Starting /dee2/code/volunteer_pipeline.sh SRR7804198 current disk space = 1526115037184 free memory = 1556747040 SRR7804198 SRAfilesize 8031bb30cd471e814bb4da1fe401f2b8 SRR7804198.sra SRR7804198.sra file validated SRR7804198 is paired end SRR7804198 is conventional basespace SRR7804198 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804198_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.078 37.0 37.0 37.0 37.0 37.0 2 36.209 37.0 37.0 37.0 37.0 37.0 3 36.3985 37.0 37.0 37.0 37.0 37.0 4 36.451 37.0 37.0 37.0 37.0 37.0 5 36.4285 37.0 37.0 37.0 37.0 37.0 6 36.6055 37.0 37.0 37.0 37.0 37.0 7 36.363 37.0 37.0 37.0 37.0 37.0 8 36.4805 37.0 37.0 37.0 37.0 37.0 9 36.468 37.0 37.0 37.0 37.0 37.0 10-14 36.5158 37.0 37.0 37.0 37.0 37.0 15-19 36.4884 37.0 37.0 37.0 37.0 37.0 20-24 36.4283 37.0 37.0 37.0 37.0 37.0 25-29 36.4347 37.0 37.0 37.0 37.0 37.0 30-34 36.339099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.3154 37.0 37.0 37.0 37.0 37.0 40-44 36.3168 37.0 37.0 37.0 37.0 37.0 45-49 36.2294 37.0 37.0 37.0 37.0 37.0 50-54 36.2476 37.0 37.0 37.0 37.0 37.0 55-59 36.0952 37.0 37.0 37.0 37.0 37.0 60-64 36.1199 37.0 37.0 37.0 37.0 37.0 65-69 36.0933 37.0 37.0 37.0 37.0 37.0 70-74 36.067099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.074799999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.063300000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.9447 37.0 37.0 37.0 37.0 37.0 90-94 35.9306 37.0 37.0 37.0 37.0 37.0 95-99 35.7843 37.0 37.0 37.0 37.0 37.0 100-104 35.7568 37.0 37.0 37.0 37.0 37.0 105-109 35.7877 37.0 37.0 37.0 37.0 37.0 110-114 35.77810000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.6398 37.0 37.0 37.0 37.0 37.0 120-124 35.478899999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.569599999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.40169999999999 37.0 37.0 37.0 34.6 37.0 135-139 35.327600000000004 37.0 37.0 37.0 32.2 37.0 140-144 35.2667 37.0 37.0 37.0 29.8 37.0 145-149 35.082 37.0 37.0 37.0 27.4 37.0 150-151 34.454499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 5.0 25 6.0 26 7.0 27 17.0 28 23.0 29 30.0 30 45.0 31 42.0 32 68.0 33 110.0 34 190.0 35 449.0 36 2740.0 37 263.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.101405622489956 12.374497991967871 8.910642570281125 34.61345381526104 2 25.825 17.4 33.975 22.8 3 23.674999999999997 23.7 24.0 28.625 4 28.000000000000004 29.849999999999998 19.3 22.85 5 26.125 31.374999999999996 21.875 20.625 6 20.825 32.25 22.5 24.425 7 17.424999999999997 21.4 39.525 21.65 8 20.349999999999998 20.150000000000002 27.400000000000002 32.1 9 21.325 18.475 30.3 29.9 10-14 23.87 25.285000000000004 24.285 26.56 15-19 24.465 24.385 24.610000000000003 26.540000000000003 20-24 24.435000000000002 24.535 24.740000000000002 26.290000000000003 25-29 24.785 24.005000000000003 24.45 26.76 30-34 24.345 25.019999999999996 23.82 26.815 35-39 24.645 24.240000000000002 24.04 27.075 40-44 24.805 24.345 24.265 26.584999999999997 45-49 24.37 24.44 24.395 26.795 50-54 24.79 24.15 23.655 27.405 55-59 24.990000000000002 24.33 24.4 26.279999999999998 60-64 25.25 23.57 24.245 26.935 65-69 25.569999999999997 24.27 23.39 26.77 70-74 25.509999999999998 23.72 24.18 26.590000000000003 75-79 25.75 23.580000000000002 23.65 27.02 80-84 25.595000000000002 23.64 23.955000000000002 26.810000000000002 85-89 24.855 23.815 