Starting /dee2/code/volunteer_pipeline.sh SRR7804203 current disk space = 1526113243136 free memory = 1602361716 SRR7804203 SRAfilesize 2d4a4276e8234081d1f4c6bdda57674f SRR7804203.sra SRR7804203.sra file validated SRR7804203 is paired end SRR7804203 is conventional basespace SRR7804203 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804203_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1745 37.0 37.0 37.0 37.0 37.0 2 36.2535 37.0 37.0 37.0 37.0 37.0 3 36.472 37.0 37.0 37.0 37.0 37.0 4 36.5115 37.0 37.0 37.0 37.0 37.0 5 36.5315 37.0 37.0 37.0 37.0 37.0 6 36.618 37.0 37.0 37.0 37.0 37.0 7 36.4055 37.0 37.0 37.0 37.0 37.0 8 36.5685 37.0 37.0 37.0 37.0 37.0 9 36.4595 37.0 37.0 37.0 37.0 37.0 10-14 36.547 37.0 37.0 37.0 37.0 37.0 15-19 36.5168 37.0 37.0 37.0 37.0 37.0 20-24 36.542100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.47 37.0 37.0 37.0 37.0 37.0 30-34 36.465199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4154 37.0 37.0 37.0 37.0 37.0 40-44 36.3953 37.0 37.0 37.0 37.0 37.0 45-49 36.3997 37.0 37.0 37.0 37.0 37.0 50-54 36.3248 37.0 37.0 37.0 37.0 37.0 55-59 36.277300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.282 37.0 37.0 37.0 37.0 37.0 65-69 36.23720000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.1996 37.0 37.0 37.0 37.0 37.0 75-79 36.201800000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.1453 37.0 37.0 37.0 37.0 37.0 85-89 36.1007 37.0 37.0 37.0 37.0 37.0 90-94 36.0698 37.0 37.0 37.0 37.0 37.0 95-99 35.959999999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.9587 37.0 37.0 37.0 37.0 37.0 105-109 35.91519999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.901599999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.788799999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.69199999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.677 37.0 37.0 37.0 37.0 37.0 130-134 35.525400000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.43429999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.478899999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.32 37.0 37.0 37.0 32.2 37.0 150-151 34.696250000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 3.0 26 5.0 27 9.0 28 19.0 29 30.0 30 31.0 31 57.0 32 47.0 33 90.0 34 157.0 35 415.0 36 2878.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.2964824120603 13.266331658291458 10.0 42.437185929648244 2 23.1 20.075000000000003 37.95 18.875 3 21.0 25.650000000000002 23.75 29.599999999999998 4 24.725 32.35 19.625 23.3 5 25.575 33.575 21.224999999999998 19.625 6 19.225 35.15 23.325000000000003 22.3 7 16.475 20.775 41.9 20.849999999999998 8 20.724999999999998 18.775 26.85 33.650000000000006 9 20.849999999999998 19.25 31.65 28.249999999999996 10-14 22.615 26.96 24.295 26.13 15-19 23.06 25.745 25.314999999999998 25.88 20-24 23.255 26.085 24.935 25.724999999999998 25-29 23.1 25.740000000000002 25.424999999999997 25.735000000000003 30-34 22.745 26.145000000000003 25.180000000000003 25.929999999999996 35-39 23.07 25.605 25.495 25.83 40-44 23.455000000000002 25.75 24.87 25.924999999999997 45-49 23.285 25.840000000000003 25.1 25.775 50-54 23.549999999999997 26.090000000000003 24.995 25.365 55-59 23.330000000000002 26.135 24.485 26.05 60-64 23.080000000000002 25.650000000000002 25.0 26.27 65-69 23.325000000000003 25.629999999999995 25.25 25.795 70-74 23.89 25.869999999999997 24.455 25.785000000000004 75-79 23.345 25.27 25.205 26.179999999999996 80-84 24.165 25.195 24.89 25.75 85-89 24.215 25.45 24.490000000000002 25.845000000000002 90-94 23.5 25.445 24.529999999999998 26.525 95-99 23.715 25.165 25.509999999999998 25.61 100-104 23.82 25.03 24.86 26.290000000000003 105-109 23.555 25.180000000000003 24.935 26.33 110-114 23.895 24.884999999999998 24.975 26.245 115-119 23.97 24.884999999999998 24.82 26.325 120-124 23.380000000000003 25.040000000000003 25.080000000000002 26.5 125-129 24.240000000000002 25.055 24.895 25.81 130-134 24.58 24.875 24.349999999999998 26.195 135-139 24.465 24.765 24.345 26.424999999999997 140-144 24.834999999999997 24.63 24.77 25.765 145-149 24.575 24.654999999999998 24.435000000000002 26.334999999999997 150-151 24.15 24.875 24.212500000000002 26.