Starting /dee2/code/volunteer_pipeline.sh SRR7804201 current disk space = 1526168846336 free memory = 1599188952 SRR7804201 SRAfilesize 16a211b8eadc6163ab7ad06288c161a5 SRR7804201.sra SRR7804201.sra file validated SRR7804201 is paired end SRR7804201 is conventional basespace SRR7804201 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804201_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1815 37.0 37.0 37.0 37.0 37.0 2 36.249 37.0 37.0 37.0 37.0 37.0 3 36.4575 37.0 37.0 37.0 37.0 37.0 4 36.4885 37.0 37.0 37.0 37.0 37.0 5 36.435 37.0 37.0 37.0 37.0 37.0 6 36.4555 37.0 37.0 37.0 37.0 37.0 7 36.36 37.0 37.0 37.0 37.0 37.0 8 36.476 37.0 37.0 37.0 37.0 37.0 9 36.389 37.0 37.0 37.0 37.0 37.0 10-14 36.5423 37.0 37.0 37.0 37.0 37.0 15-19 36.4783 37.0 37.0 37.0 37.0 37.0 20-24 36.476800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.39359999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3567 37.0 37.0 37.0 37.0 37.0 35-39 36.3587 37.0 37.0 37.0 37.0 37.0 40-44 36.3226 37.0 37.0 37.0 37.0 37.0 45-49 36.2565 37.0 37.0 37.0 37.0 37.0 50-54 36.305899999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.1806 37.0 37.0 37.0 37.0 37.0 60-64 36.1775 37.0 37.0 37.0 37.0 37.0 65-69 36.14370000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.0446 37.0 37.0 37.0 37.0 37.0 75-79 36.0398 37.0 37.0 37.0 37.0 37.0 80-84 36.060500000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0517 37.0 37.0 37.0 37.0 37.0 90-94 35.9902 37.0 37.0 37.0 37.0 37.0 95-99 35.9078 37.0 37.0 37.0 37.0 37.0 100-104 35.808299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8119 37.0 37.0 37.0 37.0 37.0 110-114 35.807 37.0 37.0 37.0 37.0 37.0 115-119 35.7218 37.0 37.0 37.0 37.0 37.0 120-124 35.5698 37.0 37.0 37.0 37.0 37.0 125-129 35.578100000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.404999999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.397000000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.4447 37.0 37.0 37.0 34.6 37.0 145-149 35.20890000000001 37.0 37.0 37.0 27.4 37.0 150-151 34.584 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 3.0 25 6.0 26 7.0 27 11.0 28 16.0 29 28.0 30 33.0 31 44.0 32 65.0 33 108.0 34 180.0 35 481.0 36 2755.0 37 258.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.802005012531325 12.731829573934835 11.528822055137844 34.93734335839599 2 26.450000000000003 17.675 33.15 22.725 3 24.3 24.224999999999998 23.45 28.025 4 28.199999999999996 29.325000000000003 18.2 24.275 5 26.525 31.55 21.0 20.925 6 21.675 33.525 23.0 21.8 7 18.375 19.075 40.325 22.225 8 22.7 19.6 26.174999999999997 31.525 9 21.175 18.875 31.900000000000002 28.050000000000004 10-14 24.065 25.575 23.715 26.645000000000003 15-19 24.905 24.610000000000003 23.724999999999998 26.76 20-24 24.765 24.63 23.9 26.705000000000002 25-29 24.915000000000003 24.095 24.32 26.669999999999998 30-34 24.92 23.9 24.240000000000002 26.939999999999998 35-39 24.8 24.279999999999998 24.099999999999998 26.82 40-44 25.2 23.919999999999998 24.48 26.400000000000002 45-49 25.669999999999998 23.775 24.34 26.215 50-54 25.305 23.945 23.585 27.165 55-59 25.285000000000004 24.060000000000002 23.435 27.22 60-64 25.805 23.84 23.724999999999998 26.63 