Starting /dee2/code/volunteer_pipeline.sh SRR7804200 current disk space = 1526070550528 free memory = 1556657140 SRR7804200 SRAfilesize 19f2720eed49fc0eded9c45cc3b3fc02 SRR7804200.sra SRR7804200.sra file validated SRR7804200 is paired end SRR7804200 is conventional basespace SRR7804200 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804200_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0555 37.0 37.0 37.0 37.0 37.0 2 36.1845 37.0 37.0 37.0 37.0 37.0 3 36.3075 37.0 37.0 37.0 37.0 37.0 4 36.425 37.0 37.0 37.0 37.0 37.0 5 36.555 37.0 37.0 37.0 37.0 37.0 6 36.509 37.0 37.0 37.0 37.0 37.0 7 36.2865 37.0 37.0 37.0 37.0 37.0 8 36.4815 37.0 37.0 37.0 37.0 37.0 9 36.451 37.0 37.0 37.0 37.0 37.0 10-14 36.509699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.50170000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4324 37.0 37.0 37.0 37.0 37.0 25-29 36.4093 37.0 37.0 37.0 37.0 37.0 30-34 36.394999999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.359899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.31529999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.2282 37.0 37.0 37.0 37.0 37.0 50-54 36.2354 37.0 37.0 37.0 37.0 37.0 55-59 36.183899999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.225500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.1567 37.0 37.0 37.0 37.0 37.0 70-74 36.09439999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.100699999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.072100000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.0354 37.0 37.0 37.0 37.0 37.0 90-94 35.970099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8839 37.0 37.0 37.0 37.0 37.0 100-104 35.8584 37.0 37.0 37.0 37.0 37.0 105-109 35.854299999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.865300000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.7079 37.0 37.0 37.0 37.0 37.0 120-124 35.596199999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6429 37.0 37.0 37.0 37.0 37.0 130-134 35.436 37.0 37.0 37.0 37.0 37.0 135-139 35.361000000000004 37.0 37.0 37.0 32.2 37.0 140-144 35.3994 37.0 37.0 37.0 34.6 37.0 145-149 35.2128 37.0 37.0 37.0 27.4 37.0 150-151 34.625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 0.0 24 0.0 25 3.0 26 8.0 27 12.0 28 20.0 29 26.0 30 37.0 31 58.0 32 69.0 33 109.0 34 176.0 35 452.0 36 2773.0 37 255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.851554663991976 12.788365095285858 12.036108324974924 41.323971915747244 2 25.650000000000002 18.85 35.475 20.025000000000002 3 21.8 23.625 25.074999999999996 29.5 4 25.8 32.574999999999996 18.7 22.925 5 26.150000000000002 31.7 22.0 20.150000000000002 6 20.849999999999998 33.425 23.35 22.375 7 16.075 20.25 42.4 21.275 8 20.424999999999997 19.650000000000002 27.575 32.35 9 21.349999999999998 19.525000000000002 30.825000000000003 28.299999999999997 10-14 23.48 26.6 24.545 25.374999999999996 15-19 23.29 25.05 25.555 26.105 20-24 23.72 25.56 25.215 25.505 25-29 22.55 25.185000000000002 25.61 26.655 30-34 23.880000000000003 24.759999999999998 25.285000000000004 26.075 35-39 23.485 25.2 25.14 26.174999999999997 40-44 23.64 24.985 25.395 25.979999999999997 45-49 23.66 24.715 25.05 26.575 50-54 23.86 25.590000000000003 24.279999999999998 26.27 55-59 23.9 25.22 24.785 26.095000000000002 60-64 24.095 24.490000000000002 25.195 26.22 65-69 24.4 25.11 24.785 25.705 70-74 24.635 24.64 24.6 26.125 75-79 24.005000000000003 25.095 24.68 26.22 80-84 23.799999999999997 24.654999999999998 24.575 26.97 85-89 24.73 24.645 24.84 25.785000000000004 90-94 24.52 24.85 24.154999999999998 26.474999999999998 95-99 24.740000000000002 25.035 24.065 26.16 100-104 24.97 24.93 24.18 25.919999999999998 105-109 24.03 24.759999999999998 24.4 26.810000000000002 110-114 24.075 25.069999999999997 24.72 26.135 115-119 24.395 24.490000000000002 24.52 26.595000000000002 120-124 24.29 24.349999999999998 24.335 27.025 125-129 25.1 24.135 24.26 26.505000000000003 130-134 24.915000000000003 24.095 24.72 26.27 135-139 24.75 24.51 24.415 26.325 140-144 24.985 24.39 24.265 26.36 145-149 25.224999999999998 24.385 23.935000000000002 26.455000000000002 150-151 26.275 23.9125 22.9625 26.