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 4.0 29 7.5 30 8.5 31 9.0 32 14.5 33 23.0 34 29.5 35 39.5 36 62.5 37 78.0 38 84.5 39 97.5 40 120.5 41 151.5 42 167.5 43 180.5 44 203.0 45 196.0 46 182.5 47 180.0 48 174.0 49 165.5 50 157.0 51 150.0 52 159.5 53 156.5 54 133.0 55 113.0 56 92.0 57 71.5 58 62.0 59 72.5 60 64.5 61 50.5 62 58.0 63 57.5 64 49.0 65 50.0 66 42.5 67 42.0 68 42.5 69 35.5 70 34.0 71 32.5 72 27.0 73 19.5 74 17.5 75 14.0 76 5.5 77 2.0 78 2.0 79 1.5 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.25292740046838 92.475 2 3.434816549570648 6.6000000000000005 3 0.28623471246422066 0.8250000000000001 4 0.026021337496747333 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.55 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.6375 0.0 0.0 0.0 0.0 132-133 0.7125 0.0 0.0 0.0 0.0 134-135 0.8125 0.0 0.0 0.0 0.0 136-137 0.95 0.0 0.0 0.0 0.0 138-139 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAACA 10 0.006830828 145.0 2 GTCAAAT 10 0.006830828 145.0 1 >>END_MODULE SRR7804203 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804203_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.407 37.0 37.0 37.0 37.0 37.0 2 36.2615 37.0 37.0 37.0 37.0 37.0 3 36.196 37.0 37.0 37.0 37.0 37.0 4 36.2885 37.0 37.0 37.0 37.0 37.0 5 36.3905 37.0 37.0 37.0 37.0 37.0 6 36.299 37.0 37.0 37.0 37.0 37.0 7 36.218 37.0 37.0 37.0 37.0 37.0 8 36.455 37.0 37.0 37.0 37.0 37.0 9 36.4145 37.0 37.0 37.0 37.0 37.0 10-14 36.3411 37.0 37.0 37.0 37.0 37.0 15-19 36.2641 37.0 37.0 37.0 37.0 37.0 20-24 36.261100000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.226 37.0 37.0 37.0 37.0 37.0 30-34 36.15659999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.085899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1494 37.0 37.0 37.0 37.0 37.0 45-49 36.052 37.0 37.0 37.0 37.0 37.0 50-54 35.986799999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.978300000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.8165 37.0 37.0 37.0 37.0 37.0 65-69 35.7984 37.0 37.0 37.0 37.0 37.0 70-74 35.7946 37.0 37.0 37.0 37.0 37.0 75-79 35.8011 37.0 37.0 37.0 37.0 37.0 80-84 35.657799999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.665600000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.5712 37.0 37.0 37.0 37.0 37.0 95-99 35.48729999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.4066 37.0 37.0 37.0 37.0 37.0 105-109 35.418400000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.295100000000005 37.0 37.0 37.0 32.2 37.0 115-119 35.1456 37.0 37.0 37.0 25.0 37.0 120-124 35.1813 37.0 37.0 37.0 27.4 37.0 125-129 35.0714 37.0 37.0 37.0 25.0 37.0 130-134 35.0062 37.0 37.0 37.0 25.0 37.0 135-139 34.83390000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.689499999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.591699999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.80625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 5.0 23 10.0 24 4.0 25 8.0 26 8.0 27 17.0 28 21.0 29 16.0 30 30.0 31 56.0 32 70.0 33 151.0 34 292.0 35 822.0 36 2399.0 37 84.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.275 12.025 13.15 41.55 2 28.050000000000004 19.400000000000002 31.374999999999996 21.175 3 22.6 22.325 27.150000000000002 27.925 4 27.025 30.65 16.775000000000002 25.55 5 28.275 32.574999999999996 18.675 20.474999999999998 6 20.599999999999998 33.525 20.25 25.624999999999996 7 20.025000000000002 15.45 38.824999999999996 25.7 8 22.175 19.25 21.925 36.65 9 23.875 20.4 25.624999999999996 30.099999999999998 10-14 25.885 25.095 22.365 26.655 15-19 25.6 23.880000000000003 23.580000000000002 26.939999999999998 20-24 25.124999999999996 24.36 23.635 26.88 25-29 25.785000000000004 24.515 23.29 26.41 30-34 26.275 24.265 23.09 26.369999999999997 35-39 25.979999999999997 24.09 23.34 26.590000000000003 40-44 25.835 24.485 23.385 26.295 45-49 26.05 24.435000000000002 23.575 25.94 50-54 26.174999999999997 24.25 23.72 25.855 55-59 26.650000000000002 24.44 23.225 25.685000000000002 