65-69 24.95 24.060000000000002 23.715 27.275 70-74 25.595000000000002 23.925 23.655 26.825 75-79 25.424999999999997 23.685000000000002 24.13 26.76 80-84 25.705 23.875 23.69 26.729999999999997 85-89 25.22 23.36 24.005000000000003 27.415 90-94 26.21 23.575 23.46 26.755000000000003 95-99 25.945 23.39 23.57 27.095000000000002 100-104 26.69 23.225 23.085 27.0 105-109 25.825 23.695 23.36 27.12 110-114 26.14 24.015 23.385 26.46 115-119 26.400000000000002 23.474999999999998 22.634999999999998 27.49 120-124 26.215 23.419999999999998 23.32 27.045 125-129 26.484999999999996 22.939999999999998 23.56 27.015 130-134 26.495 23.54 22.875 27.089999999999996 135-139 26.115 23.205000000000002 23.335 27.345000000000002 140-144 26.655 23.0 22.99 27.355 145-149 26.405 22.735 23.73 27.13 150-151 27.212500000000002 22.475 22.900000000000002 27.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 1.0 26 0.5 27 1.5 28 1.5 29 5.0 30 8.0 31 9.0 32 12.5 33 18.0 34 22.5 35 36.5 36 42.5 37 47.0 38 69.5 39 91.0 40 104.5 41 112.0 42 122.0 43 137.5 44 148.0 45 152.0 46 159.0 47 170.5 48 163.0 49 137.0 50 123.5 51 116.0 52 111.5 53 99.0 54 88.5 55 89.5 56 97.5 57 114.0 58 115.5 59 115.0 60 131.5 61 127.5 62 99.0 63 82.0 64 86.0 65 98.0 66 88.5 67 76.5 68 72.5 69 63.5 70 56.0 71 44.0 72 34.5 73 26.0 74 18.0 75 16.5 76 13.0 77 7.5 78 5.0 79 2.5 80 1.5 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.025 #Duplication Level Percentage of deduplicated Percentage of total 1 93.52324643912927 87.0 2 5.536146197258801 10.299999999999999 3 0.859983875302338 2.4 4 0.08062348830959419 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.5249999999999999 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 0.9875 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138-139 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCGCTT 10 0.006830828 145.0 8 >>END_MODULE SRR7804201 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804201_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3285 37.0 37.0 37.0 37.0 37.0 2 36.012 37.0 37.0 37.0 37.0 37.0 3 36.11 37.0 37.0 37.0 37.0 37.0 4 36.2555 37.0 37.0 37.0 37.0 37.0 5 36.2235 37.0 37.0 37.0 37.0 37.0 6 36.132 37.0 37.0 37.0 37.0 37.0 7 36.2145 37.0 37.0 37.0 37.0 37.0 8 36.2385 37.0 37.0 37.0 37.0 37.0 9 36.193 37.0 37.0 37.0 37.0 37.0 10-14 36.1442 37.0 37.0 37.0 37.0 37.0 15-19 36.111599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.03340000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.0125 37.0 37.0 37.0 37.0 37.0 30-34 35.9683 37.0 37.0 37.0 37.0 37.0 35-39 35.9163 37.0 37.0 37.0 37.0 37.0 40-44 35.8882 37.0 37.0 37.0 37.0 37.0 45-49 35.843 37.0 37.0 37.0 37.0 37.0 50-54 35.841899999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.800700000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.7282 37.0 37.0 37.0 37.0 37.0 65-69 35.6535 37.0 37.0 37.0 37.0 37.0 70-74 35.6448 37.0 37.0 37.0 37.0 37.0 75-79 35.657900000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.551899999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.4217 37.0 37.0 37.0 37.0 37.0 90-94 35.3832 37.0 37.0 37.0 37.0 37.0 95-99 35.287099999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.3044 37.0 37.0 37.0 