Starting /dee2/code/volunteer_pipeline.sh SRR7804196 current disk space = 1526209236992 free memory = 1599754188 SRR7804196 SRAfilesize 4bb1546094dfa5d7cd324e2ded5748c0 SRR7804196.sra SRR7804196.sra file validated SRR7804196 is paired end SRR7804196 is conventional basespace SRR7804196 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804196_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0665 37.0 37.0 37.0 37.0 37.0 2 36.239 37.0 37.0 37.0 37.0 37.0 3 36.4555 37.0 37.0 37.0 37.0 37.0 4 36.467 37.0 37.0 37.0 37.0 37.0 5 36.582 37.0 37.0 37.0 37.0 37.0 6 36.4985 37.0 37.0 37.0 37.0 37.0 7 36.243 37.0 37.0 37.0 37.0 37.0 8 36.3995 37.0 37.0 37.0 37.0 37.0 9 36.476 37.0 37.0 37.0 37.0 37.0 10-14 36.4935 37.0 37.0 37.0 37.0 37.0 15-19 36.4727 37.0 37.0 37.0 37.0 37.0 20-24 36.4154 37.0 37.0 37.0 37.0 37.0 25-29 36.4076 37.0 37.0 37.0 37.0 37.0 30-34 36.394 37.0 37.0 37.0 37.0 37.0 35-39 36.339200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.310900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.2923 37.0 37.0 37.0 37.0 37.0 50-54 36.2376 37.0 37.0 37.0 37.0 37.0 55-59 36.2265 37.0 37.0 37.0 37.0 37.0 60-64 36.2205 37.0 37.0 37.0 37.0 37.0 65-69 36.1676 37.0 37.0 37.0 37.0 37.0 70-74 36.0929 37.0 37.0 37.0 37.0 37.0 75-79 36.104200000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.1023 37.0 37.0 37.0 37.0 37.0 85-89 36.0425 37.0 37.0 37.0 37.0 37.0 90-94 35.9583 37.0 37.0 37.0 37.0 37.0 95-99 35.9013 37.0 37.0 37.0 37.0 37.0 100-104 35.8792 37.0 37.0 37.0 37.0 37.0 105-109 35.8124 37.0 37.0 37.0 37.0 37.0 110-114 35.857299999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7251 37.0 37.0 37.0 37.0 37.0 120-124 35.5985 37.0 37.0 37.0 37.0 37.0 125-129 35.709799999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.467 37.0 37.0 37.0 37.0 37.0 135-139 35.340500000000006 37.0 37.0 37.0 34.6 37.0 140-144 35.424699999999994 37.0 37.0 37.0 34.6 37.0 145-149 35.1941 37.0 37.0 37.0 29.8 37.0 150-151 34.6085 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 5.0 26 3.0 27 9.0 28 20.0 29 24.0 30 43.0 31 46.0 32 62.0 33 121.0 34 178.0 35 443.0 36 2818.0 37 223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.63171098845961 13.120923231309584 10.486703462117411 38.7606623181134 2 24.975 17.2 33.650000000000006 24.175 3 22.125 24.349999999999998 23.925 29.599999999999998 4 27.825 29.775000000000002 18.775 23.625 5 25.0 32.05 21.525 21.425 6 20.625 31.775 23.875 23.724999999999998 7 17.2 18.55 42.199999999999996 22.05 8 20.974999999999998 18.5 27.275 33.25 9 20.95 20.075000000000003 29.275000000000002 29.7 10-14 24.12 26.405 23.91 25.564999999999998 15-19 24.505 25.165 24.05 26.279999999999998 20-24 24.03 25.09 24.675 26.205000000000002 25-29 24.025 25.31 24.065 26.6 30-34 24.665 24.355 24.385 26.595000000000002 35-39 24.515 24.685000000000002 24.215 26.584999999999997 40-44 24.19 24.505 24.775 26.529999999999998 45-49 24.695 24.445 24.529999999999998 26.33 50-54 24.490000000000002 24.62 24.23 26.66 55-59 24.310000000000002 24.73 24.39 26.57 60-64 24.759999999999998 24.23 24.305 26.705000000000002 65-69 24.735 24.08 24.34 26.845000000000002 70-74 25.074999999999996 24.285 24.245 