Starting /dee2/code/volunteer_pipeline.sh SRR7804202 current disk space = 1526160572416 free memory = 1559728652 SRR7804202 SRAfilesize 0fb5e9a0730f497514f24ca0dc6f8437 SRR7804202.sra SRR7804202.sra file validated SRR7804202 is paired end SRR7804202 is conventional basespace SRR7804202 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804202_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.16725 37.0 37.0 37.0 37.0 37.0 2 36.2525 37.0 37.0 37.0 37.0 37.0 3 36.3005 37.0 37.0 37.0 37.0 37.0 4 36.4325 37.0 37.0 37.0 37.0 37.0 5 36.4495 37.0 37.0 37.0 37.0 37.0 6 36.506 37.0 37.0 37.0 37.0 37.0 7 36.352 37.0 37.0 37.0 37.0 37.0 8 36.4285 37.0 37.0 37.0 37.0 37.0 9 36.424 37.0 37.0 37.0 37.0 37.0 10-14 36.4837 37.0 37.0 37.0 37.0 37.0 15-19 36.4572 37.0 37.0 37.0 37.0 37.0 20-24 36.3789 37.0 37.0 37.0 37.0 37.0 25-29 36.3428 37.0 37.0 37.0 37.0 37.0 30-34 36.315999999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.2316 37.0 37.0 37.0 37.0 37.0 40-44 36.2677 37.0 37.0 37.0 37.0 37.0 45-49 36.1787 37.0 37.0 37.0 37.0 37.0 50-54 36.2213 37.0 37.0 37.0 37.0 37.0 55-59 36.1451 37.0 37.0 37.0 37.0 37.0 60-64 36.1377 37.0 37.0 37.0 37.0 37.0 65-69 36.0981 37.0 37.0 37.0 37.0 37.0 70-74 35.9812 37.0 37.0 37.0 37.0 37.0 75-79 36.0151 37.0 37.0 37.0 37.0 37.0 80-84 35.965599999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.9824 37.0 37.0 37.0 37.0 37.0 90-94 35.890699999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.771499999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7485 37.0 37.0 37.0 37.0 37.0 105-109 35.722 37.0 37.0 37.0 37.0 37.0 110-114 35.6755 37.0 37.0 37.0 37.0 37.0 115-119 35.542100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.507999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.512 37.0 37.0 37.0 37.0 37.0 130-134 35.3489 37.0 37.0 37.0 32.2 37.0 135-139 35.294200000000004 37.0 37.0 37.0 32.2 37.0 140-144 35.1718 37.0 37.0 37.0 25.0 37.0 145-149 35.0826 37.0 37.0 37.0 25.0 37.0 150-151 34.329499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 4.0 26 16.0 27 10.0 28 29.0 29 42.0 30 32.0 31 61.0 32 69.0 33 136.0 34 157.0 35 446.0 36 2769.0 37 225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.63950864878416 12.960641764853348 10.629230383554775 34.77061920280772 2 25.900000000000002 18.099999999999998 33.625 22.375 3 22.0 24.875 24.025 29.099999999999998 4 27.900000000000002 30.65 19.6 21.85 5 27.375 31.075000000000003 21.224999999999998 20.325 6 20.65 32.75 22.25 24.349999999999998 7 17.575 20.200000000000003 39.45 22.775000000000002 8 20.175 21.325 25.924999999999997 32.574999999999996 9 21.275 19.2 29.875 29.65 10-14 23.94 25.540000000000003 23.69 26.83 15-19 23.465 25.009999999999998 24.69 26.834999999999997 20-24 24.14 24.665 24.51 26.685 25-29 23.965 24.075 25.080000000000002 26.88 30-34 23.715 24.57 24.97 26.745 35-39 23.665 24.86 24.915000000000003 26.56 40-44 24.404999999999998 24.21 24.69 26.695 45-49 23.84 24.595 24.795 26.77 50-54 24.2 24.560000000000002 24.154999999999998 27.084999999999997 55-59 24.86 24.375 23.75 27.015 60-64 24.355 24.125 24.415 27.105 65-69 24.275 23.91 24.2 27.615000000000002 70-74 24.275 24.455 24.395 26.875 75-79 24.92 