60-64 26.455000000000002 24.325 23.895 25.324999999999996 65-69 27.11 24.654999999999998 23.085 25.15 70-74 26.295 24.529999999999998 23.655 25.52 75-79 26.56 24.305 23.89 25.245 80-84 26.615 25.665 23.085 24.635 85-89 27.1 24.935 23.36 24.605 90-94 26.91 24.585 23.14 25.365 95-99 26.86 24.58 23.24 25.319999999999997 100-104 26.735 24.555 23.57 25.14 105-109 27.515 24.605 23.555 24.325 110-114 26.735 24.995 22.939999999999998 25.330000000000002 115-119 26.27 24.75 23.615 25.365 120-124 26.590000000000003 24.279999999999998 23.77 25.36 125-129 26.400000000000002 24.23 24.635 24.735 130-134 27.42 23.955000000000002 24.240000000000002 24.385 135-139 26.55 24.51 24.605 24.335 140-144 26.805 25.180000000000003 23.445 24.57 145-149 26.695 24.990000000000002 23.885 24.43 150-151 26.950000000000003 25.074999999999996 23.3375 24.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 1.5 26 1.0 27 1.0 28 1.5 29 3.0 30 5.0 31 5.5 32 6.0 33 12.5 34 17.5 35 19.5 36 35.0 37 53.0 38 60.5 39 77.0 40 103.0 41 115.0 42 120.0 43 147.5 44 164.0 45 162.5 46 165.5 47 152.5 48 157.5 49 164.0 50 154.0 51 148.0 52 137.5 53 124.0 54 105.5 55 104.5 56 105.5 57 100.0 58 94.0 59 84.0 60 88.0 61 85.0 62 87.5 63 90.0 64 84.0 65 81.0 66 75.5 67 80.0 68 77.0 69 67.5 70 57.0 71 49.0 72 40.0 73 33.0 74 29.5 75 19.5 76 11.5 77 7.5 78 7.0 79 6.5 80 4.0 81 1.5 82 0.5 83 0.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.025 #Duplication Level Percentage of deduplicated Percentage of total 1 96.22494142150482 92.4 2 3.4626399375162715 6.65 3 0.2603488674824264 0.75 4 0.0520697734964853 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.21250000000000002 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.5375000000000001 0.0 0.0 0.0 0.0 128-129 0.575 0.0 0.0 0.0 0.0 130-131 0.6625000000000001 0.0 0.0 0.0 0.0 132-133 0.7375 0.0 0.0 0.0 0.0 134-135 0.8375 0.0 0.0 0.0 0.0 136-137 0.975 0.0 0.0 0.0 0.0 138-139 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGGA 10 0.006830828 145.0 7 >>END_MODULE Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263749 spots for SRR7804203.sra Written 2263749 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra Read 2263740 spots for SRR7804203.sra Written 2263740 spots for SRR7804203.sra SRR ids: ['SRR7804203.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jabshjzd SRR7804203.sra spots: 45274809 blocks: [[1, 2263740], [2263741, 4527480], [4527481, 6791220], [6791221, 9054960], [9054961, 11318700], [11318701, 13582440], [13582441, 15846180], [15846181, 18109920], [18109921, 20373660], [20373661, 22637400], [22637401, 24901140], [24901141, 27164880], [27164881, 29428620], [29428621, 31692360], [31692361, 33956100], [33956101, 36219840], [36219841, 38483580], [38483581, 40747320], [40747321, 43011060], [43011061, 45274809]] SRR7804203 file size 15320446 SRR7804203 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804203 SRR7804203_1.fastq SRR7804203_2.fastq Input file: SRR7804203_1.fastq Paired file: SRR7804203_2.fastq trimmed: SRR7804203-trimmed-pair1.fastq, SRR7804203-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:07:51 2024 >> started Tue Dec 10 04:08:47 2024 >> done (55.781s) 45274809 read pairs processed; of these: 97 ( 0.00%) short read pairs filtered out after trimming by size control 702 ( 0.00%) empty read pairs filtered out after trimming by size control 45274010 (100.00%) read pairs available; of these: 1038318 ( 2.29%) trimmed read pairs available after processing 44235692 (97.