Starting /dee2/code/volunteer_pipeline.sh SRR7804204 current disk space = 1526154035200 free memory = 1556455848 SRR7804204 SRAfilesize e382a423c7d4e49cb03bed1c3fa9f74a SRR7804204.sra SRR7804204.sra file validated SRR7804204 is paired end SRR7804204 is conventional basespace SRR7804204 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804204_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1055 37.0 37.0 37.0 37.0 37.0 2 36.285 37.0 37.0 37.0 37.0 37.0 3 36.4365 37.0 37.0 37.0 37.0 37.0 4 36.4845 37.0 37.0 37.0 37.0 37.0 5 36.5235 37.0 37.0 37.0 37.0 37.0 6 36.4205 37.0 37.0 37.0 37.0 37.0 7 36.34 37.0 37.0 37.0 37.0 37.0 8 36.453 37.0 37.0 37.0 37.0 37.0 9 36.402 37.0 37.0 37.0 37.0 37.0 10-14 36.4935 37.0 37.0 37.0 37.0 37.0 15-19 36.4351 37.0 37.0 37.0 37.0 37.0 20-24 36.4802 37.0 37.0 37.0 37.0 37.0 25-29 36.3609 37.0 37.0 37.0 37.0 37.0 30-34 36.375299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.35359999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.313900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.2555 37.0 37.0 37.0 37.0 37.0 50-54 36.2319 37.0 37.0 37.0 37.0 37.0 55-59 36.1584 37.0 37.0 37.0 37.0 37.0 60-64 36.173 37.0 37.0 37.0 37.0 37.0 65-69 36.1473 37.0 37.0 37.0 37.0 37.0 70-74 36.093700000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0928 37.0 37.0 37.0 37.0 37.0 80-84 36.0547 37.0 37.0 37.0 37.0 37.0 85-89 36.0656 37.0 37.0 37.0 37.0 37.0 90-94 35.9422 37.0 37.0 37.0 37.0 37.0 95-99 35.8488 37.0 37.0 37.0 37.0 37.0 100-104 35.852999999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.801 37.0 37.0 37.0 37.0 37.0 110-114 35.7979 37.0 37.0 37.0 37.0 37.0 115-119 35.7211 37.0 37.0 37.0 37.0 37.0 120-124 35.603300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.633799999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.4946 37.0 37.0 37.0 37.0 37.0 135-139 35.4309 37.0 37.0 37.0 34.6 37.0 140-144 35.3903 37.0 37.0 37.0 34.6 37.0 145-149 35.249399999999994 37.0 37.0 37.0 29.8 37.0 150-151 34.67475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 2.0 24 5.0 25 3.0 26 11.0 27 9.0 28 10.0 29 26.0 30 48.0 31 53.0 32 67.0 33 108.0 34 174.0 35 453.0 36 2768.0 37 262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.626506024096386 11.119477911646586 12.550200803212853 44.70381526104418 2 24.7 17.1 34.925 23.275000000000002 3 22.7 23.875 23.200000000000003 30.225 4 26.450000000000003 30.8 17.75 25.0 5 25.775 32.775 21.375 20.075000000000003 6 19.3 34.75 23.3 22.650000000000002 7 16.400000000000002 21.575 41.375 20.65 8 19.8 22.05 27.800000000000004 30.349999999999998 9 21.125 20.549999999999997 30.25 28.075 10-14 22.82 28.09 23.880000000000003 25.21 15-19 22.785 25.695 25.385 26.135 20-24 22.89 26.290000000000003 24.66 26.16 25-29 23.145 26.715 24.425 25.715 30-34 23.1 25.81 24.905 26.185000000000002 35-39 22.735 26.450000000000003 24.45 26.365 40-44 23.835 26.165 24.365000000000002 25.635 45-49 23.24 25.430000000000003 24.955 26.375 50-54 23.77 25.83 24.51 25.89 55-59 24.22 25.419999999999998 24.83 25.53 60-64 23.84 25.424999999999997 24.965 25.77 65-69 23.51 25.990000000000002 24.695 25.805 70-74 23.61 25.330000000000002 24.72 26.340000000000003 75-79 23.895 25.264999999999997 