24.13 23.525 27.425 80-84 24.615000000000002 24.23 24.42 26.735 85-89 25.545 23.189999999999998 23.855 27.41 90-94 24.185000000000002 23.885 24.175 27.755000000000003 95-99 25.205 24.135 23.48 27.18 100-104 24.925 23.57 24.529999999999998 26.974999999999998 105-109 25.324999999999996 23.695 23.89 27.089999999999996 110-114 25.185000000000002 24.154999999999998 23.035 27.625 115-119 25.369999999999997 23.385 23.66 27.584999999999997 120-124 25.669999999999998 23.62 23.380000000000003 27.33 125-129 25.480000000000004 23.505000000000003 23.7 27.315 130-134 25.22 23.145 24.044999999999998 27.589999999999996 135-139 25.825 23.235 23.23 27.71 140-144 25.580000000000002 22.175 24.125 28.12 145-149 26.02 23.125 23.47 27.384999999999998 150-151 26.2125 22.287499999999998 23.5625 27.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.5 28 4.5 29 5.0 30 9.5 31 14.0 32 15.0 33 18.0 34 29.0 35 38.0 36 44.0 37 58.5 38 71.5 39 85.0 40 100.0 41 108.0 42 128.0 43 139.0 44 144.5 45 154.0 46 150.0 47 157.0 48 158.5 49 155.0 50 150.0 51 143.0 52 132.0 53 117.5 54 125.5 55 149.0 56 148.0 57 136.5 58 120.0 59 92.0 60 81.0 61 79.5 62 77.0 63 71.5 64 65.5 65 71.5 66 69.0 67 56.5 68 64.5 69 54.5 70 34.0 71 33.5 72 29.5 73 28.0 74 27.5 75 17.5 76 11.5 77 7.5 78 5.5 79 4.5 80 2.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.22103861517976 88.44999999999999 2 5.219707057256991 9.8 3 0.3994673768308922 1.125 4 0.13315579227696406 0.5 5 0.02663115845539281 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAAGCTGCCGCCGGGGTAGAGAGGGTCGACGATCTCACCGAGCGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7125 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.2000000000000002 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5499999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGT 10 0.006830828 145.0 1 GGATCAA 10 0.006830828 145.0 4 AAGGGGA 10 0.006830828 145.0 4 >>END_MODULE SRR7804202 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804202_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2955 37.0 37.0 37.0 37.0 37.0 2 35.8675 37.0 37.0 37.0 37.0 37.0 3 36.005 37.0 37.0 37.0 37.0 37.0 4 36.0985 37.0 37.0 37.0 37.0 37.0 5 36.23 37.0 37.0 37.0 37.0 37.0 6 36.0385 37.0 37.0 37.0 37.0 37.0 7 35.979 37.0 37.0 37.0 37.0 37.0 8 36.0905 37.0 37.0 37.0 37.0 37.0 9 36.057 37.0 37.0 37.0 37.0 37.0 10-14 36.019600000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.9259 37.0 37.0 37.0 37.0 37.0 20-24 35.9281 37.0 37.0 37.0 37.0 37.0 25-29 35.876200000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.7686 37.0 37.0 37.0 37.0 37.0 35-39 35.7296 37.0 37.0 37.0 37.0 37.0 40-44 35.7509 37.0 37.0 37.0 37.0 37.0 45-49 35.68060000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.6279 37.0 37.0 37.0 37.0 37.0 55-59 35.5599 37.0 37.0 37.0 37.0 37.0 60-64 35.4551 37.0 37.0 37.0 37.0 37.0 65-69 35.503 37.0 37.0 37.0 37.0 37.0 70-74 35.419799999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.499399999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.3293 37.0 37.0 37.0 34.6 37.0 85-89 35.2822 37.0 37.0 37.0 37.0 37.0 90-94 35.2773 37.0 37.0 37.0 32.2 37.0 95-99 35.0791 37.0 37.0 37.0 25.0 37.0 100-104 35.0954 37.0 37.0 