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 2.0 26 1.5 27 1.5 28 3.0 29 6.0 30 9.0 31 15.5 32 16.0 33 20.5 34 30.0 35 44.5 36 51.5 37 61.5 38 79.0 39 88.0 40 115.5 41 145.5 42 172.0 43 199.5 44 194.5 45 181.0 46 189.0 47 180.5 48 178.5 49 171.5 50 149.5 51 137.5 52 119.5 53 92.5 54 98.5 55 113.0 56 90.5 57 74.5 58 73.0 59 71.0 60 72.5 61 70.0 62 66.0 63 60.0 64 56.0 65 62.5 66 53.5 67 53.0 68 59.0 69 48.0 70 41.0 71 36.0 72 32.5 73 31.0 74 24.0 75 14.0 76 8.0 77 10.5 78 8.5 79 3.5 80 3.5 81 2.0 82 1.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.72573839662446 89.8 2 5.089662447257385 9.65 3 0.15822784810126583 0.44999999999999996 4 0.026371308016877634 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.037500000000000006 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138-139 1.1749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTTAT 10 0.006830828 145.0 7 TTTATTC 10 0.006830828 145.0 9 >>END_MODULE SRR7804200 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804200_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.313 37.0 37.0 37.0 37.0 37.0 2 36.0415 37.0 37.0 37.0 37.0 37.0 3 36.1785 37.0 37.0 37.0 37.0 37.0 4 36.303 37.0 37.0 37.0 37.0 37.0 5 36.298 37.0 37.0 37.0 37.0 37.0 6 36.1475 37.0 37.0 37.0 37.0 37.0 7 36.1075 37.0 37.0 37.0 37.0 37.0 8 36.302 37.0 37.0 37.0 37.0 37.0 9 36.2665 37.0 37.0 37.0 37.0 37.0 10-14 36.2107 37.0 37.0 37.0 37.0 37.0 15-19 36.193599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.112700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0828 37.0 37.0 37.0 37.0 37.0 30-34 36.0227 37.0 37.0 37.0 37.0 37.0 35-39 35.9454 37.0 37.0 37.0 37.0 37.0 40-44 35.9614 37.0 37.0 37.0 37.0 37.0 45-49 35.9162 37.0 37.0 37.0 37.0 37.0 50-54 35.91510000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.85850000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.7432 37.0 37.0 37.0 37.0 37.0 65-69 35.69840000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.6992 37.0 37.0 37.0 37.0 37.0 75-79 35.631899999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.5762 37.0 37.0 37.0 37.0 37.0 85-89 35.4531 37.0 37.0 37.0 34.6 37.0 90-94 35.484 37.0 37.0 37.0 37.0 37.0 95-99 35.348699999999994 37.0 37.0 37.0 34.6 37.0 100-104 35.2938 37.0 37.0 37.0 29.8 37.0 105-109 35.3034 37.0 37.0 37.0 32.2 37.0 110-114 35.0695 37.0 37.0 37.0 25.0 37.0 115-119 34.991699999999994 37.0 37.0 37.0 25.0 37.0 120-124 34.9117 37.0 37.0 37.0 25.0 37.0 125-129 34.860499999999995 37.0 37.0 37.0 25.0 37.0 130-134 34.7293 37.0 37.0 37.0 25.0 37.0 135-139 34.59949999999999 37.0 37.0 37.0 25.0 37.0 140-144 34.4435 37.0 37.0 37.0 25.0 37.0 145-149 34.337900000000005 37.0 37.0 37.0 25.0 37.0 150-151 33.552 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 2.0 16 1.0 17 0.0 18 1.0 19 2.0 20 4.0 21 2.0 22 5.0 23 4.0 24 10.0 25 3.0 26 14.0 27 19.0 28 22.0 29 33.0 30 43.0 31 62.0 32 89.0 33 146.0 34 307.0 35 862.0 36 2289.0 37 75.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.025 12.025 13.450000000000001 41.5 2 27.800000000000004 18.325 32.125 21.75 3 23.375 22.125 27.500000000000004 27.0 4 27.450000000000003 29.125 18.175 25.25 5 29.099999999999998 32.25 18.625 20.025000000000002 6 21.625 33.625 20.05 24.7 7 19.45 13.625000000000002 39.574999999999996 27.35 8 23.35 19.125 23.35 34.175 9 24.85 20.599999999999998 26.224999999999998 28.325 10-14 25.665 24.8 22.68 26.855 15-19 26.674999999999997 23.905 23.48 25.94 20-24 26.584999999999997 24.165 23.085 26.165 25-29 26.31 23.28 23.525 26.884999999999998 30-34 26.6 23.945 23.345 26.11 35-39 26.615 23.895 23.21 26.279999999999998 40-44 26.32 24.15 23.605 25.924999999999997 45-49 26.46 23.535 23.919999999999998 