 21.0 77 14.0 78 11.5 79 7.5 80 2.5 81 3.0 82 2.0 83 1.0 84 1.0 85 0.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.7 #Duplication Level Percentage of deduplicated Percentage of total 1 96.1337513061651 92.0 2 3.5527690700104495 6.800000000000001 3 0.20898641588296762 0.6 4 0.026123301985370953 0.1 5 0.026123301985370953 0.125 6 0.026123301985370953 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026123301985370953 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.025 104-105 0.2 0.0 0.0 0.0 0.025 106-107 0.21250000000000002 0.0 0.0 0.0 0.025 108-109 0.25 0.0 0.0 0.0 0.025 110-111 0.3 0.0 0.0 0.0 0.025 112-113 0.32499999999999996 0.0 0.0 0.0 0.025 114-115 0.35 0.0 0.0 0.0 0.025 116-117 0.42500000000000004 0.0 0.0 0.0 0.025 118-119 0.55 0.0 0.0 0.0 0.025 120-121 0.65 0.0 0.0 0.0 0.025 122-123 0.725 0.0 0.0 0.0 0.025 124-125 0.85 0.0 0.0 0.0 0.025 126-127 0.925 0.0 0.0 0.0 0.025 128-129 1.0499999999999998 0.0 0.0 0.0 0.025 130-131 1.1125 0.0 0.0 0.0 0.025 132-133 1.1749999999999998 0.0 0.0 0.0 0.025 134-135 1.2375 0.0 0.0 0.0 0.025 136-137 1.2875 0.0 0.0 0.0 0.025 138-139 1.375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1703000 spots for SRR7804195.sra Written 1703000 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra Read 1702995 spots for SRR7804195.sra Written 1702995 spots for SRR7804195.sra SRR ids: ['SRR7804195.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vmu7740f SRR7804195.sra spots: 34059905 blocks: [[1, 1702995], [1702996, 3405990], [3405991, 5108985], [5108986, 6811980], [6811981, 8514975], [8514976, 10217970], [10217971, 11920965], [11920966, 13623960], [13623961, 15326955], [15326956, 17029950], [17029951, 18732945], [18732946, 20435940], [20435941, 22138935], [22138936, 23841930], [23841931, 25544925], [25544926, 27247920], [27247921, 28950915], [28950916, 30653910], [30653911, 32356905], [32356906, 34059905]] SRR7804195 file size 11520083 SRR7804195 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804195 SRR7804195_1.fastq SRR7804195_2.fastq Input file: SRR7804195_1.fastq Paired file: SRR7804195_2.fastq trimmed: SRR7804195-trimmed-pair1.fastq, SRR7804195-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:57:26 2024 >> started Tue Dec 10 03:58:11 2024 >> done (45.045s) 34059905 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 911 ( 0.00%) empty read pairs filtered out after trimming by size control 34058917 (100.00%) read pairs available; of these: 707699 ( 2.08%) trimmed read pairs available after processing 33351218 (97.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 13 0.00% 21 18 0.00% 22 22 0.00% 23 33 0.00% 24 31 0.00% 25 28 0.00% 26 40 0.00% 27 38 0.00% 28 36 0.00% 29 33 0.00% 30 47 0.00% 31 39 0.00% 32 48 0.00% 33 44 0.00% 34 38 0.00% 35 57 0.00% 36 50 0.00% 37 45 0.00% 38 66 0.00% 39 58 0.00% 40 73 0.00% 41 73 0.00% 42 76 0.00% 43 87 0.00% 44 61 0.00% 45 57 0.00% 46 58 0.00% 47 95 0.00% 48 79 0.00% 49 79 0.00% 50 88 0.00% 51 80 0.00% 52 98 0.00% 53 85 0.00% 54 108 0.00% 55 90 0.00% 56 101 0.00% 57 124 0.00% 58 119 0.00% 59 118 0.00% 60 116 0.00% 61 129 0.00% 62 141 0.00% 63 123 0.00% 64 131 0.00% 65 159 0.00% 66 148 0.00% 67 132 0.00% 68 189 0.00% 69 171 0.00% 70 204 0.00% 71 176 0.00% 72 244 0.00% 73 249 0.00% 74 228 0.00% 75 279 0.00% 76 258 0.00% 77 318 0.00% 78 371 0.00% 79 433 0.00% 80 408 0.00% 81 458 0.00% 82 546 0.00% 83 539 0.00% 84 640 0.00% 85 711 0.00% 86 770 0.00% 87 890 0.00% 88 969 0.00% 89 1065 0.00% 90 1157 0.00% 91 1274 0.00% 92 1426 0.00% 93 1563 0.00% 94 1801 0.01% 95 1856 0.01% 96 2059 0.01% 97 2154 