24.42 26.419999999999998 80-84 23.91 25.624999999999996 24.224999999999998 26.240000000000002 85-89 23.66 25.564999999999998 24.245 26.529999999999998 90-94 23.78 25.055 24.709999999999997 26.455000000000002 95-99 24.7 24.779999999999998 24.33 26.19 100-104 23.775 25.345000000000002 24.77 26.11 105-109 24.325 24.75 24.855 26.07 110-114 24.725 24.595 24.48 26.200000000000003 115-119 24.154999999999998 24.73 24.635 26.479999999999997 120-124 24.735 24.98 23.849999999999998 26.435 125-129 24.625 24.66 23.875 26.840000000000003 130-134 24.33 24.529999999999998 24.46 26.68 135-139 24.97 24.745 24.43 25.855 140-144 24.97 24.41 24.310000000000002 26.31 145-149 24.595 24.505 24.395 26.505000000000003 150-151 25.0 25.0 22.900000000000002 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 0.0 27 1.0 28 3.5 29 5.5 30 8.0 31 9.0 32 11.5 33 20.5 34 34.0 35 42.5 36 47.0 37 64.0 38 84.0 39 103.5 40 127.5 41 143.5 42 152.5 43 163.5 44 183.0 45 191.0 46 194.0 47 196.5 48 188.5 49 165.5 50 154.0 51 155.5 52 141.5 53 141.5 54 136.0 55 113.5 56 99.0 57 91.0 58 78.5 59 69.0 60 64.5 61 59.0 62 55.0 63 49.0 64 49.5 65 55.0 66 52.0 67 40.0 68 36.5 69 38.5 70 37.0 71 31.0 72 28.0 73 30.5 74 19.5 75 8.5 76 5.5 77 4.5 78 6.0 79 4.5 80 1.0 81 0.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.90078328981724 91.825 2 3.7859007832898173 7.249999999999999 3 0.28720626631853785 0.8250000000000001 4 0.02610966057441253 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.7124999999999999 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.175 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.4249999999999998 0.0 0.0 0.0 0.0 136-137 1.575 0.0 0.0 0.0 0.0 138-139 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTTA 10 0.006830828 145.0 145 TTTTCTG 10 0.006830828 145.0 2 ACACCTC 10 0.006830828 145.0 9 CTGACAC 10 0.006830828 145.0 6 GACACCT 10 0.006830828 145.0 8 TCTGACA 10 0.006830828 145.0 5 GCCACTC 10 0.006830828 145.0 2 >>END_MODULE SRR7804204 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804204_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3355 37.0 37.0 37.0 37.0 37.0 2 36.156 37.0 37.0 37.0 37.0 37.0 3 36.2645 37.0 37.0 37.0 37.0 37.0 4 36.352 37.0 37.0 37.0 37.0 37.0 5 36.4205 37.0 37.0 37.0 37.0 37.0 6 36.267 37.0 37.0 37.0 37.0 37.0 7 36.25 37.0 37.0 37.0 37.0 37.0 8 36.367 37.0 37.0 37.0 37.0 37.0 9 36.3205 37.0 37.0 37.0 37.0 37.0 10-14 36.2909 37.0 37.0 37.0 37.0 37.0 15-19 36.232299999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1978 37.0 37.0 37.0 37.0 37.0 25-29 36.1896 37.0 37.0 37.0 37.0 37.0 30-34 36.2141 37.0 37.0 37.0 37.0 37.0 35-39 36.114 37.0 37.0 37.0 37.0 37.0 40-44 36.01809999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.9458 37.0 37.0 37.0 37.0 37.0 50-54 36.0042 37.0 37.0 37.0 37.0 37.0 55-59 35.9851 37.0 37.0 37.0 37.0 37.0 60-64 35.856700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.813 37.0 37.0 37.0 37.0 37.0 70-74 35.8213 37.0 37.0 37.0 37.0 37.0 75-79 35.804700000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.6605 37.0 37.0 37.0 37.0 37.0 85-89 35.6818 37.0 37.0 37.0 37.0 37.0 90-94 35.6345 37.0 37.0 37.0 37.0 37.0 95-99 35.527 37.0 37.0 37.0 37.0 37.0 100-104 