26.085 50-54 26.200000000000003 23.82 23.68 26.3 55-59 27.224999999999998 23.655 22.835 26.284999999999997 60-64 26.52 24.02 23.415 26.045 65-69 25.97 23.565 24.01 26.455000000000002 70-74 26.055 23.865 23.48 26.6 75-79 25.564999999999998 24.27 23.599999999999998 26.565 80-84 26.645000000000003 23.815 23.82 25.72 85-89 26.634999999999998 23.275000000000002 23.86 26.229999999999997 90-94 27.37 23.880000000000003 23.135 25.615 95-99 27.185 24.115000000000002 23.445 25.255 100-104 26.805 23.86 23.59 25.745 105-109 27.445000000000004 23.24 23.745 25.569999999999997 110-114 26.575 23.98 23.365 26.08 115-119 27.205000000000002 24.645 23.0 25.15 120-124 26.85 24.26 23.345 25.545 125-129 27.045 24.38 23.265 25.31 130-134 27.04 24.125 23.76 25.074999999999996 135-139 27.07 24.385 23.49 25.055 140-144 27.325 24.505 23.32 24.85 145-149 27.345000000000002 24.415 23.055 25.185000000000002 150-151 27.450000000000003 24.65 22.5875 25.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 0.5 27 2.0 28 5.0 29 5.5 30 6.0 31 11.5 32 17.5 33 15.0 34 18.0 35 31.0 36 33.5 37 40.0 38 65.0 39 84.0 40 88.5 41 120.0 42 140.5 43 136.0 44 146.0 45 150.0 46 160.5 47 167.5 48 164.0 49 149.5 50 139.5 51 132.5 52 106.0 53 97.5 54 106.0 55 99.5 56 83.5 57 76.5 58 80.5 59 89.0 60 91.0 61 87.5 62 98.0 63 95.5 64 77.0 65 79.0 66 79.5 67 76.0 68 78.0 69 76.5 70 71.0 71 63.0 72 54.0 73 47.5 74 44.0 75 29.5 76 19.0 77 17.5 78 11.5 79 9.0 80 6.0 81 4.0 82 4.5 83 2.5 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.37693722090886 90.77499999999999 2 4.360388757551878 8.3 3 0.21013921723141582 0.6 4 0.026267402153926978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026267402153926978 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.037500000000000006 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.1125 0.0 0.0 0.0 0.0 138-139 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645364 spots for SRR7804200.sra Written 1645364 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra Read 1645351 spots for SRR7804200.sra Written 1645351 spots for SRR7804200.sra SRR ids: ['SRR7804200.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rdmqrhft SRR7804200.sra spots: 32907033 blocks: [[1, 1645351], [1645352, 3290702], [3290703, 4936053], [4936054, 6581404], [6581405, 8226755], [8226756, 9872106], [9872107, 11517457], [11517458, 13162808], [13162809, 14808159], [14808160, 16453510], [16453511, 18098861], [18098862, 19744212], [19744213, 21389563], [21389564, 23034914], [23034915, 24680265], [24680266, 26325616], [26325617, 27970967], [27970968, 29616318], [29616319, 31261669], [31261670, 32907033]] SRR7804200 file size 11129413 SRR7804200 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804200 SRR7804200_1.fastq SRR7804200_2.fastq Input file: SRR7804200_1.fastq Paired file: SRR7804200_2.fastq trimmed: SRR7804200-trimmed-pair1.fastq, SRR7804200-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 03:58:33 2024 >> started Tue Dec 10 03:59:10 2024 >> done (36.805s) 32907033 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 442 ( 0.00%) empty read pairs filtered out after trimming by size control 32906497 (100.00%) read pairs available; of these: 788448 ( 2.40%) trimmed read pairs available after processing 32118049 (97.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 14 0.00% 21 18 0.00% 22 19 0.00% 23 27 0.00% 24 18 0.00% 25 25 0.00% 26 20 0.00% 27 34 0.00% 28 35 0.00% 29 29 0.00% 30 46 0.00% 31 39 0.00% 32 47 0.00% 33 43 0.00% 34 40 0.00% 35 49 0.00% 36 50 0.00% 37 43 0.00% 38 48 0.00% 39 52 0.00% 40 42 0.00% 41 61 0.00% 42 78 0.00% 43 50 0.00% 44 63 0.00% 45 65 0.00% 46 75 0.00% 47 73 0.00% 48 75 0.00% 49 61 0.00% 50 81 0.00% 51 79 0.00% 52 69 0.00% 53 80 0.00% 54 88 0.00% 55 86 0.00% 56 81 0.00% 57 86 0.00% 58 80 0.00% 59 90 0.00% 60 109 0.00% 61 115 0.00% 62 107 0.00% 63 108 0.00% 64 140 0.00% 65 159 0.00% 66 122 0.00% 67 136 0.00% 