Starting /dee2/code/volunteer_pipeline.sh SRR7804199 current disk space = 1526077526016 free memory = 1599200640 SRR7804199 SRAfilesize b1a13d8bf32ead20b83698bd41814343 SRR7804199.sra SRR7804199.sra file validated SRR7804199 is paired end SRR7804199 is conventional basespace SRR7804199 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804199_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.12775 37.0 37.0 37.0 37.0 37.0 2 36.3215 37.0 37.0 37.0 37.0 37.0 3 36.3855 37.0 37.0 37.0 37.0 37.0 4 36.461 37.0 37.0 37.0 37.0 37.0 5 36.5035 37.0 37.0 37.0 37.0 37.0 6 36.461 37.0 37.0 37.0 37.0 37.0 7 36.2805 37.0 37.0 37.0 37.0 37.0 8 36.493 37.0 37.0 37.0 37.0 37.0 9 36.3675 37.0 37.0 37.0 37.0 37.0 10-14 36.4731 37.0 37.0 37.0 37.0 37.0 15-19 36.4375 37.0 37.0 37.0 37.0 37.0 20-24 36.4417 37.0 37.0 37.0 37.0 37.0 25-29 36.369899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3928 37.0 37.0 37.0 37.0 37.0 35-39 36.3786 37.0 37.0 37.0 37.0 37.0 40-44 36.3258 37.0 37.0 37.0 37.0 37.0 45-49 36.26610000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.2307 37.0 37.0 37.0 37.0 37.0 55-59 36.1632 37.0 37.0 37.0 37.0 37.0 60-64 36.202000000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.1905 37.0 37.0 37.0 37.0 37.0 70-74 36.049099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.07339999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0758 37.0 37.0 37.0 37.0 37.0 85-89 35.9878 37.0 37.0 37.0 37.0 37.0 90-94 35.9403 37.0 37.0 37.0 37.0 37.0 95-99 35.8618 37.0 37.0 37.0 37.0 37.0 100-104 35.856100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.7551 37.0 37.0 37.0 37.0 37.0 110-114 35.8197 37.0 37.0 37.0 37.0 37.0 115-119 35.692899999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.5989 37.0 37.0 37.0 37.0 37.0 125-129 35.6173 37.0 37.0 37.0 37.0 37.0 130-134 35.448 37.0 37.0 37.0 37.0 37.0 135-139 35.3999 37.0 37.0 37.0 37.0 37.0 140-144 35.417500000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.1887 37.0 37.0 37.0 29.8 37.0 150-151 34.50325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 2.0 25 5.0 26 9.0 27 7.0 28 16.0 29 31.0 30 48.0 31 45.0 32 77.0 33 109.0 34 174.0 35 439.0 36 2802.0 37 234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1326146903986 13.96339934820757 9.827024316871396 37.07696164452244 2 24.375 19.0 35.625 21.0 3 21.099999999999998 26.075 24.099999999999998 28.725 4 26.174999999999997 31.65 21.2 20.974999999999998 5 25.624999999999996 33.050000000000004 21.4 19.925 6 20.974999999999998 33.550000000000004 22.175 23.3 7 15.725 20.4 42.325 21.55 8 20.549999999999997 20.724999999999998 26.35 32.375 9 20.8 20.275000000000002 30.275000000000002 28.65 10-14 23.5 26.025 24.795 25.679999999999996 15-19 23.630000000000003 25.480000000000004 24.785 26.105 20-24 23.45 25.005 25.61 25.935000000000002 25-29 22.91 26.224999999999998 24.595 26.27 30-34 23.875 24.93 25.855 25.34 35-39 23.119999999999997 25.5 25.255 26.125 40-44 23.5 25.624999999999996 25.275 25.6 45-49 23.275000000000002 25.430000000000003 25.474999999999998 25.82 50-54 23.285 25.4 24.759999999999998 26.555 55-59 23.674999999999997 25.405 24.72 26.200000000000003 60-64 23.7 24.745 25.16 26.395000000000003 65-69 24.41 25.014999999999997 25.03 25.545 