34.6 37.0 105-109 35.2149 37.0 37.0 37.0 29.8 37.0 110-114 35.0868 37.0 37.0 37.0 25.0 37.0 115-119 35.0052 37.0 37.0 37.0 25.0 37.0 120-124 34.9208 37.0 37.0 37.0 25.0 37.0 125-129 34.8945 37.0 37.0 37.0 25.0 37.0 130-134 34.7605 37.0 37.0 37.0 25.0 37.0 135-139 34.6488 37.0 37.0 37.0 25.0 37.0 140-144 34.4387 37.0 37.0 37.0 25.0 37.0 145-149 34.370900000000006 37.0 37.0 37.0 25.0 37.0 150-151 33.541250000000005 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 4.0 15 2.0 16 3.0 17 5.0 18 2.0 19 6.0 20 2.0 21 6.0 22 6.0 23 9.0 24 6.0 25 11.0 26 11.0 27 18.0 28 15.0 29 29.0 30 34.0 31 52.0 32 92.0 33 155.0 34 267.0 35 801.0 36 2370.0 37 88.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.525 12.125 12.475 35.875 2 31.05 17.4 27.700000000000003 23.849999999999998 3 25.174999999999997 20.8 26.474999999999998 27.55 4 27.375 28.975 17.05 26.6 5 30.4 30.049999999999997 17.125 22.425 6 23.025000000000002 31.25 18.775 26.950000000000003 7 21.325 15.325 36.05 27.3 8 24.175 19.025 20.95 35.85 9 23.724999999999998 20.925 24.325 31.025000000000002 10-14 26.935 23.3 21.5 28.265 15-19 26.6 23.585 22.55 27.265 20-24 27.125 23.225 22.27 27.38 25-29 27.145000000000003 23.544999999999998 21.66 27.650000000000002 30-34 27.305 23.06 22.08 27.555000000000003 35-39 27.985 24.075 20.415 27.525 40-44 27.089999999999996 23.115 22.08 27.715 45-49 27.245 23.189999999999998 21.815 27.750000000000004 50-54 26.729999999999997 23.015 22.189999999999998 28.065 55-59 27.6 22.3 22.185 27.915 60-64 26.93 22.895 22.009999999999998 28.165000000000003 65-69 27.42 22.655 21.565 28.360000000000003 70-74 26.825 22.105 22.865 28.205000000000002 75-79 27.175 22.74 21.78 28.305000000000003 80-84 27.63 23.06 21.265 28.044999999999998 85-89 26.93 22.75 21.815 28.505000000000003 90-94 27.605 22.795 21.765 27.834999999999997 95-99 27.315 22.695 22.7 27.29 100-104 27.185 23.155 21.455 28.205000000000002 105-109 27.224999999999998 22.85 21.755 28.17 110-114 27.644999999999996 23.285 21.73 27.339999999999996 115-119 27.11 23.215 21.665 28.01 120-124 28.28 23.294999999999998 21.605 26.82 125-129 27.694999999999997 22.615 22.075 27.615000000000002 130-134 28.055000000000003 23.315 22.035 26.595000000000002 135-139 28.015 23.345 22.325 26.314999999999998 140-144 28.105000000000004 22.919999999999998 21.92 27.055 145-149 28.15 23.494999999999997 22.205 26.150000000000002 150-151 28.1125 24.1625 21.9 25.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 1.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 1.5 25 1.0 26 2.0 27 2.0 28 2.0 29 4.0 30 5.5 31 5.5 32 5.5 33 6.5 34 12.0 35 16.0 36 26.0 37 39.5 38 45.5 39 61.5 40 84.0 41 89.0 42 92.5 43 103.5 44 118.0 45 142.0 46 131.5 47 113.5 48 113.0 49 105.5 50 105.5 51 104.5 52 101.0 53 92.0 54 90.0 55 94.5 56 97.0 57 102.0 58 115.5 59 125.5 60 118.5 61 130.5 62 148.5 63 140.0 64 114.5 65 101.5 66 106.0 67 109.0 68 105.5 69 99.0 70 93.0 71 76.0 72 63.5 73 69.0 74 55.5 75 33.5 76 24.5 77 14.0 78 7.0 79 7.0 80 4.5 81 2.0 82 1.