37.0 27.4 37.0 105-109 35.0727 37.0 37.0 37.0 27.4 37.0 110-114 34.8621 37.0 37.0 37.0 25.0 37.0 115-119 34.7909 37.0 37.0 37.0 25.0 37.0 120-124 34.7856 37.0 37.0 37.0 25.0 37.0 125-129 34.68730000000001 37.0 37.0 37.0 25.0 37.0 130-134 34.564499999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.397800000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.2795 37.0 37.0 37.0 25.0 37.0 145-149 34.1406 37.0 37.0 37.0 25.0 37.0 150-151 33.5165 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 9.0 15 4.0 16 3.0 17 0.0 18 4.0 19 2.0 20 3.0 21 10.0 22 10.0 23 6.0 24 6.0 25 18.0 26 14.0 27 16.0 28 31.0 29 35.0 30 48.0 31 75.0 32 84.0 33 166.0 34 319.0 35 836.0 36 2218.0 37 78.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.025000000000006 13.925 10.674999999999999 32.375 2 30.325000000000003 19.125 27.474999999999998 23.075000000000003 3 26.35 22.5 26.025 25.124999999999996 4 30.049999999999997 29.849999999999998 16.775000000000002 23.325000000000003 5 28.999999999999996 32.4 17.474999999999998 21.125 6 23.849999999999998 34.35 17.599999999999998 24.2 7 23.125 15.049999999999999 35.475 26.35 8 23.375 20.424999999999997 21.525 34.675 9 26.174999999999997 21.6 23.025000000000002 29.2 10-14 27.134999999999998 23.89 21.775 27.200000000000003 15-19 28.13 23.775 21.82 26.275 20-24 27.485 23.755000000000003 22.009999999999998 26.75 25-29 27.400000000000002 24.335 21.855 26.41 30-34 26.77 24.740000000000002 22.345000000000002 26.145000000000003 35-39 27.560000000000002 24.265 21.584999999999997 26.590000000000003 40-44 27.925 24.01 22.07 25.995 45-49 27.37 24.474999999999998 22.095000000000002 26.06 50-54 28.125 23.625 21.97 26.279999999999998 55-59 28.29 23.94 21.7 26.07 60-64 27.965 23.7 22.255 26.08 65-69 27.435 23.215 22.650000000000002 26.700000000000003 70-74 27.944999999999997 24.0 21.97 26.085 75-79 28.185 23.415 22.435 25.965 80-84 27.865000000000002 23.585 22.785 25.765 85-89 28.299999999999997 22.95 22.24 26.51 90-94 27.99 23.895 21.9 26.215 95-99 27.91 24.5 21.990000000000002 25.6 100-104 28.439999999999998 23.89 21.59 26.08 105-109 27.405 24.395 22.5 25.7 110-114 28.055000000000003 23.765 22.155 26.025 115-119 27.105 24.055 22.365 26.474999999999998 120-124 28.084999999999997 24.16 22.400000000000002 25.355 125-129 27.825 24.625 21.605 25.945 130-134 28.255000000000003 23.62 22.189999999999998 25.935000000000002 135-139 28.144999999999996 23.990000000000002 22.275 25.590000000000003 140-144 28.235 24.525 22.21 25.03 145-149 27.900000000000002 24.62 22.07 25.41 150-151 29.349999999999998 24.462500000000002 21.9375 24.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 2.0 27 3.5 28 3.5 29 3.5 30 3.0 31 7.0 32 12.0 33 9.0 34 10.5 35 18.5 36 29.0 37 41.0 38 48.0 39 53.0 40 64.5 41 68.5 42 87.0 43 105.5 44 118.0 45 130.0 46 140.0 47 157.5 48 150.0 49 144.5 50 143.5 51 132.0 52 118.0 53 105.5 54 115.5 55 133.5 56 136.5 57 129.0 58 114.0 59 114.0 60 123.0 61 117.0 62 109.0 63 99.0 64 90.0 65 91.5 66 85.5 67 88.5 68 89.5 69 72.5 70 55.5 71 54.5 72 60.5 73 51.5 74 37.0 75 28.0 76 26.5 77 18.5 78 8.5 79 6.0 80 4.5 81 3.0 82 2.5 83 3.0 84 2.0 85 1.5 86 2.