35.4758 37.0 37.0 37.0 37.0 37.0 105-109 35.4153 37.0 37.0 37.0 37.0 37.0 110-114 35.239599999999996 37.0 37.0 37.0 27.4 37.0 115-119 35.25920000000001 37.0 37.0 37.0 27.4 37.0 120-124 35.166 37.0 37.0 37.0 25.0 37.0 125-129 35.08059999999999 37.0 37.0 37.0 25.0 37.0 130-134 35.0117 37.0 37.0 37.0 25.0 37.0 135-139 34.7849 37.0 37.0 37.0 25.0 37.0 140-144 34.6178 37.0 37.0 37.0 25.0 37.0 145-149 34.5026 37.0 37.0 37.0 25.0 37.0 150-151 33.96625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 2.0 19 0.0 20 0.0 21 2.0 22 4.0 23 4.0 24 8.0 25 8.0 26 11.0 27 8.0 28 18.0 29 30.0 30 34.0 31 61.0 32 84.0 33 155.0 34 270.0 35 824.0 36 2360.0 37 116.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.2 12.475 15.425 42.9 2 27.474999999999998 18.05 31.924999999999997 22.55 3 23.65 21.7 28.625 26.025 4 26.650000000000002 28.499999999999996 18.075 26.775 5 28.825 29.675 19.400000000000002 22.1 6 22.925 33.275 19.125 24.675 7 21.725 14.75 36.199999999999996 27.325 8 22.55 19.55 24.75 33.15 9 25.724999999999998 19.825 25.174999999999997 29.275000000000002 10-14 25.245 24.915000000000003 22.89 26.950000000000003 15-19 25.695 23.745 23.935000000000002 26.625 20-24 25.474999999999998 23.875 23.995 26.655 25-29 26.32 24.065 23.325000000000003 26.290000000000003 30-34 25.775 24.355 23.44 26.43 35-39 26.314999999999998 24.18 23.09 26.415 40-44 26.779999999999998 24.365000000000002 23.335 25.52 45-49 26.840000000000003 24.14 23.36 25.66 50-54 26.495 24.33 23.315 25.86 55-59 26.295 23.97 24.13 25.605 60-64 26.884999999999998 24.52 23.32 25.275 65-69 26.995 24.54 23.48 24.985 70-74 26.735 24.36 23.265 25.64 75-79 26.695 24.51 23.630000000000003 25.165 80-84 27.47 24.47 23.56 24.5 85-89 27.139999999999997 24.7 23.225 24.935 90-94 27.200000000000003 24.65 23.225 24.925 95-99 27.055 24.135 23.294999999999998 25.515 100-104 27.435 23.82 23.575 25.169999999999998 105-109 26.68 24.490000000000002 24.13 24.7 110-114 27.21 24.595 23.865 24.33 115-119 26.88 24.185000000000002 23.995 24.94 120-124 26.575 24.38 24.03 25.014999999999997 125-129 27.060000000000002 24.060000000000002 24.279999999999998 24.6 130-134 26.705000000000002 25.275 23.44 24.58 135-139 27.025 24.55 23.925 24.5 140-144 26.784999999999997 24.255 24.5 24.46 145-149 27.339999999999996 24.785 23.805 24.07 150-151 27.175 23.8375 23.6375 25.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 3.0 28 4.5 29 4.5 30 4.0 31 4.5 32 5.5 33 12.5 34 16.0 35 16.5 36 24.0 37 40.0 38 62.5 39 74.0 40 89.5 41 103.5 42 119.5 43 139.0 44 146.0 45 156.5 46 168.5 47 180.0 48 174.5 49 173.5 50 168.0 51 155.5 52 147.0 53 122.5 54 119.5 55 115.5 56 95.5 57 92.5 58 97.0 59 98.5 60 94.0 61 83.5 62 88.5 63 81.5 64 75.5 65 79.5 66 73.0 67 70.0 68 60.5 69 52.5 70 50.5 71 52.0 72 46.0 73 36.5 74 33.0 75 27.5 76 18.0 77 11.5 78 7.5 79 5.0 80 3.0 81 1.0 82 1.5 83 1.