26.395000000000003 75-79 25.319999999999997 24.08 23.785 26.815 80-84 26.064999999999998 23.825 23.735 26.375 85-89 25.36 23.919999999999998 24.34 26.38 90-94 25.330000000000002 23.885 24.315 26.47 95-99 25.0 23.66 24.645 26.695 100-104 25.335 23.78 24.115000000000002 26.77 105-109 25.16 23.48 24.025 27.334999999999997 110-114 25.245 23.805 23.79 27.16 115-119 25.965 23.515 23.794999999999998 26.724999999999998 120-124 25.814999999999998 23.705000000000002 23.665 26.815 125-129 25.995 23.935000000000002 23.515 26.555 130-134 25.869999999999997 23.515 23.43 27.185 135-139 25.840000000000003 23.52 23.62 27.02 140-144 25.929999999999996 23.53 23.77 26.77 145-149 25.245 23.075000000000003 24.29 27.389999999999997 150-151 26.337500000000002 22.475 24.1375 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 1.0 29 3.0 30 6.0 31 9.5 32 13.0 33 18.0 34 27.0 35 34.0 36 44.0 37 57.5 38 67.0 39 80.0 40 100.0 41 124.5 42 139.5 43 154.0 44 177.5 45 179.0 46 174.5 47 163.0 48 158.0 49 165.0 50 146.5 51 132.5 52 131.5 53 124.5 54 110.5 55 101.0 56 97.5 57 94.5 58 103.5 59 106.0 60 90.5 61 86.5 62 86.5 63 74.5 64 77.5 65 79.0 66 70.5 67 68.5 68 63.0 69 53.0 70 41.5 71 35.0 72 29.0 73 22.5 74 22.0 75 17.5 76 11.0 77 10.0 78 5.5 79 2.5 80 2.5 81 2.0 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.79799313440719 89.75 2 4.805914972273567 9.1 3 0.36968576709796674 1.05 4 0.026406126221283337 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138-139 1.3250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGAAC 10 0.006830828 145.0 1 TGAAGTC 10 0.006830828 145.0 145 CTACGGG 10 0.006830828 145.0 8 >>END_MODULE SRR7804196 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804196_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.313 37.0 37.0 37.0 37.0 37.0 2 36.061 37.0 37.0 37.0 37.0 37.0 3 36.1395 37.0 37.0 37.0 37.0 37.0 4 36.2425 37.0 37.0 37.0 37.0 37.0 5 36.239 37.0 37.0 37.0 37.0 37.0 6 36.1155 37.0 37.0 37.0 37.0 37.0 7 36.1585 37.0 37.0 37.0 37.0 37.0 8 36.208 37.0 37.0 37.0 37.0 37.0 9 36.2335 37.0 37.0 37.0 37.0 37.0 10-14 36.2266 37.0 37.0 37.0 37.0 37.0 15-19 36.064 37.0 37.0 37.0 37.0 37.0 20-24 36.0555 37.0 37.0 37.0 37.0 37.0 25-29 36.051 37.0 37.0 37.0 37.0 37.0 30-34 36.01959999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.914100000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.9251 37.0 37.0 37.0 37.0 37.0 45-49 35.840799999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.76819999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.7605 37.0 37.0 37.0 37.0 37.0 60-64 35.59779999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.572300000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.6017 37.0 37.0 37.0 37.0 37.0 75-79 35.584 37.0 37.0 37.0 37.0 37.0 80-84 35.380700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.3056 37.0 37.0 37.0 32.2 37.0 90-94 35.282399999999996 37.0 37.0 37.0 34.6 37.0 95-99 35.1853 37.0 37.0 37.0 27.4 37.0 100-104 35.1584 37.0 37.0 37.0 27.4 37.0 105-109 35.1063 37.0 37.0 37.0 25.0 37.0 110-114 34.9885 37.0 37.0 37.0 25.0 37.0 115-119 34.9897 37.0 37.0 37.0 25.0 37.0 120-124 34.9717 37.0 37.0 37.0 25.0 37.0 125-129 34.772800000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.6459 37.0 37.0 37.0 25.0 37.0 135-139 34.4615 37.0 37.0 37.0 25.0 37.0 140-144 34.3085 37.0 37.0 37.0 25.0 37.0 145-149 34.177200000000006 37.0 37.0 37.0 25.0 37.0 150-151 33.357 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 7.0 15 2.0 16 4.0 17 0.0 18 0.0 19 2.0 20 6.0 21 5.0 22 9.0 23 5.0 24 4.0 25 8.0 26 12.0 27 12.0 28 25.0 29 29.0 30 47.0 31 80.0 32 91.0 33 168.0 34 312.0 35 897.0 36 2198.0 37 76.