24.02 27.310000000000002 90-94 26.05 23.235 23.53 27.185 95-99 25.785000000000004 23.26 23.805 27.150000000000002 100-104 26.235000000000003 23.35 23.465 26.950000000000003 105-109 25.835 23.48 23.715 26.97 110-114 25.064999999999998 23.53 23.785 27.62 115-119 25.775 23.035 23.674999999999997 27.515 120-124 26.450000000000003 23.34 23.580000000000002 26.63 125-129 25.71 22.78 24.560000000000002 26.950000000000003 130-134 26.07 23.315 23.09 27.525 135-139 26.284999999999997 23.175 23.485 27.055 140-144 26.229999999999997 22.985 23.565 27.22 145-149 26.634999999999998 23.189999999999998 23.494999999999997 26.68 150-151 26.875 22.037499999999998 24.075 27.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 2.0 27 2.0 28 3.5 29 2.0 30 3.0 31 7.5 32 14.5 33 23.5 34 32.5 35 35.0 36 36.5 37 56.0 38 75.0 39 83.5 40 101.0 41 134.0 42 143.0 43 130.5 44 135.5 45 153.5 46 166.0 47 162.0 48 151.0 49 144.5 50 135.0 51 129.0 52 134.5 53 119.0 54 99.5 55 106.5 56 103.5 57 92.0 58 94.5 59 108.5 60 111.0 61 98.0 62 88.0 63 76.5 64 81.5 65 78.5 66 69.5 67 78.0 68 72.0 69 60.0 70 53.0 71 41.5 72 37.5 73 32.0 74 24.5 75 23.5 76 16.0 77 10.0 78 10.0 79 7.0 80 3.5 81 2.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.75 #Duplication Level Percentage of deduplicated Percentage of total 1 94.64379947229553 89.67500000000001 2 5.171503957783641 9.8 3 0.18469656992084432 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.30000000000000004 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2625 0.0 0.0 0.0 0.0 138-139 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804198 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804198_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3375 37.0 37.0 37.0 37.0 37.0 2 36.1845 37.0 37.0 37.0 37.0 37.0 3 36.148 37.0 37.0 37.0 37.0 37.0 4 36.189 37.0 37.0 37.0 37.0 37.0 5 36.241 37.0 37.0 37.0 37.0 37.0 6 36.0825 37.0 37.0 37.0 37.0 37.0 7 36.1855 37.0 37.0 37.0 37.0 37.0 8 36.1915 37.0 37.0 37.0 37.0 37.0 9 36.2035 37.0 37.0 37.0 37.0 37.0 10-14 36.1734 37.0 37.0 37.0 37.0 37.0 15-19 36.131600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.104200000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.0184 37.0 37.0 37.0 37.0 37.0 30-34 35.9705 37.0 37.0 37.0 37.0 37.0 35-39 35.9413 37.0 37.0 37.0 37.0 37.0 40-44 35.8914 37.0 37.0 37.0 37.0 37.0 45-49 35.8322 37.0 37.0 37.0 37.0 37.0 50-54 35.8659 37.0 37.0 37.0 37.0 37.0 55-59 35.77329999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.6602 37.0 37.0 37.0 37.0 37.0 65-69 35.6802 37.0 37.0 37.0 37.0 37.0 70-74 35.6364 37.0 37.0 37.0 37.0 37.0 75-79 35.6341 37.0 37.0 37.0 37.0 37.0 80-84 35.5244 37.0 37.0 37.0 37.0 37.0 85-89 35.4106 37.0 37.0 37.0 37.0 37.0 90-94 35.448800000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.3591 37.0 37.0 37.0 37.0 37.0 100-104 35.3335 37.0 37.0 37.0 34.6 37.0 105-109 35.1916 37.0 37.0 37.0 29.8 37.0 110-114 35.13719999999999 37.0 37.0 37.0 25.0 37.0 115-119 35.07190000000001 37.0 37.0 37.0 25.0 37.0 120-124 34.952600000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.9318 37.0 37.0 37.0 25.0 37.0 130-134 34.8524 37.0 37.0 37.0 25.0 37.0 135-139 34.5633 37.0 37.0 37.0 25.0 37.0 140-144 34.4573 37.0 37.0 37.0 25.0 37.0 145-149 34.395 37.0 37.0 37.0 25.0 37.0 150-151 33.72725 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 6.0 15 5.0 16 3.0 17 3.0 18 3.0 19 5.0 20 1.0 21 12.0 22 9.0 23 6.0 24 4.0 25 8.0 26 15.0 27 19.0 28 15.0 29 34.0 30 40.0 31 53.0 32 79.0 33 126.0 34 253.0 35 753.0 36 2443.0 37 100.