70-74 23.98 25.5 24.87 25.650000000000002 75-79 23.73 25.205 25.06 26.005 80-84 24.18 24.985 24.745 26.090000000000003 85-89 23.855 25.595000000000002 24.279999999999998 26.27 90-94 23.474999999999998 25.775 24.22 26.529999999999998 95-99 23.96 24.68 25.240000000000002 26.119999999999997 100-104 23.825 24.365000000000002 25.724999999999998 26.085 105-109 24.27 25.09 24.275 26.365 110-114 23.65 24.654999999999998 24.62 27.075 115-119 24.34 24.75 24.75 26.16 120-124 24.490000000000002 24.15 25.0 26.36 125-129 24.79 25.2 24.435000000000002 25.575 130-134 24.88 24.09 25.014999999999997 26.015 135-139 24.44 24.610000000000003 24.185000000000002 26.765 140-144 24.41 24.485 24.755 26.35 145-149 24.59 24.154999999999998 24.975 26.279999999999998 150-151 25.05 24.05 24.837500000000002 26.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 3.0 27 2.5 28 2.0 29 4.0 30 5.5 31 10.5 32 14.5 33 21.0 34 32.0 35 46.5 36 59.5 37 63.0 38 77.0 39 96.5 40 119.5 41 146.0 42 186.5 43 198.5 44 174.5 45 171.0 46 185.0 47 192.0 48 176.0 49 170.5 50 165.0 51 144.0 52 134.5 53 123.0 54 99.5 55 90.0 56 96.0 57 86.5 58 81.0 59 85.5 60 75.5 61 72.0 62 67.5 63 61.5 64 59.0 65 51.5 66 50.0 67 49.0 68 49.5 69 41.0 70 27.0 71 27.5 72 23.0 73 20.0 74 18.5 75 13.5 76 10.0 77 4.5 78 5.0 79 4.5 80 1.5 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.96143824908808 92.07499999999999 2 3.8561750911933297 7.3999999999999995 3 0.18238665971860343 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0125 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.07500000000000001 0.0 0.0 0.0 0.0125 108-109 0.1 0.0 0.0 0.0 0.025 110-111 0.1 0.0 0.0 0.0 0.025 112-113 0.1125 0.0 0.0 0.0 0.025 114-115 0.1375 0.0 0.0 0.0 0.025 116-117 0.175 0.0 0.0 0.0 0.025 118-119 0.225 0.0 0.0 0.0 0.025 120-121 0.25 0.0 0.0 0.0 0.025 122-123 0.2625 0.0 0.0 0.0 0.025 124-125 0.30000000000000004 0.0 0.0 0.0 0.025 126-127 0.3375 0.0 0.0 0.0 0.025 128-129 0.4375 0.0 0.0 0.0 0.025 130-131 0.5875 0.0 0.0 0.0 0.025 132-133 0.7 0.0 0.0 0.0 0.025 134-135 0.75 0.0 0.0 0.0 0.025 136-137 0.85 0.0 0.0 0.0 0.025 138-139 0.8875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804199 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804199_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4885 37.0 37.0 37.0 37.0 37.0 2 36.2355 37.0 37.0 37.0 37.0 37.0 3 36.335 37.0 37.0 37.0 37.0 37.0 4 36.398 37.0 37.0 37.0 37.0 37.0 5 36.397 37.0 37.0 37.0 37.0 37.0 6 36.304 37.0 37.0 37.0 37.0 37.0 7 36.297 37.0 37.0 37.0 37.0 37.0 8 36.371 37.0 37.0 37.0 37.0 37.0 9 36.393 37.0 37.0 37.0 37.0 37.0 10-14 36.3456 37.0 37.0 37.0 37.0 37.0 15-19 36.2405 37.0 37.0 37.0 37.0 37.0 20-24 36.2372 37.0 37.0 37.0 37.0 37.0 25-29 36.1942 37.0 37.0 37.0 37.0 37.0 30-34 36.185199999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0795 37.0 37.0 37.0 37.0 37.0 40-44 36.0943 37.0 37.0 37.0 37.0 37.0 45-49 36.00500000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.0267 37.0 37.0 37.0 37.0 37.0 55-59 36.009699999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.86110000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.8578 37.0 37.0 37.0 37.0 37.0 70-74 35.8617 37.0 37.0 37.0 37.0 37.0 75-79 35.8433 37.0 37.0 37.0 37.0 37.0 80-84 35.8394 37.0 