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 1.0 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.88052373158756 85.125 2 5.7555919258046915 10.549999999999999 3 1.0092744135297327 2.775 4 0.24549918166939444 0.8999999999999999 5 0.08183306055646482 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027277686852154936 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 11 0.27499999999999997 No Hit CTCATCTCTCACTGACCTTACCACTTGAATTGGGATCGAAATGGCCGCGT 5 0.125 No Hit CGCACAATGTCGACCGCCGCGGCCAACTGGTGCTACGCAACCGTCGCGCC 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 0.9875 0.0 0.0 0.0 0.0 136-137 1.0125 0.0 0.0 0.0 0.0 138-139 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra Read 1861058 spots for SRR7804201.sra Written 1861058 spots for SRR7804201.sra Read 1861043 spots for SRR7804201.sra Written 1861043 spots for SRR7804201.sra SRR ids: ['SRR7804201.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9qocpmhx SRR7804201.sra spots: 37220875 blocks: [[1, 1861043], [1861044, 3722086], [3722087, 5583129], [5583130, 7444172], [7444173, 9305215], [9305216, 11166258], [11166259, 13027301], [13027302, 14888344], [14888345, 16749387], [16749388, 18610430], [18610431, 20471473], [20471474, 22332516], [22332517, 24193559], [24193560, 26054602], [26054603, 27915645], [27915646, 29776688], [29776689, 31637731], [31637732, 33498774], [33498775, 35359817], [35359818, 37220875]] SRR7804201 file size 12591232 SRR7804201 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804201 SRR7804201_1.fastq SRR7804201_2.fastq Input file: SRR7804201_1.fastq Paired file: SRR7804201_2.fastq trimmed: SRR7804201-trimmed-pair1.fastq, SRR7804201-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:02:56 2024 >> started Tue Dec 10 04:03:38 2024 >> done (41.440s) 37220875 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 2123 ( 0.01%) empty read pairs filtered out after trimming by size control 37218640 (99.99%) read pairs available; of these: 786209 ( 2.11%) trimmed read pairs available after processing 36432431 (97.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 7 0.00% 20 14 0.00% 21 20 0.00% 22 24 0.00% 23 16 0.00% 24 32 0.00% 25 27 0.00% 26 27 0.00% 27 29 0.00% 28 39 0.00% 29 41 0.00% 30 25 0.00% 31 35 0.00% 32 29 0.00% 33 32 0.00% 34 42 0.00% 35 43 0.00% 36 41 0.00% 37 46 0.00% 38 46 0.00% 39 55 0.00% 40 48 0.00% 41 53 0.00% 42 61 0.00% 43 55 0.00% 44 44 0.00% 45 48 0.00% 46 56 0.00% 47 48 0.00% 48 59 0.00% 49 63 0.00% 50 73 0.00% 51 63 0.00% 52 49 0.00% 53 57 0.00% 54 79 0.00% 55 103 0.00% 56 81 0.00% 57 90 0.00% 58 72 0.00% 59 94 0.00% 60 123 0.00% 61 127 0.00% 62 105 0.00% 63 93 0.00% 64 91 0.00% 65 94 0.00% 66 134 0.00% 67 116 0.00% 68 147 0.00% 69 139 0.00% 70 161 0.00% 71 145 0.00% 72 166 0.00% 73 184 0.00% 74 177 0.00% 75 179 0.00% 76 260 0.00% 77 255 0.00% 78 285 0.00% 79 279 0.00% 80 330 0.00% 81 366 0.00% 82 404 0.00% 83 451 0.00% 84 491 0.00% 85 538 0.00% 86 640 0.00% 87 691 0.00% 88 821 0.00% 89 830 0.00% 90 943 0.00% 91 1083 0.00% 92 1164 0.00% 93 1260 0.00% 94 1463 0.00% 95 1581 0.00% 96 1752 0.00% 97 2017 0.01% 98 2090 0.01% 99 2301 0.01% 100 2509 0.01% 101 2789 0.01% 102 3011 0.01% 103 3246 0.01% 104 3628 0.01% 105 3846 0.01% 106 4301 0.01% 107 4447 0.01% 108 4641 0.01% 109 5242 0.01% 110 5425 0.01% 111 5868 0.02% 112 6317 0.02% 113 6778 0.02% 114 7378 0.02% 115 7765 0.02% 116 8051 0.02% 117 8481 