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 15 0.00% 20 18 0.00% 21 20 0.00% 22 37 0.00% 23 31 0.00% 24 29 0.00% 25 38 0.00% 26 31 0.00% 27 41 0.00% 28 49 0.00% 29 38 0.00% 30 58 0.00% 31 60 0.00% 32 53 0.00% 33 50 0.00% 34 60 0.00% 35 63 0.00% 36 55 0.00% 37 65 0.00% 38 62 0.00% 39 75 0.00% 40 82 0.00% 41 75 0.00% 42 67 0.00% 43 79 0.00% 44 75 0.00% 45 82 0.00% 46 100 0.00% 47 74 0.00% 48 90 0.00% 49 58 0.00% 50 95 0.00% 51 72 0.00% 52 101 0.00% 53 114 0.00% 54 111 0.00% 55 108 0.00% 56 120 0.00% 57 127 0.00% 58 120 0.00% 59 135 0.00% 60 130 0.00% 61 127 0.00% 62 142 0.00% 63 152 0.00% 64 158 0.00% 65 162 0.00% 66 168 0.00% 67 175 0.00% 68 204 0.00% 69 186 0.00% 70 208 0.00% 71 207 0.00% 72 278 0.00% 73 244 0.00% 74 248 0.00% 75 251 0.00% 76 291 0.00% 77 316 0.00% 78 344 0.00% 79 397 0.00% 80 415 0.00% 81 452 0.00% 82 509 0.00% 83 592 0.00% 84 601 0.00% 85 668 0.00% 86 776 0.00% 87 878 0.00% 88 981 0.00% 89 1074 0.00% 90 1149 0.00% 91 1262 0.00% 92 1489 0.00% 93 1523 0.00% 94 1696 0.00% 95 1973 0.00% 96 2073 0.00% 97 2373 0.01% 98 2554 0.01% 99 2681 0.01% 100 3115 0.01% 101 3351 0.01% 102 3569 0.01% 103 4003 0.01% 104 4350 0.01% 105 4869 0.01% 106 5270 0.01% 107 5464 0.01% 108 5867 0.01% 109 6400 0.01% 110 6743 0.01% 111 7488 0.02% 112 7796 0.02% 113 8538 0.02% 114 8987 0.02% 115 9764 0.02% 116 10335 0.02% 117 10779 0.02% 118 11613 0.03% 119 12331 0.03% 120 12635 0.03% 121 13628 0.03% 122 14466 0.03% 123 15406 0.03% 124 16455 0.04% 125 16822 0.04% 126 17946 0.04% 127 18980 0.04% 128 19558 0.04% 129 20847 0.05% 130 21375 0.05% 131 22198 0.05% 132 23768 0.05% 133 24535 0.05% 134 25992 0.06% 135 26918 0.06% 136 28484 0.06% 137 29048 0.06% 138 30579 0.07% 139 31206 0.07% 140 32227 0.07% 141 33332 0.07% 142 35196 0.08% 143 36114 0.08% 144 37842 0.08% 145 39822 0.09% 146 40809 0.09% 147 42355 0.09% 148 44275 0.10% 149 45246 0.10% 150 46676 0.10% 151 44235692 97.71% 45274010 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=12.31 fanout-score-rank=19 prefix-density=0.38 prefix-fanout=6.9 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCGGCAAACTTCACGGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTGAGATCCTTCACAGCAAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=351.38 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=29.4 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=30 prefix-density=0.66 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=620.25 fanout-score-rank=1 prefix-density=1.29 prefix-fanout=18.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804203 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:09:38 Started mapping on | Dec 10 04:09:38 Finished on | Dec 10 04:16:10 Mapping speed, Million of reads per hour | 415.78 Number of input reads | 45274010 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 43199280 Uniquely mapped reads % | 95.42% Average mapped length | 300.19 Number of splices: Total | 47126903 Number of splices: Annotated (sjdb) | 44200177 Number of splices: GT/AG | 46502810 Number of splices: GC/AG | 526484 Number of splices: AT/AC | 38240 Number of splices: Non-canonical | 59369 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.68 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 693244 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 38654 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1381486 1381486 1381486 N_multimapping 693244 693244 693244 N_noFeature 1099860 42118330 1481845 N_ambiguous 838035 7112 142471 UnstrandedReadsAssigned:41261385 PositiveStrandReadsAssigned:1073838 NegativeStrandReadsAssigned:41574964 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804203 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804203-trimmed-pair1.fastq SRR7804203-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,274,010 reads, 42,016,351 reads pseudoaligned [quant] estimated average fragment length: 330.009 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 SRR7804203.ke.tsv 35125 SRR7804203.se.tsv 88098 total ==> SRR7804203.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 608.326 0 0 PNS24247 1044 714.991 150.147 6.38083 PNS24249 1928 1598.99 394.78 7.50188 PNS24246 1044 714.991 150.147 6.38083 PNS24248 1044 714.991 150.147 6.38083 PNS24244 1471 1141.99 287.778 7.65695 PNS24243 293 70.8293 0 0 KQK14069 1603 1273.99 9028.63 215.336 KQK14071 474 190.847 70.4537 11.2171 ==> SRR7804203.se.tsv <== BRADI_1g14170v3 9520 BRADI_1g53295v3 285 BRADI_1g59795v3 899 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 4450 BRADI_1g74790v3 175 BRADI_1g09890v3 0 BRADI_1g77505v3 575 BRADI_1g48960v3 0 SRR7804203 completed mapping pipeline successfully