37.0 37.0 37.0 37.0 85-89 35.6529 37.0 37.0 37.0 37.0 37.0 90-94 35.581599999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.607099999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.4948 37.0 37.0 37.0 37.0 37.0 105-109 35.4865 37.0 37.0 37.0 37.0 37.0 110-114 35.3519 37.0 37.0 37.0 34.6 37.0 115-119 35.2858 37.0 37.0 37.0 32.2 37.0 120-124 35.1944 37.0 37.0 37.0 27.4 37.0 125-129 35.105 37.0 37.0 37.0 25.0 37.0 130-134 35.149800000000006 37.0 37.0 37.0 25.0 37.0 135-139 34.9961 37.0 37.0 37.0 25.0 37.0 140-144 34.7564 37.0 37.0 37.0 25.0 37.0 145-149 34.6978 37.0 37.0 37.0 25.0 37.0 150-151 33.9935 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 2.0 16 2.0 17 1.0 18 1.0 19 0.0 20 1.0 21 4.0 22 6.0 23 4.0 24 5.0 25 8.0 26 6.0 27 16.0 28 20.0 29 20.0 30 32.0 31 58.0 32 78.0 33 147.0 34 222.0 35 697.0 36 2557.0 37 109.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 12.4 12.125 36.725 2 29.225 18.825 31.05 20.9 3 22.525000000000002 23.65 28.175 25.650000000000002 4 26.3 32.074999999999996 18.25 23.375 5 28.025 31.75 18.6 21.625 6 21.85 33.900000000000006 19.0 25.25 7 21.5 15.0 36.875 26.625 8 23.625 20.125 20.825 35.425000000000004 9 23.674999999999997 21.8 25.25 29.275000000000002 10-14 25.53 24.6 22.425 27.445000000000004 15-19 25.86 24.09 23.235 26.815 20-24 25.56 24.54 23.080000000000002 26.82 25-29 26.3 24.15 23.494999999999997 26.055 30-34 26.355 24.285 23.080000000000002 26.279999999999998 35-39 26.810000000000002 24.474999999999998 22.685 26.029999999999998 40-44 26.490000000000002 24.46 23.005 26.045 45-49 26.515 23.919999999999998 23.305 26.26 50-54 26.27 24.47 22.99 26.27 55-59 27.52 23.880000000000003 22.68 25.919999999999998 60-64 27.18 24.145 23.25 25.424999999999997 65-69 26.58 24.855 22.865 25.7 70-74 26.919999999999998 24.32 23.244999999999997 25.515 75-79 26.52 24.115000000000002 23.9 25.465 80-84 26.68 24.310000000000002 23.13 25.88 85-89 26.355 24.995 23.03 25.619999999999997 90-94 26.669999999999998 24.36 23.244999999999997 25.724999999999998 95-99 26.445 24.645 23.945 24.965 100-104 26.75 24.075 23.47 25.705 105-109 27.185 24.34 23.57 24.905 110-114 27.250000000000004 24.865000000000002 22.855 25.03 115-119 27.16 23.875 23.115 25.85 120-124 27.155 24.51 23.57 24.765 125-129 26.889999999999997 24.67 23.65 24.79 130-134 27.235 23.995 23.435 25.335 135-139 27.045 24.81 23.825 24.32 140-144 26.58 25.314999999999998 23.075000000000003 25.03 145-149 26.52 25.365 23.380000000000003 24.735 150-151 26.487500000000004 25.174999999999997 23.825 24.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 0.0 26 0.5 27 1.0 28 2.0 29 4.0 30 7.0 31 9.5 32 14.5 33 20.0 34 20.0 35 23.0 36 31.0 37 43.0 38 59.5 39 78.0 40 99.5 41 112.0 42 121.0 43 135.0 44 141.0 45 157.0 46 175.0 47 168.5 48 161.5 49 154.0 50 141.0 51 127.5 52 122.0 53 118.0 54 109.0 55 99.0 56 87.0 57 93.5 58 101.5 59 104.0 60 99.5 61 88.5 62 87.5 63 81.5 64 80.0 65 83.0 66 83.0 67 79.5 68 72.0 69 68.0 70 60.0 71 55.0 72 52.5 73 41.0 74 33.0 75 29.5 76 20.0 77 15.5 78 10.0 79 5.5 80 4.5 81 2.