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.3 12.725 12.85 38.125 2 30.049999999999997 16.875 29.975 23.1 3 23.925 21.2 27.6 27.275 4 27.750000000000004 29.675 17.175 25.4 5 28.95 30.425 17.849999999999998 22.775000000000002 6 22.6 33.4 18.8 25.2 7 21.45 14.575 36.5 27.474999999999998 8 23.549999999999997 18.15 22.650000000000002 35.65 9 25.124999999999996 20.225 24.9 29.75 10-14 25.8 24.310000000000002 21.51 28.38 15-19 26.51 23.294999999999998 22.6 27.595 20-24 26.474999999999998 24.04 21.89 27.595 25-29 27.185 23.225 22.665 26.924999999999997 30-34 26.705000000000002 23.445 22.185 27.665 35-39 26.47 23.595 22.54 27.395000000000003 40-44 27.24 23.305 22.27 27.185 45-49 27.195000000000004 22.43 22.505 27.87 50-54 27.435 23.615 22.07 26.88 55-59 27.275 23.28 21.845 27.6 60-64 27.405 22.775000000000002 22.235 27.584999999999997 65-69 26.529999999999998 23.150000000000002 22.295 28.025 70-74 26.765 22.97 22.575 27.689999999999998 75-79 27.034999999999997 23.24 22.435 27.29 80-84 27.245 23.895 21.83 27.029999999999998 85-89 27.315 23.415 22.12 27.150000000000002 90-94 27.35 23.294999999999998 22.35 27.005000000000003 95-99 27.655 22.915 22.939999999999998 26.490000000000002 100-104 27.915 23.695 21.615000000000002 26.775 105-109 27.08 23.45 22.6 26.87 110-114 27.565 23.419999999999998 22.39 26.625 115-119 26.935 23.525 22.09 27.450000000000003 120-124 28.065 23.25 22.41 26.275 125-129 27.055 24.025 22.075 26.845000000000002 130-134 27.6 23.905 22.125 26.369999999999997 135-139 27.705000000000002 23.830000000000002 22.445 26.02 140-144 27.35 24.215 22.06 26.375 145-149 28.235 23.544999999999998 22.55 25.669999999999998 150-151 28.212500000000002 23.9875 23.0125 24.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.0 26 0.0 27 0.5 28 1.0 29 1.0 30 1.0 31 3.5 32 8.5 33 15.0 34 16.5 35 20.0 36 25.5 37 33.5 38 51.0 39 63.5 40 75.5 41 91.5 42 114.5 43 123.0 44 120.0 45 139.0 46 159.5 47 158.0 48 148.5 49 127.5 50 115.0 51 112.0 52 100.0 53 93.0 54 103.0 55 117.0 56 110.5 57 106.0 58 113.5 59 117.5 60 111.0 61 101.5 62 94.0 63 94.5 64 98.5 65 96.5 66 85.0 67 77.5 68 90.5 69 98.0 70 83.5 71 75.0 72 68.5 73 54.0 74 45.5 75 35.0 76 28.5 77 23.0 78 14.5 79 8.5 80 5.5 81 6.0 82 4.0 83 1.5 84 1.5 85 2.5 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 1.5 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.4326052210975 88.625 2 4.981353223228556 9.35 3 0.37293553542887586 1.05 4 0.07991475759190196 0.3 5 0.10655301012253596 0.5 6 0.0 0.0 7 0.02663825253063399 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 7 0.17500000000000002 No Hit CGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGT 5 0.125 No Hit CTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCG 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit CTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.8375 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCCAG 10 0.006830828 145.0 4 ATCCTTC 10 0.006830828 145.0 6 TTTTTTT 20 0.00593511 29.0 130-134 CCCCCCC 50 0.0013298223 17.4 115-119 >>END_MODULE Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718633 spots for SRR7804196.sra Written 1718633 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra Read 1718628 spots for SRR7804196.sra Written 1718628 spots for SRR7804196.sra SRR ids: ['SRR7804196.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kovl4zld SRR7804196.sra spots: 34372565 blocks: [[1, 1718628], [1718629, 3437256], [3437257, 5155884], [5155885, 6874512], [6874513, 8593140], [8593141, 10311768], [10311769, 12030396], [12030397, 13749024], [13749025, 15467652], [15467653, 17186280], [17186281, 18904908], [18904909, 20623536], [20623537, 22342164], [22342165, 24060792], [24060793, 25779420], [25779421, 27498048], [27498049, 29216676], [29216677, 30935304], [30935305, 32653932], [32653933, 34372565]] SRR7804196 file size 11626034 SRR7804196 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804196 SRR7804196_1.fastq SRR7804196_2.fastq Input file: SRR7804196_1.fastq Paired file: SRR7804196_2.fastq trimmed: SRR7804196-trimmed-pair1.fastq, SRR7804196-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:52:44 2024 >> started Tue Dec 10 03:53:25 2024 >> done (40.526s) 34372565 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 712 ( 0.00%) empty read pairs filtered out after trimming by size control 34371752 (100.00%) read pairs available; of these: 806978 ( 2.35%) trimmed read pairs available after processing 33564774 (97.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 15 0.00% 20 14 0.00% 21 15 0.00% 22 16 0.00% 23 27 0.00% 24 21 0.00% 25 26 0.00% 26 38 0.00% 27 31 0.00% 28 34 0.00% 29 34 0.00% 30 26 0.00% 31 40 0.00% 32 50 0.00% 33 27 0.00% 34 35 0.00% 35 40 0.00% 36 53 0.00% 37 45 0.00% 38 66 0.00% 39 66 0.00% 40 44 0.00% 41 56 0.00% 42 46 0.00% 43 58 0.00% 44 54 0.00% 45 49 0.00% 46 67 0.00% 47 56 0.00% 48 69 0.00% 49 41 0.00% 50 80 0.00% 51 56 0.00% 52 63 0.00% 53 78 0.00% 54 76 0.00% 55 81 0.00% 56 89 0.00% 57 83 0.00% 58 86 0.00% 59 95 0.00% 60 100 0.00% 61 107 0.00% 62 96 0.00% 63 120 0.00% 64 122 0.00% 65 93 0.00% 66 111 0.00% 67 123 0.00% 68 118 0.00% 69 131 0.00% 70 166 0.00% 71 156 0.00% 72 176 0.00% 73 208 0.00% 74 208 0.00% 75 219 0.00% 76 243 0.00% 77 256 0.00% 78 310 0.00% 79 335 0.00% 80 374 0.00% 81 443 0.00% 82 460 0.00% 83 544 0.00% 84 601 0.00% 85 633 0.00% 86 741 0.00% 87 783 0.00% 88 917 0.00% 89 952 0.00% 90 1115 0.00% 91 1132 0.00% 92 1306 0.00% 93 1588 0.00% 94 1723 0.01% 95 1792 0.01% 96 2070 0.01% 97 2276 0.01% 98 2325 0.01% 99 2538 0.01% 100 2735 0.01% 101 2999 0.01% 102 3323 0.01% 103 3690 0.01% 104 3933 0.01% 105 4178 0.01% 106 4610 0.01% 107 4871 0.01% 108 5092 0.01% 109 5486 0.02% 110 5752 0.02% 111 6153 0.02% 112 6598 0.02% 113 7107 0.02% 114 7837 0.02% 115 8222 0.02% 116 8560 0.02% 117 9042 0.03% 118 9250 0.03% 119 9700 0.03% 120 10142 0.03% 