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.525 14.099999999999998 10.674999999999999 34.699999999999996 2 30.275000000000002 19.15 28.15 22.425 3 25.275 22.900000000000002 25.624999999999996 26.200000000000003 4 28.575 30.425 16.575 24.425 5 28.775000000000002 31.825 17.075000000000003 22.325 6 21.625 33.25 19.025 26.1 7 22.425 15.6 34.775 27.200000000000003 8 23.875 19.225 21.125 35.775 9 24.825 20.5 22.625 32.05 10-14 26.334999999999997 24.29 21.72 27.655 15-19 26.565 24.310000000000002 21.88 27.245 20-24 27.529999999999998 23.5 21.47 27.500000000000004 25-29 26.479999999999997 24.18 21.605 27.735 30-34 27.43 23.65 22.0 26.919999999999998 35-39 26.715 23.549999999999997 21.64 28.095 40-44 27.22 23.935000000000002 21.584999999999997 27.26 45-49 27.32 23.474999999999998 21.86 27.345000000000002 50-54 26.765 23.71 21.745 27.779999999999998 55-59 27.639999999999997 22.96 21.785 27.615000000000002 60-64 27.21 23.115 21.47 28.205000000000002 65-69 26.645000000000003 22.945 22.470000000000002 27.939999999999998 70-74 27.384999999999998 23.105 22.14 27.37 75-79 27.215 23.1 21.86 27.825 80-84 26.875 23.685000000000002 21.87 27.57 85-89 27.365000000000002 23.69 22.185 26.76 90-94 27.36 23.325000000000003 22.035 27.279999999999998 95-99 27.200000000000003 23.810000000000002 21.98 27.01 100-104 27.27 23.36 21.959999999999997 27.41 105-109 27.605 23.39 21.81 27.195000000000004 110-114 27.615000000000002 23.69 21.785 26.91 115-119 27.305 23.875 21.790000000000003 27.029999999999998 120-124 27.200000000000003 23.835 22.16 26.805 125-129 27.525 23.580000000000002 22.065 26.83 130-134 28.084999999999997 23.169999999999998 22.125 26.619999999999997 135-139 27.595 23.84 21.834999999999997 26.729999999999997 140-144 28.49 22.99 22.52 26.0 145-149 27.66 24.38 22.005 25.955000000000002 150-151 27.6 24.224999999999998 21.4375 26.737499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 1.0 7 1.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 2.0 27 2.5 28 2.0 29 4.5 30 4.0 31 4.5 32 6.0 33 7.5 34 9.5 35 15.0 36 26.0 37 38.5 38 47.0 39 54.0 40 69.5 41 90.5 42 106.0 43 118.5 44 124.0 45 126.0 46 137.0 47 145.5 48 141.5 49 127.5 50 119.0 51 115.5 52 111.5 53 121.5 54 109.0 55 91.0 56 101.5 57 110.0 58 102.0 59 102.0 60 118.5 61 111.0 62 115.5 63 119.0 64 99.0 65 100.5 66 100.5 67 96.0 68 89.0 69 93.5 70 99.0 71 74.5 72 62.5 73 56.5 74 39.0 75 25.5 76 23.5 77 18.5 78 10.5 79 9.0 80 5.5 81 4.0 82 6.0 83 4.0 84 1.5 85 1.0 86 0.0 87 1.5 88 1.5 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.10980810234541 88.275 2 5.383795309168443 10.100000000000001 3 0.39978678038379534 1.125 4 0.053304904051172705 0.2 5 0.0 0.0 6 0.053304904051172705 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0125 0.0 0.0 0.0 0.025 80-81 0.037500000000000006 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.075 0.0 0.0 0.0 0.025 88-89 0.075 0.0 0.0 0.0 0.025 90-91 0.1 0.0 0.0 0.0 0.025 92-93 0.1 0.0 0.0 0.0 0.025 94-95 0.1125 0.0 0.0 0.0 0.025 96-97 0.15 0.0 0.0 0.0 0.025 98-99 0.15 0.0 0.0 0.0 0.025 100-101 0.15 0.0 0.0 0.0 0.025 102-103 0.175 0.0 0.0 0.0 0.025 104-105 0.175 0.0 0.0 0.0 0.025 106-107 0.175 0.0 0.0 0.0 0.025 108-109 0.175 0.0 0.0 0.0 