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.93432369038311 92.025 2 3.9093041438623923 7.5 3 0.13031013812874642 0.375 4 0.026062027625749284 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.1875 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.30000000000000004 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.3625 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4375 0.0 0.0 0.0 0.0 128-129 0.5375 0.0 0.0 0.0 0.0 130-131 0.6875 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.85 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 0.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCTG 10 0.006830828 145.0 9 TGACAAC 10 0.006830828 145.0 1 CCGTCTG 10 0.006830828 145.0 7 GGAGCCG 10 0.006830828 145.0 8 >>END_MODULE Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523553 spots for SRR7804199.sra Written 1523553 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra Read 1523535 spots for SRR7804199.sra Written 1523535 spots for SRR7804199.sra SRR ids: ['SRR7804199.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p4zq90mr SRR7804199.sra spots: 30470718 blocks: [[1, 1523535], [1523536, 3047070], [3047071, 4570605], [4570606, 6094140], [6094141, 7617675], [7617676, 9141210], [9141211, 10664745], [10664746, 12188280], [12188281, 13711815], [13711816, 15235350], [15235351, 16758885], [16758886, 18282420], [18282421, 19805955], [19805956, 21329490], [21329491, 22853025], [22853026, 24376560], [24376561, 25900095], [25900096, 27423630], [27423631, 28947165], [28947166, 30470718]] SRR7804199 file size 10303826 SRR7804199 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804199 SRR7804199_1.fastq SRR7804199_2.fastq Input file: SRR7804199_1.fastq Paired file: SRR7804199_2.fastq trimmed: SRR7804199-trimmed-pair1.fastq, SRR7804199-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:59:47 2024 >> started Tue Dec 10 04:00:26 2024 >> done (39.541s) 30470718 read pairs processed; of these: 92 ( 0.00%) short read pairs filtered out after trimming by size control 561 ( 0.00%) empty read pairs filtered out after trimming by size control 30470065 (100.00%) read pairs available; of these: 580314 ( 1.90%) trimmed read pairs available after processing 29889751 (98.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 13 0.00% 20 25 0.00% 21 15 0.00% 22 18 0.00% 23 10 0.00% 24 21 0.00% 25 28 0.00% 26 30 0.00% 27 41 0.00% 28 36 0.00% 29 33 0.00% 30 48 0.00% 31 39 0.00% 32 51 0.00% 33 45 0.00% 34 48 0.00% 35 61 0.00% 36 64 0.00% 37 52 0.00% 38 67 0.00% 39 58 0.00% 40 47 0.00% 41 55 0.00% 42 66 0.00% 43 46 0.00% 44 75 0.00% 45 58 0.00% 46 87 0.00% 47 58 0.00% 48 71 0.00% 49 77 0.00% 50 102 0.00% 51 92 0.00% 52 82 0.00% 53 91 0.00% 54 92 0.00% 55 92 0.00% 56 95 0.00% 57 110 0.00% 58 100 0.00% 59 95 0.00% 60 104 0.00% 61 102 0.00% 62 105 0.00% 63 125 0.00% 64 126 0.00% 65 125 0.00% 66 116 0.00% 67 122 0.00% 68 129 0.00% 69 107 0.00% 70 157 0.00% 71 153 0.00% 72 161 0.00% 73 210 0.00% 74 204 0.00% 75 209 0.00% 76 223 0.00% 77 228 0.00% 78 246 0.00% 79 283 0.00% 80 249 0.00% 81 318 0.00% 82 387 0.00% 83 429 0.00% 84 441 0.00% 85 476 0.00% 86 496 0.00% 87 534 0.00% 88 633 0.00% 89 650 0.00% 90 719 0.00% 91 807 0.00% 92 914 0.00% 93 1040 0.00% 94 1132 0.00% 95 1259 0.00% 96 1343 0.00% 97 1443 0.00% 98 1598 0.01% 99 1654 0.01% 100 1759 0.01% 101 1965 0.01% 102 2241 0.01% 103 2399 0.01% 104 2667 0.01% 105 2937 0.01% 106 3103 0.01% 107 3196 