0.01% 98 2333 0.01% 99 2467 0.01% 100 2701 0.01% 101 2796 0.01% 102 3210 0.01% 103 3389 0.01% 104 3511 0.01% 105 3853 0.01% 106 4185 0.01% 107 4327 0.01% 108 4615 0.01% 109 4792 0.01% 110 5014 0.01% 111 5452 0.02% 112 6081 0.02% 113 6258 0.02% 114 6678 0.02% 115 6934 0.02% 116 7259 0.02% 117 7732 0.02% 118 7971 0.02% 119 8242 0.02% 120 8794 0.03% 121 9538 0.03% 122 9725 0.03% 123 10565 0.03% 124 11211 0.03% 125 11571 0.03% 126 12309 0.04% 127 12555 0.04% 128 12968 0.04% 129 13630 0.04% 130 14027 0.04% 131 14836 0.04% 132 15214 0.04% 133 15995 0.05% 134 16895 0.05% 135 17908 0.05% 136 18858 0.06% 137 19311 0.06% 138 20409 0.06% 139 20314 0.06% 140 21182 0.06% 141 21655 0.06% 142 22800 0.07% 143 23756 0.07% 144 24830 0.07% 145 26135 0.08% 146 27048 0.08% 147 27503 0.08% 148 29134 0.09% 149 29431 0.09% 150 30750 0.09% 151 33351218 97.92% 34058917 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=28 prefix-density=0.18 prefix-fanout=3.1 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCT criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=325.36 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=31.7 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=31 prefix-density=0.82 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=614.76 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=20.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804195 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:59:34 Started mapping on | Dec 10 03:59:35 Finished on | Dec 10 04:07:07 Mapping speed, Million of reads per hour | 271.27 Number of input reads | 34058917 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 31631734 Uniquely mapped reads % | 92.87% Average mapped length | 300.23 Number of splices: Total | 32397266 Number of splices: Annotated (sjdb) | 30296145 Number of splices: GT/AG | 31967367 Number of splices: GC/AG | 361144 Number of splices: AT/AC | 23981 Number of splices: Non-canonical | 44774 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.85 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454241 % of reads mapped to multiple loci | 1.33% Number of reads mapped to too many loci | 34378 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.92% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1972942 1972942 1972942 N_multimapping 454241 454241 454241 N_noFeature 794001 30721710 1116787 N_ambiguous 700746 5785 114991 UnstrandedReadsAssigned:30136987 PositiveStrandReadsAssigned:904239 NegativeStrandReadsAssigned:30399956 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804195 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804195-trimmed-pair1.fastq SRR7804195-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,058,917 reads, 30,724,818 reads pseudoaligned [quant] estimated average fragment length: 335.564 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52973 SRR7804195.ke.tsv 35125 SRR7804195.se.tsv 88098 total ==> SRR7804195.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 602.589 0 0 PNS24247 1044 709.436 81.5004 4.68107 PNS24249 1928 1593.44 318.628 8.14794 PNS24246 1044 709.436 81.5004 4.68107 PNS24248 1044 709.436 81.5004 4.68107 PNS24244 1471 1136.44 139.871 5.01511 PNS24243 293 69.1524 1 0.589239 KQK14069 1603 1268.44 18385.8 590.626 KQK14071 474 185.673 146.349 32.1173 ==> SRR7804195.se.tsv <== BRADI_1g14170v3 19357 BRADI_1g53295v3 277 BRADI_1g59795v3 717 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 1992 BRADI_1g74790v3 179 BRADI_1g09890v3 0 BRADI_1g77505v3 358 BRADI_1g48960v3 0 SRR7804195 completed mapping pipeline successfully