Starting /dee2/code/volunteer_pipeline.sh SRR7804197 current disk space = 1526119993344 free memory = 1388683884 SRR7804197 SRAfilesize 62ed05448e6c49183229985cbe00a0e1 SRR7804197.sra SRR7804197.sra file validated SRR7804197 is paired end SRR7804197 is conventional basespace SRR7804197 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804197_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.08825 37.0 37.0 37.0 37.0 37.0 2 36.244 37.0 37.0 37.0 37.0 37.0 3 36.423 37.0 37.0 37.0 37.0 37.0 4 36.5545 37.0 37.0 37.0 37.0 37.0 5 36.435 37.0 37.0 37.0 37.0 37.0 6 36.6625 37.0 37.0 37.0 37.0 37.0 7 36.4145 37.0 37.0 37.0 37.0 37.0 8 36.473 37.0 37.0 37.0 37.0 37.0 9 36.5225 37.0 37.0 37.0 37.0 37.0 10-14 36.522499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5282 37.0 37.0 37.0 37.0 37.0 20-24 36.515 37.0 37.0 37.0 37.0 37.0 25-29 36.37 37.0 37.0 37.0 37.0 37.0 30-34 36.44879999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.3951 37.0 37.0 37.0 37.0 37.0 40-44 36.341499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3072 37.0 37.0 37.0 37.0 37.0 50-54 36.288 37.0 37.0 37.0 37.0 37.0 55-59 36.2046 37.0 37.0 37.0 37.0 37.0 60-64 36.227500000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.2241 37.0 37.0 37.0 37.0 37.0 70-74 36.1178 37.0 37.0 37.0 37.0 37.0 75-79 36.1066 37.0 37.0 37.0 37.0 37.0 80-84 36.1573 37.0 37.0 37.0 37.0 37.0 85-89 36.0386 37.0 37.0 37.0 37.0 37.0 90-94 35.9501 37.0 37.0 37.0 37.0 37.0 95-99 35.91179999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.9119 37.0 37.0 37.0 37.0 37.0 105-109 35.8433 37.0 37.0 37.0 37.0 37.0 110-114 35.871399999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.8009 37.0 37.0 37.0 37.0 37.0 120-124 35.6558 37.0 37.0 37.0 37.0 37.0 125-129 35.6803 37.0 37.0 37.0 37.0 37.0 130-134 35.5243 37.0 37.0 37.0 37.0 37.0 135-139 35.4522 37.0 37.0 37.0 37.0 37.0 140-144 35.4562 37.0 37.0 37.0 34.6 37.0 145-149 35.2399 37.0 37.0 37.0 29.8 37.0 150-151 34.67225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 3.0 25 4.0 26 5.0 27 12.0 28 7.0 29 28.0 30 35.0 31 59.0 32 61.0 33 103.0 34 145.0 35 447.0 36 2854.0 37 232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.64908314493846 13.489073097211756 11.630243657372521 38.231600100477266 2 25.900000000000002 19.7 34.825 19.575 3 22.675 24.325 23.35 29.65 4 26.724999999999998 31.900000000000002 19.15 22.225 5 24.9 32.9 21.75 20.45 6 20.275000000000002 32.675 22.825 24.224999999999998 7 17.275 19.625 41.375 21.725 8 20.95 20.0 26.150000000000002 32.9 9 21.875 20.075000000000003 30.225 27.825 10-14 22.67 25.89 24.925 26.515 15-19 23.355 25.564999999999998 25.11 25.97 20-24 23.380000000000003 25.56 24.995 26.064999999999998 25-29 23.805 25.775 24.785 25.635 30-34 23.294999999999998 25.455 25.314999999999998 25.935000000000002 35-39 24.165 24.755 24.75 26.33 40-44 23.765 25.53 24.955 25.75 45-49 23.785 24.89 24.68 26.645000000000003 50-54 24.145 24.59 24.94 26.325 55-59 23.905 25.485000000000003 24.415 26.195 60-64 24.34 24.82 24.805 26.035000000000004 65-69 24.03 25.485000000000003 24.23 26.255 70-74 23.76 25.46 24.58 26.200000000000003 75-79 24.36 25.455 24.345 25.840000000000003 80-84 24.41 25.05 24.52 26.02 85-89 24.22 24.36 24.715 26.705000000000002 90-94 24.09 25.085 24.39 26.435 95-99 24.740000000000002 24.32 24.66 26.279999999999998 100-104 24.66 24.005000000000003 24.54 26.795 105-109 24.925 24.48 23.94 26.655 110-114 25.44 24.16 24.285 26.115 115-119 24.245 24.58 24.77 26.405 120-124 25.655 23.69 24.275 26.38 125-129 24.279999999999998 24.709999999999997 24.224999999999998 26.784999999999997 130-134 25.115 24.505 24.215 26.165 135-139 25.069999999999997 24.57 24.03 26.33 140-144 24.665 24.25 24.455 26.63 145-149 25.040000000000003 23.599999999999998 24.775 26.584999999999997 150-151 24.3875 23.4125 24.837500000000002 27.