0.02% 118 8851 0.02% 119 9504 0.03% 120 10046 0.03% 121 10465 0.03% 122 10944 0.03% 123 11779 0.03% 124 12557 0.03% 125 13216 0.04% 126 13873 0.04% 127 14236 0.04% 128 14757 0.04% 129 15213 0.04% 130 15682 0.04% 131 16654 0.04% 132 17701 0.05% 133 18366 0.05% 134 19717 0.05% 135 20538 0.06% 136 21402 0.06% 137 21787 0.06% 138 22748 0.06% 139 23542 0.06% 140 24310 0.07% 141 24812 0.07% 142 25723 0.07% 143 26996 0.07% 144 28182 0.08% 145 29371 0.08% 146 30433 0.08% 147 31658 0.09% 148 32827 0.09% 149 33095 0.09% 150 35044 0.09% 151 36432431 97.89% 37218640 reads passed initial QC criterion=sequence-density sequence-density=2.08 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=23 prefix-density=2.10 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.62 sequence-density-rank=16 fanout-score=8.20 fanout-score-rank=1 prefix-density=2.77 prefix-fanout=1.8 sequence=CCGAACATGGGAAGCTTCCACAT criterion=sequence-density sequence-density=1.44 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=14 prefix-density=1.59 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=72.18 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.7 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCATACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC -y GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG -o SRR7804201 SRR7804201_1.fastq SRR7804201_2.fastq Input file: SRR7804201_1.fastq Paired file: SRR7804201_2.fastq trimmed: SRR7804201-trimmed-pair1.fastq, SRR7804201-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC -- paired 3' end adapter sequence (-y): GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:06:19 2024 >> started Tue Dec 10 04:06:36 2024 >> done (17.164s) 12406213 read pairs processed; of these: 412 ( 0.00%) short read pairs filtered out after trimming by size control 15944 ( 0.13%) empty read pairs filtered out after trimming by size control 12389857 (99.87%) read pairs available; of these: 87 ( 0.00%) trimmed read pairs available after processing 12389770 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 1 0.00% 20 7 0.00% 21 11 0.00% 22 10 0.00% 23 7 0.00% 24 8 0.00% 25 8 0.00% 26 9 0.00% 27 9 0.00% 28 16 0.00% 29 14 0.00% 30 9 0.00% 31 9 0.00% 32 6 0.00% 33 11 0.00% 34 16 0.00% 35 13 0.00% 36 18 0.00% 37 12 0.00% 38 16 0.00% 39 19 0.00% 40 12 0.00% 41 14 0.00% 42 14 0.00% 43 19 0.00% 44 21 0.00% 45 15 0.00% 46 26 0.00% 47 14 0.00% 48 17 0.00% 49 17 0.00% 50 19 0.00% 51 24 0.00% 52 20 0.00% 53 18 0.00% 54 23 0.00% 55 32 0.00% 56 24 0.00% 57 32 0.00% 58 28 0.00% 59 35 0.00% 60 40 0.00% 61 41 0.00% 62 32 0.00% 63 34 0.00% 64 33 0.00% 65 30 0.00% 66 43 0.00% 67 39 0.00% 68 56 0.00% 69 36 0.00% 70 54 0.00% 71 61 0.00% 72 45 0.00% 73 71 0.00% 74 62 0.00% 75 65 0.00% 76 83 0.00% 77 94 0.00% 78 92 0.00% 79 101 0.00% 80 109 0.00% 81 112 0.00% 82 120 0.00% 83 161 0.00% 84 155 0.00% 85 178 0.00% 86 212 0.00% 87 242 0.00% 88 278 0.00% 89 279 0.00% 90 321 0.00% 91 369 0.00% 92 366 0.00% 93 415 0.00% 94 486 0.00% 95 496 0.00% 96 580 0.00% 97 668 0.01% 98 719 0.01% 99 774 0.01% 100 794 0.01% 101 898 0.01% 102 1023 0.01% 103 1032 0.01% 104 1200 0.01% 105 1317 0.01% 106 1421 0.01% 107 1469 0.01% 108 1555 0.01% 109 1823 