0.01% 108 3440 0.01% 109 3672 0.01% 110 3863 0.01% 111 4203 0.01% 112 4505 0.01% 113 5039 0.02% 114 5197 0.02% 115 5696 0.02% 116 5951 0.02% 117 6203 0.02% 118 6343 0.02% 119 6584 0.02% 120 6970 0.02% 121 7556 0.02% 122 8008 0.03% 123 8433 0.03% 124 9080 0.03% 125 9705 0.03% 126 10363 0.03% 127 10513 0.03% 128 10847 0.04% 129 11062 0.04% 130 11508 0.04% 131 12116 0.04% 132 12974 0.04% 133 13668 0.04% 134 14415 0.05% 135 14908 0.05% 136 15964 0.05% 137 16174 0.05% 138 16831 0.06% 139 17112 0.06% 140 17553 0.06% 141 18202 0.06% 142 18803 0.06% 143 19847 0.07% 144 20797 0.07% 145 21833 0.07% 146 23184 0.08% 147 24041 0.08% 148 24593 0.08% 149 24508 0.08% 150 25619 0.08% 151 29889751 98.10% 30470065 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=13 prefix-density=0.55 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=13.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.5 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=25 prefix-density=0.46 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=145.29 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.8 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804199 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:01:20 Started mapping on | Dec 10 04:01:20 Finished on | Dec 10 04:06:13 Mapping speed, Million of reads per hour | 374.38 Number of input reads | 30470065 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 28937708 Uniquely mapped reads % | 94.97% Average mapped length | 300.32 Number of splices: Total | 31593667 Number of splices: Annotated (sjdb) | 29710590 Number of splices: GT/AG | 31148797 Number of splices: GC/AG | 385904 Number of splices: AT/AC | 17577 Number of splices: Non-canonical | 41389 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.65 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330922 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 19731 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1201435 1201435 1201435 N_multimapping 330922 330922 330922 N_noFeature 870373 28080445 1098249 N_ambiguous 760696 4814 131899 UnstrandedReadsAssigned:27306639 PositiveStrandReadsAssigned:852449 NegativeStrandReadsAssigned:27707560 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804199 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804199-trimmed-pair1.fastq SRR7804199-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,470,065 reads, 27,880,139 reads pseudoaligned [quant] estimated average fragment length: 344.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR7804199.ke.tsv 35125 SRR7804199.se.tsv 88098 total ==> SRR7804199.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 593.903 0 0 PNS24247 1044 700.351 84.3938 5.53245 PNS24249 1928 1584.35 198.527 5.75296 PNS24246 1044 700.351 84.3938 5.53245 PNS24248 1044 700.351 84.3938 5.53245 PNS24244 1471 1127.35 104.291 4.24729 PNS24243 293 67.9075 0 0 KQK14069 1603 1259.35 808.944 29.4914 KQK14071 474 182.203 9.53501 2.40264 ==> SRR7804199.se.tsv <== BRADI_1g14170v3 876 BRADI_1g53295v3 372 BRADI_1g59795v3 1114 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 3009 BRADI_1g74790v3 710 BRADI_1g09890v3 9 BRADI_1g77505v3 461 BRADI_1g48960v3 0 SRR7804199 completed mapping pipeline successfully