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 4.0 29 5.5 30 7.0 31 9.5 32 17.0 33 23.0 34 27.0 35 40.0 36 55.5 37 62.5 38 72.0 39 88.0 40 109.0 41 146.5 42 177.0 43 187.0 44 173.5 45 171.5 46 182.5 47 188.5 48 187.5 49 171.5 50 151.5 51 140.0 52 138.0 53 122.5 54 105.0 55 102.5 56 93.0 57 82.0 58 74.5 59 72.0 60 84.5 61 73.5 62 64.0 63 69.5 64 68.0 65 60.5 66 44.5 67 45.0 68 56.5 69 56.0 70 42.5 71 31.5 72 25.5 73 19.5 74 20.5 75 16.5 76 10.5 77 7.5 78 4.0 79 3.5 80 3.0 81 2.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.575 #Duplication Level Percentage of deduplicated Percentage of total 1 95.5793879152498 91.35 2 4.237509809050484 8.1 3 0.15694480774261052 0.44999999999999996 4 0.02615746795710175 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.23750000000000002 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.175 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804197 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804197_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.332 37.0 37.0 37.0 37.0 37.0 2 36.1115 37.0 37.0 37.0 37.0 37.0 3 36.1915 37.0 37.0 37.0 37.0 37.0 4 36.311 37.0 37.0 37.0 37.0 37.0 5 36.3745 37.0 37.0 37.0 37.0 37.0 6 36.2505 37.0 37.0 37.0 37.0 37.0 7 36.196 37.0 37.0 37.0 37.0 37.0 8 36.3035 37.0 37.0 37.0 37.0 37.0 9 36.358 37.0 37.0 37.0 37.0 37.0 10-14 36.194 37.0 37.0 37.0 37.0 37.0 15-19 36.087 37.0 37.0 37.0 37.0 37.0 20-24 36.1156 37.0 37.0 37.0 37.0 37.0 25-29 36.1109 37.0 37.0 37.0 37.0 37.0 30-34 36.054899999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9577 37.0 37.0 37.0 37.0 37.0 40-44 35.934000000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.856500000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8845 37.0 37.0 37.0 37.0 37.0 55-59 35.7873 37.0 37.0 37.0 37.0 37.0 60-64 35.715500000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.6366 37.0 37.0 37.0 37.0 37.0 70-74 35.6189 37.0 37.0 37.0 37.0 37.0 75-79 35.5889 37.0 37.0 37.0 37.0 37.0 80-84 35.5465 37.0 37.0 37.0 37.0 37.0 85-89 35.4114 37.0 37.0 37.0 37.0 37.0 90-94 35.4379 37.0 37.0 37.0 34.6 37.0 95-99 35.332 37.0 37.0 37.0 37.0 37.0 100-104 35.201499999999996 37.0 37.0 37.0 27.4 37.0 105-109 35.1866 37.0 37.0 37.0 29.8 37.0 110-114 35.0413 37.0 37.0 37.0 25.0 37.0 115-119 34.975899999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.9688 37.0 37.0 37.0 25.0 37.0 125-129 34.775 37.0 37.0 37.0 25.0 37.0 130-134 34.8322 37.0 37.0 37.0 25.0 37.0 135-139 34.486399999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.3694 37.0 37.0 37.0 25.0 37.0 145-149 34.3805 37.0 37.0 37.0 25.0 37.0 150-151 33.46275 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 6.0 16 0.0 17 0.0 18 1.0 19 0.0 20 3.0 21 2.0 22 4.0 23 9.0 24 10.0 25 10.0 26 9.0 27 16.0 28 16.0 29 25.0 30 45.0 31 67.0 32 102.0 33 173.0 34 297.0 35 834.0 36 2303.0 37 61.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.949999999999996 11.600000000000001 13.125 39.324999999999996 2 29.875 18.65 31.15 20.325 3 23.525 22.525000000000002 26.224999999999998 27.725 4 28.075 29.7 16.975 25.25 5 28.825 30.45 19.05 21.675 6 21.375 34.849999999999994 18.975 24.8 7 21.2 13.725000000000001 38.800000000000004 26.275 8 23.075000000000003 18.775 22.3 35.85 9 24.025 21.025 24.474999999999998 30.475 10-14 25.66 24.465 22.215 27.66 15-19 26.085 24.12 22.900000000000002 26.895000000000003 20-24 26.3 24.565 22.595000000000002 26.540000000000003 25-29 25.985000000000003 24.455 22.634999999999998 26.924999999999997 30-34 26.705000000000002 24.33 22.705000000000002 26.26 35-39 26.545 24.535 23.125 25.795 40-44 26.939999999999998 24.240000000000002 22.85 25.97 45-49 26.99 23.895 22.895 26.22 50-54 26.745 24.145 22.615 26.495 55-59 26.655 24.060000000000002 22.81 26.474999999999998 60-64 26.090000000000003 23.990000000000002 23.26 26.66 65-69 26.995 23.34 23.225 26.44 70-74 26.3 