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 95.89112797696939 91.60000000000001 2 3.7424757916775713 7.1499999999999995 3 0.23554043444124576 0.675 4 0.05234231876472127 0.2 5 0.07851347814708191 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTCTTCCTCAG 5 0.125 No Hit CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 5 0.125 No Hit GAAACATCCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.65 0.0 0.0 0.0 0.0 138-139 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAA 10 0.006830828 145.0 3 CCTGCTC 10 0.006830828 145.0 8 ACACACA 10 0.006830828 145.0 2 TGGGGAG 10 0.006830828 145.0 5 GTGGGGA 10 0.006830828 145.0 4 GGGGAGT 10 0.006830828 145.0 6 TGCAAGT 20 0.00593511 29.0 105-109 AAAAAAA 20 0.00593511 29.0 110-114 TGCGGCA 20 0.00593511 29.0 110-114 >>END_MODULE Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656432 spots for SRR7804204.sra Written 1656432 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra Read 1656424 spots for SRR7804204.sra Written 1656424 spots for SRR7804204.sra SRR ids: ['SRR7804204.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9h9n_cqm SRR7804204.sra spots: 33128488 blocks: [[1, 1656424], [1656425, 3312848], [3312849, 4969272], [4969273, 6625696], [6625697, 8282120], [8282121, 9938544], [9938545, 11594968], [11594969, 13251392], [13251393, 14907816], [14907817, 16564240], [16564241, 18220664], [18220665, 19877088], [19877089, 21533512], [21533513, 23189936], [23189937, 24846360], [24846361, 26502784], [26502785, 28159208], [28159209, 29815632], [29815633, 31472056], [31472057, 33128488]] SRR7804204 file size 11204457 SRR7804204 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804204 SRR7804204_1.fastq SRR7804204_2.fastq Input file: SRR7804204_1.fastq Paired file: SRR7804204_2.fastq trimmed: SRR7804204-trimmed-pair1.fastq, SRR7804204-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:06:00 2024 >> started Tue Dec 10 04:06:42 2024 >> done (41.526s) 33128488 read pairs processed; of these: 141 ( 0.00%) short read pairs filtered out after trimming by size control 24784 ( 0.07%) empty read pairs filtered out after trimming by size control 33103563 (99.92%) read pairs available; of these: 1089279 ( 3.29%) trimmed read pairs available after processing 32014284 (96.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 17 0.00% 20 7 0.00% 21 13 0.00% 22 14 0.00% 23 20 0.00% 24 30 0.00% 25 21 0.00% 26 33 0.00% 27 32 0.00% 28 28 0.00% 29 28 0.00% 30 39 0.00% 31 40 0.00% 32 40 0.00% 33 44 0.00% 34 50 0.00% 35 55 0.00% 36 48 0.00% 37 59 0.00% 38 63 0.00% 39 60 0.00% 40 52 0.00% 41 53 0.00% 42 60 0.00% 43 85 0.00% 44 59 0.00% 45 63 0.00% 46 76 0.00% 47 80 0.00% 48 68 0.00% 49 75 0.00% 50 74 0.00% 51 68 0.00% 52 110 0.00% 53 79 0.00% 54 90 0.00% 55 104 0.00% 56 99 0.00% 57 111 0.00% 58 109 0.00% 59 115 0.00% 60 122 0.00% 61 133 0.00% 62 162 0.00% 63 127 0.00% 64 135 0.00% 65 145 0.00% 66 139 0.00% 67 194 0.00% 68 191 0.00% 69 208 0.00% 70 269 0.00% 71 243 0.00% 72 287 0.00% 73 278 0.00% 74 305 0.00% 75 345 0.00% 76 370 0.00% 77 409 0.00% 78 447 0.00% 79 572 0.00% 80 556 0.00% 81 623 0.00% 82 736 0.00% 83 858 0.00% 84 916 0.00% 85 943 0.00% 86 1152 0.00% 87 1311 0.00% 88 1349 0.00% 89 1538 0.00% 90 1694 0.01% 91 1897 0.01% 92 2151 0.01% 93 2352 0.01% 94 2627 0.01% 95 2901 0.01% 96 3084 0.01% 97 3322 0.01% 98 3642 0.01% 99 3865 0.01% 100 4334 0.01% 101 4677 0.01% 102 5000 0.02% 103 5434 0.02% 104 5873 0.02% 105 6307 0.02% 106 6834 0.02% 107 6889 0.02% 108 7369 0.02% 109 7723 0.02% 110 8283 0.03% 111 8641 0.03% 112 9320 0.03% 113 9917 0.03% 