68 165 0.00% 69 158 0.00% 70 164 0.00% 71 195 0.00% 72 226 0.00% 73 235 0.00% 74 243 0.00% 75 282 0.00% 76 309 0.00% 77 325 0.00% 78 359 0.00% 79 416 0.00% 80 457 0.00% 81 455 0.00% 82 569 0.00% 83 643 0.00% 84 688 0.00% 85 821 0.00% 86 851 0.00% 87 969 0.00% 88 1101 0.00% 89 1149 0.00% 90 1246 0.00% 91 1412 0.00% 92 1565 0.00% 93 1769 0.01% 94 1893 0.01% 95 2055 0.01% 96 2250 0.01% 97 2488 0.01% 98 2530 0.01% 99 2885 0.01% 100 2970 0.01% 101 3343 0.01% 102 3481 0.01% 103 3915 0.01% 104 4228 0.01% 105 4288 0.01% 106 4657 0.01% 107 4985 0.02% 108 5134 0.02% 109 5462 0.02% 110 5833 0.02% 111 6019 0.02% 112 6573 0.02% 113 7026 0.02% 114 7474 0.02% 115 8032 0.02% 116 8179 0.02% 117 8616 0.03% 118 9091 0.03% 119 9469 0.03% 120 10022 0.03% 121 10603 0.03% 122 11252 0.03% 123 11660 0.04% 124 12378 0.04% 125 13066 0.04% 126 13444 0.04% 127 13962 0.04% 128 14639 0.04% 129 15232 0.05% 130 16085 0.05% 131 16608 0.05% 132 17339 0.05% 133 17965 0.05% 134 19119 0.06% 135 19786 0.06% 136 20930 0.06% 137 21371 0.06% 138 21912 0.07% 139 23051 0.07% 140 23749 0.07% 141 24387 0.07% 142 25521 0.08% 143 26345 0.08% 144 27436 0.08% 145 28814 0.09% 146 29714 0.09% 147 30693 0.09% 148 32138 0.10% 149 32433 0.10% 150 33969 0.10% 151 32118049 97.60% 32906497 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=7.53 fanout-score-rank=6 prefix-density=0.75 prefix-fanout=3.0 sequence=ATGGCGAGGATGCTCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=284.99 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=16.0 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=26 prefix-density=0.65 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.17 sequence-density-rank=23 fanout-score=110.38 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=20.7 sequence=CGCCGCCGCCGTCGGCCGCTCCGCCAACCGTTCTGCGCTGGCGCCCCTGC SRR7804200 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:00:08 Started mapping on | Dec 10 04:00:08 Finished on | Dec 10 04:04:54 Mapping speed, Million of reads per hour | 414.21 Number of input reads | 32906497 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 31369388 Uniquely mapped reads % | 95.33% Average mapped length | 300.10 Number of splices: Total | 32512574 Number of splices: Annotated (sjdb) | 30595741 Number of splices: GT/AG | 32076206 Number of splices: GC/AG | 378292 Number of splices: AT/AC | 12304 Number of splices: Non-canonical | 45772 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312855 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 23081 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.12% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1224254 1224254 1224254 N_multimapping 312855 312855 312855 N_noFeature 1095429 30440647 1339103 N_ambiguous 819079 5384 134415 UnstrandedReadsAssigned:29454880 PositiveStrandReadsAssigned:923357 NegativeStrandReadsAssigned:29895870 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804200 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804200-trimmed-pair1.fastq SRR7804200-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,906,497 reads, 30,063,182 reads pseudoaligned [quant] estimated average fragment length: 337.239 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR7804200.ke.tsv 35125 SRR7804200.se.tsv 88098 total ==> SRR7804200.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 601.146 0 0 PNS24247 1044 707.761 93.5636 5.77534 PNS24249 1928 1591.76 196.183 5.38443 PNS24246 1044 707.761 93.5636 5.77534 PNS24248 1044 707.761 93.5636 5.77534 PNS24244 1471 1134.76 124.127 4.77879 PNS24243 293 71.2496 0 0 KQK14069 1603 1266.76 2754.58 94.9987 KQK14071 474 188.342 49.0204 11.3707 ==> SRR7804200.se.tsv <== BRADI_1g14170v3 3198 BRADI_1g53295v3 191 BRADI_1g59795v3 476 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 533 BRADI_1g74790v3 1114 BRADI_1g09890v3 0 BRADI_1g77505v3 467 BRADI_1g48960v3 0 SRR7804200 completed mapping pipeline successfully