0.01% 110 1808 0.01% 111 1983 0.02% 112 2080 0.02% 113 2212 0.02% 114 2548 0.02% 115 2626 0.02% 116 2633 0.02% 117 2777 0.02% 118 2912 0.02% 119 3174 0.03% 120 3397 0.03% 121 3528 0.03% 122 3617 0.03% 123 3984 0.03% 124 4249 0.03% 125 4453 0.04% 126 4593 0.04% 127 4777 0.04% 128 4832 0.04% 129 5048 0.04% 130 5254 0.04% 131 5610 0.05% 132 5907 0.05% 133 6181 0.05% 134 6573 0.05% 135 6804 0.05% 136 7243 0.06% 137 7279 0.06% 138 7537 0.06% 139 7862 0.06% 140 8127 0.07% 141 8253 0.07% 142 8566 0.07% 143 8867 0.07% 144 9386 0.08% 145 9847 0.08% 146 10143 0.08% 147 10560 0.09% 148 11023 0.09% 149 10993 0.09% 150 11701 0.09% 151 12127564 97.88% criterion=sequence-density sequence-density=1.94 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=20 prefix-density=2.06 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=16.68 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.9 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=1.44 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=23 prefix-density=1.52 prefix-fanout=2.5 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=88.22 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7804201 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:07:41 Started mapping on | Dec 10 04:07:41 Finished on | Dec 10 04:12:05 Mapping speed, Million of reads per hour | 507.30 Number of input reads | 37202284 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 35309918 Uniquely mapped reads % | 94.91% Average mapped length | 300.25 Number of splices: Total | 36409974 Number of splices: Annotated (sjdb) | 34545874 Number of splices: GT/AG | 35930490 Number of splices: GC/AG | 429251 Number of splices: AT/AC | 8171 Number of splices: Non-canonical | 42062 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303240 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 40922 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1589126 1589126 1589126 N_multimapping 303240 303240 303240 N_noFeature 849323 34182775 1096514 N_ambiguous 1061316 5315 183553 UnstrandedReadsAssigned:33399279 PositiveStrandReadsAssigned:1121828 NegativeStrandReadsAssigned:34029851 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804201 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804201-trimmed-pair1.fastq SRR7804201-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,202,284 reads, 34,258,177 reads pseudoaligned [quant] estimated average fragment length: 345.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52973 SRR7804201.ke.tsv 35125 SRR7804201.se.tsv 88098 total ==> SRR7804201.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 592.911 0 0 PNS24247 1044 699.337 56.6551 2.77652 PNS24249 1928 1583.34 78.832 1.70639 PNS24246 1044 699.337 56.6551 2.77652 PNS24248 1044 699.337 56.6551 2.77652 PNS24244 1471 1126.34 95.2027 2.89687 PNS24243 293 70.4733 0 0 KQK14069 1603 1258.34 4859.44 132.354 KQK14071 474 185.414 58.7108 10.8524 ==> SRR7804201.se.tsv <== BRADI_1g14170v3 5244 BRADI_1g53295v3 132 BRADI_1g59795v3 1535 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 440 BRADI_1g74790v3 156 BRADI_1g09890v3 0 BRADI_1g77505v3 361 BRADI_1g48960v3 0 SRR7804201 completed mapping pipeline successfully