23.24 23.735 26.724999999999998 75-79 26.8 23.544999999999998 23.31 26.345000000000002 80-84 27.0 24.295 22.88 25.825 85-89 26.99 23.919999999999998 23.275000000000002 25.814999999999998 90-94 26.69 24.21 23.015 26.085 95-99 26.919999999999998 24.935 22.264999999999997 25.88 100-104 26.77 23.990000000000002 23.205000000000002 26.035000000000004 105-109 26.875 24.03 23.375 25.72 110-114 27.04 24.82 22.585 25.555 115-119 27.034999999999997 24.07 23.23 25.665 120-124 26.375 23.849999999999998 23.465 26.31 125-129 26.724999999999998 24.13 23.635 25.509999999999998 130-134 27.455000000000002 24.44 23.400000000000002 24.705 135-139 26.93 24.5 23.400000000000002 25.169999999999998 140-144 27.47 25.165 22.655 24.709999999999997 145-149 27.205000000000002 24.435000000000002 23.59 24.77 150-151 27.487499999999997 24.6625 22.5 25.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 1.0 26 1.5 27 1.5 28 1.5 29 2.5 30 6.5 31 10.0 32 11.0 33 13.5 34 17.0 35 20.0 36 30.5 37 45.0 38 59.0 39 77.5 40 94.5 41 100.5 42 114.0 43 129.5 44 146.0 45 164.0 46 161.5 47 155.5 48 152.0 49 140.0 50 134.0 51 140.0 52 120.0 53 110.0 54 118.0 55 102.5 56 90.5 57 93.0 58 102.5 59 111.5 60 101.5 61 90.5 62 87.5 63 77.0 64 82.5 65 84.5 66 74.5 67 75.5 68 83.0 69 91.5 70 73.5 71 52.0 72 53.0 73 53.5 74 38.0 75 28.0 76 20.5 77 12.0 78 10.5 79 5.5 80 3.5 81 2.5 82 2.0 83 1.0 84 2.0 85 1.5 86 0.5 87 1.5 88 1.0 89 0.0 90 0.0 91 1.0 92 1.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.02500658067913 90.25 2 4.711766254277442 8.95 3 0.21058173203474598 0.6 4 0.052645433008686494 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.23750000000000002 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.2625000000000002 0.0 0.0 0.0 0.0 138-139 1.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCGCT 10 0.006830828 145.0 1 >>END_MODULE Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142936 spots for SRR7804197.sra Written 2142936 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra Read 2142918 spots for SRR7804197.sra Written 2142918 spots for SRR7804197.sra SRR ids: ['SRR7804197.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4c58kj6g SRR7804197.sra spots: 42858378 blocks: [[1, 2142918], [2142919, 4285836], [4285837, 6428754], [6428755, 8571672], [8571673, 10714590], [10714591, 12857508], [12857509, 15000426], [15000427, 17143344], [17143345, 19286262], [19286263, 21429180], [21429181, 23572098], [23572099, 25715016], [25715017, 27857934], [27857935, 30000852], [30000853, 32143770], [32143771, 34286688], [34286689, 36429606], [36429607, 38572524], [38572525, 40715442], [40715443, 42858378]] SRR7804197 file size 14501597 SRR7804197 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804197 SRR7804197_1.fastq SRR7804197_2.fastq Input file: SRR7804197_1.fastq Paired file: SRR7804197_2.fastq trimmed: SRR7804197-trimmed-pair1.fastq, SRR7804197-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:22:14 2024 >> started Tue Dec 10 04:23:08 2024 >> done (54.067s) 42858378 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 870 ( 0.00%) empty read pairs filtered out after trimming by size control 42857403 (100.00%) read pairs available; of these: 987276 ( 2.30%) trimmed read pairs available after processing 41870127 (97.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 17 0.00% 20 21 0.00% 21 19 0.00% 22 21 0.00% 23 27 0.00% 24 33 0.00% 25 32 0.00% 26 37 0.00% 27 43 0.00% 28 35 0.00% 29 45 0.00% 30 49 0.00% 31 48 0.00% 32 56 0.00% 33 66 0.00% 34 63 0.00% 35 65 0.00% 36 75 0.00% 37 56 0.00% 38 72 0.00% 39 71 0.00% 40 62 0.00% 41 68 0.00% 42 76 0.00% 43 93 0.00% 44 69 0.00% 45 76 0.00% 46 73 0.00% 47 84 0.00% 48 86 0.00% 49 86 0.00% 50 97 0.00% 51 92 0.00% 52 118 0.00% 53 114 0.00% 54 93 0.00% 55 117 0.00% 56 144 0.00% 57 139 0.00% 58 110 0.00% 59 103 0.00% 60 141 0.00% 61 138 0.00% 