121 10674 0.03% 122 10973 0.03% 123 12132 0.04% 124 12773 0.04% 125 13605 0.04% 126 14388 0.04% 127 14855 0.04% 128 14939 0.04% 129 15632 0.05% 130 16037 0.05% 131 16750 0.05% 132 18220 0.05% 133 18562 0.05% 134 20016 0.06% 135 20892 0.06% 136 21652 0.06% 137 22260 0.06% 138 23233 0.07% 139 23712 0.07% 140 24370 0.07% 141 24863 0.07% 142 26127 0.08% 143 27162 0.08% 144 28516 0.08% 145 30408 0.09% 146 30717 0.09% 147 32647 0.09% 148 33311 0.10% 149 33900 0.10% 150 34602 0.10% 151 33564774 97.65% 34371752 reads passed initial QC criterion=sequence-density sequence-density=1.32 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=17 prefix-density=1.35 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=27 fanout-score=6.37 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=1.7 sequence=AGCATGGCCCACCTGCAGTGGATCACCTC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=9 prefix-density=0.97 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=77.81 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.9 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804196 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:54:15 Started mapping on | Dec 10 03:54:16 Finished on | Dec 10 03:59:28 Mapping speed, Million of reads per hour | 396.60 Number of input reads | 34371752 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 32393686 Uniquely mapped reads % | 94.25% Average mapped length | 300.12 Number of splices: Total | 34355776 Number of splices: Annotated (sjdb) | 32490971 Number of splices: GT/AG | 33894514 Number of splices: GC/AG | 405513 Number of splices: AT/AC | 15559 Number of splices: Non-canonical | 40190 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378719 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 33489 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.82% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1599347 1599347 1599347 N_multimapping 378719 378719 378719 N_noFeature 769263 31496933 987423 N_ambiguous 833493 4763 156300 UnstrandedReadsAssigned:30790930 PositiveStrandReadsAssigned:891990 NegativeStrandReadsAssigned:31249963 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804196 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804196-trimmed-pair1.fastq SRR7804196-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,371,752 reads, 31,518,602 reads pseudoaligned [quant] estimated average fragment length: 332.367 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR7804196.ke.tsv 35125 SRR7804196.se.tsv 88098 total ==> SRR7804196.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 605.648 0 0 PNS24247 1044 712.633 59.8051 3.29778 PNS24249 1928 1596.63 167.082 4.11218 PNS24246 1044 712.633 59.8051 3.29778 PNS24248 1044 712.633 59.8051 3.29778 PNS24244 1471 1139.63 99.503 3.43099 PNS24243 293 70.3779 0 0 KQK14069 1603 1271.63 481.73 14.8864 KQK14071 474 188.865 4.72621 0.983352 ==> SRR7804196.se.tsv <== BRADI_1g14170v3 526 BRADI_1g53295v3 175 BRADI_1g59795v3 810 BRADI_1g07683v3 0 BRADI_1g00485v3 57 BRADI_1g20270v3 4663 BRADI_1g74790v3 250 BRADI_1g09890v3 12 BRADI_1g77505v3 429 BRADI_1g48960v3 0 SRR7804196 completed mapping pipeline successfully