0.025 110-111 0.1875 0.0 0.0 0.0 0.025 112-113 0.225 0.0 0.0 0.0 0.025 114-115 0.275 0.0 0.0 0.0 0.025 116-117 0.30000000000000004 0.0 0.0 0.0 0.025 118-119 0.3375 0.0 0.0 0.0 0.025 120-121 0.375 0.0 0.0 0.0 0.025 122-123 0.525 0.0 0.0 0.0 0.025 124-125 0.625 0.0 0.0 0.0 0.025 126-127 0.7 0.0 0.0 0.0 0.025 128-129 0.775 0.0 0.0 0.0 0.025 130-131 0.9125 0.0 0.0 0.0 0.025 132-133 1.0499999999999998 0.0 0.0 0.0 0.025 134-135 1.125 0.0 0.0 0.0 0.025 136-137 1.2375 0.0 0.0 0.0 0.025 138-139 1.425 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCTCA 10 0.006830828 145.0 3 TCATCTC 10 0.006830828 145.0 8 TTTAATG 10 0.006830828 145.0 3 >>END_MODULE Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207177 spots for SRR7804198.sra Written 2207177 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra Read 2207161 spots for SRR7804198.sra Written 2207161 spots for SRR7804198.sra SRR ids: ['SRR7804198.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2pwntjbx SRR7804198.sra spots: 44143236 blocks: [[1, 2207161], [2207162, 4414322], [4414323, 6621483], [6621484, 8828644], [8828645, 11035805], [11035806, 13242966], [13242967, 15450127], [15450128, 17657288], [17657289, 19864449], [19864450, 22071610], [22071611, 24278771], [24278772, 26485932], [26485933, 28693093], [28693094, 30900254], [30900255, 33107415], [33107416, 35314576], [35314577, 37521737], [37521738, 39728898], [39728899, 41936059], [41936060, 44143236]] SRR7804198 file size 14936993 SRR7804198 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804198 SRR7804198_1.fastq SRR7804198_2.fastq Input file: SRR7804198_1.fastq Paired file: SRR7804198_2.fastq trimmed: SRR7804198-trimmed-pair1.fastq, SRR7804198-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:57:11 2024 >> started Tue Dec 10 03:58:06 2024 >> done (55.257s) 44143236 read pairs processed; of these: 88 ( 0.00%) short read pairs filtered out after trimming by size control 1364 ( 0.00%) empty read pairs filtered out after trimming by size control 44141784 (100.00%) read pairs available; of these: 1148018 ( 2.60%) trimmed read pairs available after processing 42993766 (97.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 15 0.00% 20 29 0.00% 21 25 0.00% 22 29 0.00% 23 25 0.00% 24 29 0.00% 25 32 0.00% 26 35 0.00% 27 37 0.00% 28 41 0.00% 29 41 0.00% 30 33 0.00% 31 41 0.00% 32 64 0.00% 33 53 0.00% 34 52 0.00% 35 65 0.00% 36 64 0.00% 37 58 0.00% 38 75 0.00% 39 71 0.00% 40 69 0.00% 41 57 0.00% 42 68 0.00% 43 73 0.00% 44 77 0.00% 45 67 0.00% 46 80 0.00% 47 77 0.00% 48 73 0.00% 49 99 0.00% 50 112 0.00% 51 92 0.00% 52 95 0.00% 53 109 0.00% 54 104 0.00% 55 112 0.00% 56 102 0.00% 57 97 0.00% 58 105 0.00% 59 111 0.00% 60 138 0.00% 61 131 0.00% 62 143 0.00% 63 147 0.00% 64 133 0.00% 65 175 0.00% 66 155 0.00% 67 144 0.00% 68 173 0.00% 69 142 0.00% 70 206 0.00% 71 208 0.00% 72 245 0.00% 73 274 0.00% 74 272 0.00% 75 302 0.00% 76 346 0.00% 77 355 0.00% 78 374 0.00% 79 430 0.00% 80 446 0.00% 81 530 0.00% 82 564 0.00% 83 613 0.00% 84 748 0.00% 85 883 0.00% 86 913 0.00% 87 1045 0.00% 88 1097 0.00% 89 1284 0.00% 90 1363 0.00% 91 1527 0.00% 92 1776 0.00% 93 2005 0.00% 94 2304 0.01% 95 2440 0.01% 96 2653 0.01% 97 2941 0.01% 98 3151 0.01% 99 3453 0.01% 100 3891 0.01% 101 4071 0.01% 102 4442 0.01% 103 4971 0.01% 104 5372 0.01% 105 5725 0.01% 106 6416 0.01% 107 6567 0.01% 108 7205 0.02% 109 