62 140 0.00% 63 151 0.00% 64 165 0.00% 65 132 0.00% 66 154 0.00% 67 147 0.00% 68 178 0.00% 69 186 0.00% 70 218 0.00% 71 212 0.00% 72 256 0.00% 73 258 0.00% 74 289 0.00% 75 319 0.00% 76 328 0.00% 77 325 0.00% 78 372 0.00% 79 407 0.00% 80 459 0.00% 81 525 0.00% 82 614 0.00% 83 617 0.00% 84 735 0.00% 85 821 0.00% 86 907 0.00% 87 947 0.00% 88 1102 0.00% 89 1107 0.00% 90 1229 0.00% 91 1380 0.00% 92 1589 0.00% 93 1856 0.00% 94 2045 0.00% 95 2161 0.01% 96 2453 0.01% 97 2696 0.01% 98 2816 0.01% 99 3035 0.01% 100 3440 0.01% 101 3705 0.01% 102 3911 0.01% 103 4297 0.01% 104 4634 0.01% 105 5126 0.01% 106 5513 0.01% 107 5895 0.01% 108 6042 0.01% 109 6669 0.02% 110 6923 0.02% 111 7277 0.02% 112 8039 0.02% 113 8674 0.02% 114 9297 0.02% 115 9972 0.02% 116 10240 0.02% 117 10629 0.02% 118 11382 0.03% 119 11772 0.03% 120 12285 0.03% 121 13043 0.03% 122 14092 0.03% 123 14747 0.03% 124 15844 0.04% 125 16666 0.04% 126 17345 0.04% 127 17947 0.04% 128 18547 0.04% 129 19058 0.04% 130 20100 0.05% 131 20922 0.05% 132 21707 0.05% 133 22970 0.05% 134 24123 0.06% 135 25420 0.06% 136 26450 0.06% 137 27513 0.06% 138 28235 0.07% 139 29354 0.07% 140 30424 0.07% 141 31154 0.07% 142 32283 0.08% 143 33596 0.08% 144 34753 0.08% 145 36836 0.09% 146 37311 0.09% 147 39549 0.09% 148 40707 0.09% 149 41570 0.10% 150 42809 0.10% 151 41870127 97.70% 42857403 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=28 prefix-density=0.53 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=14.94 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.8 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=19 prefix-density=0.60 prefix-fanout=2.9 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=36.76 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.9 sequence=AGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804197 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:24:20 Started mapping on | Dec 10 04:24:20 Finished on | Dec 10 04:30:41 Mapping speed, Million of reads per hour | 404.95 Number of input reads | 42857403 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 40731991 Uniquely mapped reads % | 95.04% Average mapped length | 300.15 Number of splices: Total | 43231313 Number of splices: Annotated (sjdb) | 40725089 Number of splices: GT/AG | 42638098 Number of splices: GC/AG | 518391 Number of splices: AT/AC | 21428 Number of splices: Non-canonical | 53396 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 423064 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 24636 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1702348 1702348 1702348 N_multimapping 423064 423064 423064 N_noFeature 1109032 39533840 1407847 N_ambiguous 1088335 6539 189194 UnstrandedReadsAssigned:38534624 PositiveStrandReadsAssigned:1191612 NegativeStrandReadsAssigned:39134950 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804197 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804197-trimmed-pair1.fastq SRR7804197-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,857,403 reads, 39,401,479 reads pseudoaligned [quant] estimated average fragment length: 332.14 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR7804197.ke.tsv 35125 SRR7804197.se.tsv 88098 total ==> SRR7804197.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 606.073 0 0 PNS24247 1044 712.86 108.052 4.86467 PNS24249 1928 1596.86 239.698 4.81752 PNS24246 1044 712.86 108.052 4.86467 PNS24248 1044 712.86 108.052 4.86467 PNS24244 1471 1139.86 215.146 6.05769 PNS24243 293 69.8148 0 0 KQK14069 1603 1271.86 1276.83 32.2195 KQK14071 474 187.918 13.3209 2.27504 ==> SRR7804197.se.tsv <== BRADI_1g14170v3 1365 BRADI_1g53295v3 416 BRADI_1g59795v3 1477 BRADI_1g07683v3 0 BRADI_1g00485v3 84 BRADI_1g20270v3 4893 BRADI_1g74790v3 850 BRADI_1g09890v3 19 BRADI_1g77505v3 625 BRADI_1g48960v3 0 SRR7804197 completed mapping pipeline successfully