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.4 #Duplication Level Percentage of deduplicated Percentage of total 1 94.0845824411135 87.875 2 5.2462526766595285 9.8 3 0.4014989293361884 1.125 4 0.13383297644539613 0.5 5 0.05353319057815846 0.25 6 0.08029978586723768 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGATTCTATGGG 6 0.15 No Hit CAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGG 6 0.15 No Hit CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 6 0.15 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.025 136-137 1.45 0.0 0.0 0.0 0.025 138-139 1.6 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250312 spots for SRR7804202.sra Written 1250312 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra Read 1250293 spots for SRR7804202.sra Written 1250293 spots for SRR7804202.sra SRR ids: ['SRR7804202.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3oogsjpl SRR7804202.sra spots: 25005879 blocks: [[1, 1250293], [1250294, 2500586], [2500587, 3750879], [3750880, 5001172], [5001173, 6251465], [6251466, 7501758], [7501759, 8752051], [8752052, 10002344], [10002345, 11252637], [11252638, 12502930], [12502931, 13753223], [13753224, 15003516], [15003517, 16253809], [16253810, 17504102], [17504103, 18754395], [18754396, 20004688], [20004689, 21254981], [21254982, 22505274], [22505275, 23755567], [23755568, 25005879]] SRR7804202 file size 8451971 SRR7804202 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804202 SRR7804202_1.fastq SRR7804202_2.fastq Input file: SRR7804202_1.fastq Paired file: SRR7804202_2.fastq trimmed: SRR7804202-trimmed-pair1.fastq, SRR7804202-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:01:51 2024 >> started Tue Dec 10 04:02:19 2024 >> done (27.839s) 25005879 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 631 ( 0.00%) empty read pairs filtered out after trimming by size control 25005183 (100.00%) read pairs available; of these: 697649 ( 2.79%) trimmed read pairs available after processing 24307534 (97.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 9 0.00% 21 17 0.00% 22 22 0.00% 23 17 0.00% 24 18 0.00% 25 25 0.00% 26 31 0.00% 27 25 0.00% 28 32 0.00% 29 19 0.00% 30 38 0.00% 31 37 0.00% 32 32 0.00% 33 39 0.00% 34 44 0.00% 35 48 0.00% 36 29 0.00% 37 44 0.00% 38 38 0.00% 39 37 0.00% 40 49 0.00% 41 40 0.00% 42 45 0.00% 43 47 0.00% 44 61 0.00% 45 45 0.00% 46 47 0.00% 47 59 0.00% 48 62 0.00% 49 61 0.00% 50 66 0.00% 51 50 0.00% 52 59 0.00% 53 66 0.00% 54 73 0.00% 55 78 0.00% 56 87 0.00% 57 76 0.00% 58 78 0.00% 59 76 0.00% 60 94 0.00% 61 94 0.00% 62 75 0.00% 63 100 0.00% 64 93 0.00% 65 90 0.00% 66 114 0.00% 67 118 0.00% 68 130 0.00% 69 107 0.00% 70 139 0.00% 71 136 0.00% 72 150 0.00% 73 172 0.00% 74 193 0.00% 75 185 0.00% 76 242 0.00% 77 288 0.00% 78 276 0.00% 79 313 0.00% 80 353 0.00% 81 380 0.00% 82 449 0.00% 83 478 0.00% 84 528 0.00% 85 559 0.00% 86 687 0.00% 87 678 0.00% 88 799 0.00% 89 877 0.00% 90 945 0.00% 91 1059 0.00% 92 1241 0.00% 93 1346 0.01% 94 1525 0.01% 95 1685 0.01% 96 1813 0.01% 97 1941 0.01% 98 2030 0.01% 99 2382 0.01% 100 2442 0.01% 101 2753 0.01% 102 2898 0.01% 103 3172 0.01% 104 3473 0.01% 105 3794 0.02% 106 3951 0.02% 107 4226 0.02% 108 4559 0.02% 109 4806 0.02% 110 5201 0.02% 111 