7650 0.02% 110 8051 0.02% 111 8680 0.02% 112 9422 0.02% 113 9777 0.02% 114 10698 0.02% 115 11425 0.03% 116 12128 0.03% 117 12587 0.03% 118 13110 0.03% 119 13758 0.03% 120 14444 0.03% 121 15398 0.03% 122 16183 0.04% 123 17282 0.04% 124 18144 0.04% 125 19532 0.04% 126 20058 0.05% 127 20945 0.05% 128 21439 0.05% 129 22391 0.05% 130 23535 0.05% 131 24192 0.05% 132 25814 0.06% 133 27209 0.06% 134 28466 0.06% 135 30324 0.07% 136 31351 0.07% 137 31673 0.07% 138 33179 0.08% 139 34337 0.08% 140 34918 0.08% 141 35958 0.08% 142 37296 0.08% 143 38882 0.09% 144 41175 0.09% 145 42780 0.10% 146 44469 0.10% 147 46030 0.10% 148 47569 0.11% 149 48534 0.11% 150 49635 0.11% 151 42993766 97.40% 44141784 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=28 prefix-density=0.95 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.39 sequence-density-rank=17 fanout-score=6.95 fanout-score-rank=1 prefix-density=1.56 prefix-fanout=1.7 sequence=CCGAACATGGGAAGCTTCCACAT criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=11 prefix-density=1.02 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=146.76 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=9.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804198 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 03:59:05 Started mapping on | Dec 10 03:59:05 Finished on | Dec 10 04:06:41 Mapping speed, Million of reads per hour | 348.49 Number of input reads | 44141784 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 40833927 Uniquely mapped reads % | 92.51% Average mapped length | 300.03 Number of splices: Total | 41972284 Number of splices: Annotated (sjdb) | 39805452 Number of splices: GT/AG | 41413822 Number of splices: GC/AG | 491389 Number of splices: AT/AC | 17903 Number of splices: Non-canonical | 49170 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.56 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484003 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 43087 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.54% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2823854 2823854 2823854 N_multimapping 484003 484003 484003 N_noFeature 854122 39706153 1101330 N_ambiguous 1085559 5462 206069 UnstrandedReadsAssigned:38894246 PositiveStrandReadsAssigned:1122312 NegativeStrandReadsAssigned:39526528 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804198 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804198-trimmed-pair1.fastq SRR7804198-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,141,784 reads, 40,103,843 reads pseudoaligned [quant] estimated average fragment length: 325.001 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR7804198.ke.tsv 35125 SRR7804198.se.tsv 88098 total ==> SRR7804198.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 612.923 0 0 PNS24247 1044 719.999 65.9308 2.73419 PNS24249 1928 1604 229.018 4.26322 PNS24246 1044 719.999 65.9308 2.73419 PNS24248 1044 719.999 65.9308 2.73419 PNS24244 1471 1147 101.19 2.63419 PNS24243 293 72.1419 0 0 KQK14069 1603 1279 791.216 18.4713 KQK14071 474 191.705 20.0809 3.12769 ==> SRR7804198.se.tsv <== BRADI_1g14170v3 845 BRADI_1g53295v3 140 BRADI_1g59795v3 858 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 5710 BRADI_1g74790v3 287 BRADI_1g09890v3 22 BRADI_1g77505v3 619 BRADI_1g48960v3 2 SRR7804198 completed mapping pipeline successfully