114 10617 0.03% 115 11309 0.03% 116 11626 0.04% 117 12447 0.04% 118 12928 0.04% 119 13359 0.04% 120 13948 0.04% 121 14839 0.04% 122 15581 0.05% 123 16471 0.05% 124 17466 0.05% 125 18470 0.06% 126 19299 0.06% 127 20251 0.06% 128 20480 0.06% 129 21403 0.06% 130 22048 0.07% 131 22799 0.07% 132 23681 0.07% 133 24775 0.07% 134 26544 0.08% 135 27598 0.08% 136 29436 0.09% 137 29941 0.09% 138 30780 0.09% 139 31660 0.10% 140 32233 0.10% 141 32987 0.10% 142 34798 0.11% 143 35513 0.11% 144 36994 0.11% 145 38974 0.12% 146 40960 0.12% 147 42310 0.13% 148 43589 0.13% 149 44135 0.13% 150 45450 0.14% 151 32014284 96.71% 33103563 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=35 prefix-density=0.32 prefix-fanout=3.3 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=10 fanout-score=325.60 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=29.4 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=26 prefix-density=0.72 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=735.03 fanout-score-rank=1 prefix-density=1.19 prefix-fanout=19.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR7804204 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:07:35 Started mapping on | Dec 10 04:07:35 Finished on | Dec 10 04:12:37 Mapping speed, Million of reads per hour | 394.61 Number of input reads | 33103563 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 31253495 Uniquely mapped reads % | 94.41% Average mapped length | 299.79 Number of splices: Total | 31359292 Number of splices: Annotated (sjdb) | 29358388 Number of splices: GT/AG | 30944153 Number of splices: GC/AG | 350106 Number of splices: AT/AC | 24683 Number of splices: Non-canonical | 40350 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.68 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 476188 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 36291 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1373880 1373880 1373880 N_multimapping 476188 476188 476188 N_noFeature 759081 30414935 1050538 N_ambiguous 647408 5141 102946 UnstrandedReadsAssigned:29847006 PositiveStrandReadsAssigned:833419 NegativeStrandReadsAssigned:30100011 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804204 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804204-trimmed-pair1.fastq SRR7804204-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,103,563 reads, 30,418,035 reads pseudoaligned [quant] estimated average fragment length: 309.828 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR7804204.ke.tsv 35125 SRR7804204.se.tsv 88098 total ==> SRR7804204.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 627.994 0 0 PNS24247 1044 735.172 101.607 5.5628 PNS24249 1928 1619.17 293.134 7.28672 PNS24246 1044 735.172 101.607 5.5628 PNS24248 1044 735.172 101.607 5.5628 PNS24244 1471 1162.17 274.045 9.49095 PNS24243 293 74.5262 1 0.54007 KQK14069 1603 1294.17 7529.03 234.156 KQK14071 474 199.963 62.2828 12.5365 ==> SRR7804204.se.tsv <== BRADI_1g14170v3 7830 BRADI_1g53295v3 174 BRADI_1g59795v3 636 BRADI_1g07683v3 0 BRADI_1g00485v3 74 BRADI_1g20270v3 3062 BRADI_1g74790v3 205 BRADI_1g09890v3 1 BRADI_1g77505v3 458 BRADI_1g48960v3 0 SRR7804204 completed mapping pipeline successfully