5392 0.02% 112 6040 0.02% 113 6124 0.02% 114 6862 0.03% 115 7054 0.03% 116 7586 0.03% 117 7665 0.03% 118 8044 0.03% 119 8224 0.03% 120 8883 0.04% 121 9588 0.04% 122 9872 0.04% 123 10418 0.04% 124 11238 0.04% 125 11688 0.05% 126 12240 0.05% 127 12577 0.05% 128 12982 0.05% 129 13811 0.06% 130 14025 0.06% 131 15138 0.06% 132 15668 0.06% 133 16318 0.07% 134 16946 0.07% 135 18208 0.07% 136 18734 0.07% 137 19449 0.08% 138 20025 0.08% 139 20567 0.08% 140 20820 0.08% 141 21545 0.09% 142 22551 0.09% 143 23324 0.09% 144 24591 0.10% 145 25783 0.10% 146 26219 0.10% 147 27404 0.11% 148 28026 0.11% 149 28204 0.11% 150 29836 0.12% 151 24307534 97.21% 25005183 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.72 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=65.25 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=4.4 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=19 prefix-density=0.99 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=14.29 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR7804202 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:03:12 Started mapping on | Dec 10 04:03:12 Finished on | Dec 10 04:08:57 Mapping speed, Million of reads per hour | 260.92 Number of input reads | 25005183 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20780755 Uniquely mapped reads % | 83.11% Average mapped length | 299.87 Number of splices: Total | 18336065 Number of splices: Annotated (sjdb) | 17310852 Number of splices: GT/AG | 18090224 Number of splices: GC/AG | 210387 Number of splices: AT/AC | 6536 Number of splices: Non-canonical | 28918 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1101669 % of reads mapped to multiple loci | 4.41% Number of reads mapped to too many loci | 133594 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.30% % of reads unmapped: other | 4.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3122759 3122759 3122759 N_multimapping 1101669 1101669 1101669 N_noFeature 1748285 20122692 1900722 N_ambiguous 612055 3077 107636 UnstrandedReadsAssigned:18420415 PositiveStrandReadsAssigned:654986 NegativeStrandReadsAssigned:18772397 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804202 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804202-trimmed-pair1.fastq SRR7804202-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,005,183 reads, 19,316,865 reads pseudoaligned [quant] estimated average fragment length: 320.454 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52973 SRR7804202.ke.tsv 35125 SRR7804202.se.tsv 88098 total ==> SRR7804202.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 617.445 0 0 PNS24247 1044 724.546 56.609 4.41684 PNS24249 1928 1608.55 112.153 3.94156 PNS24246 1044 724.546 56.609 4.41684 PNS24248 1044 724.546 56.609 4.41684 PNS24244 1471 1151.55 165.02 8.10119 PNS24243 293 72.8836 0 0 KQK14069 1603 1283.55 8612.89 379.341 KQK14071 474 193.53 71.9928 21.0298 ==> SRR7804202.se.tsv <== BRADI_1g14170v3 8784 BRADI_1g53295v3 134 BRADI_1g59795v3 644 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 164 BRADI_1g74790v3 282 BRADI_1g09890v3 0 BRADI_1g77505v3 346 BRADI_1g48960v3 0 SRR7804202 completed mapping pipeline successfully