Starting /dee2/code/volunteer_pipeline.sh SRR7804205 current disk space = 1526153932800 free memory = 1556638676 SRR7804205 SRAfilesize a90790a8e5bfe1c364f51f841720d1d1 SRR7804205.sra SRR7804205.sra file validated SRR7804205 is paired end SRR7804205 is conventional basespace SRR7804205 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804205_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.175 37.0 37.0 37.0 37.0 37.0 2 36.281 37.0 37.0 37.0 37.0 37.0 3 36.2725 37.0 37.0 37.0 37.0 37.0 4 36.4735 37.0 37.0 37.0 37.0 37.0 5 36.372 37.0 37.0 37.0 37.0 37.0 6 36.46 37.0 37.0 37.0 37.0 37.0 7 36.324 37.0 37.0 37.0 37.0 37.0 8 36.5035 37.0 37.0 37.0 37.0 37.0 9 36.4955 37.0 37.0 37.0 37.0 37.0 10-14 36.5055 37.0 37.0 37.0 37.0 37.0 15-19 36.474599999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4595 37.0 37.0 37.0 37.0 37.0 25-29 36.3605 37.0 37.0 37.0 37.0 37.0 30-34 36.382600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.337 37.0 37.0 37.0 37.0 37.0 40-44 36.277 37.0 37.0 37.0 37.0 37.0 45-49 36.2346 37.0 37.0 37.0 37.0 37.0 50-54 36.255700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1726 37.0 37.0 37.0 37.0 37.0 60-64 36.1592 37.0 37.0 37.0 37.0 37.0 65-69 36.1151 37.0 37.0 37.0 37.0 37.0 70-74 36.053700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.0515 37.0 37.0 37.0 37.0 37.0 80-84 36.0807 37.0 37.0 37.0 37.0 37.0 85-89 35.9411 37.0 37.0 37.0 37.0 37.0 90-94 35.9517 37.0 37.0 37.0 37.0 37.0 95-99 35.8859 37.0 37.0 37.0 37.0 37.0 100-104 35.794799999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.7508 37.0 37.0 37.0 37.0 37.0 110-114 35.7663 37.0 37.0 37.0 37.0 37.0 115-119 35.590199999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.5248 37.0 37.0 37.0 37.0 37.0 125-129 35.4895 37.0 37.0 37.0 37.0 37.0 130-134 35.417699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.3436 37.0 37.0 37.0 37.0 37.0 140-144 35.227599999999995 37.0 37.0 37.0 32.2 37.0 145-149 35.091100000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.4855 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 3.0 25 5.0 26 11.0 27 15.0 28 13.0 29 24.0 30 35.0 31 59.0 32 84.0 33 118.0 34 196.0 35 431.0 36 2744.0 37 259.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.13670505758638 13.545317976965448 9.339008512769153 35.97896845267902 2 25.7 18.325 33.925 22.05 3 21.775 26.174999999999997 22.625 29.425 4 27.750000000000004 30.75 18.05 23.45 5 25.575 32.45 21.525 20.45 6 21.8 32.4 22.625 23.175 7 17.0 20.5 40.0 22.5 8 21.625 18.425 27.725 32.225 9 21.45 17.1 31.075000000000003 30.375000000000004 10-14 24.04 25.765 23.96 26.235000000000003 15-19 24.495 24.365000000000002 24.195 26.945000000000004 20-24 24.38 24.495 24.654999999999998 26.47 25-29 24.044999999999998 25.165 24.515 26.275 30-34 24.349999999999998 25.230000000000004 24.445 25.974999999999998 35-39 24.575 24.645 24.095 26.685 40-44 24.345 24.64 24.41 26.605 45-49 23.915 24.765 24.16 27.16 50-54 24.310000000000002 24.93 23.385 27.375 55-59 25.025 24.22 23.79 26.965 60-64 24.404999999999998 24.14 24.365000000000002 27.089999999999996 65-69 24.43 24.16 24.255 27.155 70-74 24.915000000000003 24.565 23.515 27.005000000000003 75-79 25.319999999999997 24.279999999999998 23.505000000000003 26.895000000000003 80-84 25.374999999999996 23.724999999999998 24.495 26.405 85-89 25.3 23.98 23.825 26.895000000000003 90-94 25.145 24.09 23.544999999999998 27.22 95-99 25.355 24.495 23.705000000000002 26.445 100-104 25.655 24.455 23.244999999999997 26.645000000000003 105-109 25.615 23.715 23.16 27.51 110-114 25.525 24.154999999999998 22.770000000000003 27.55 115-119 25.77 23.655 23.61 26.965 120-124 26.179999999999996 23.985 22.57 27.265 125-129 25.669999999999998 23.595 23.775 26.96 130-134 26.26 23.78 22.965 26.995 135-139 26.045 23.445 23.655 26.855 140-144 26.14 22.95 23.7 27.21 145-149 25.86 23.580000000000002 23.565 26.995 150-151 25.374999999999996 22.8375 23.474999999999998 28.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 2.0 27 2.5 28 3.0 29 5.5 30 8.5 31 11.5 32 17.0 33 22.0 34 24.5 35 33.0 36 46.5 37 63.0 38 83.5 39 93.5 40 102.5 41 128.5 42 141.0 43 142.5 44 144.5 45 144.5 46 175.0 47 178.5 48 150.5 49 152.0 50 159.5 51 139.5 52 117.0 53 122.5 54 106.5 55 84.0 56 82.0 57 78.0 58 83.0 59 89.5 60 96.5 61 98.5 62 92.0 63 91.0 64 88.5 65 82.0 66 77.5 67 68.0 68 59.5 69 63.0 70 57.0 71 38.5 72 27.0 73 24.5 74 25.0 75 23.5 76 15.5 77 12.5 78 9.5 79 4.0 80 1.5 81 1.0 82 1.0 83 1.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.52121529596647 91.175 2 4.26925091671032 8.15 3 0.18334206390780514 0.525 4 0.0 0.0 5 0.0 0.0 6 0.026191723415400735 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACACA 10 0.006830828 145.0 8 GTATGCA 10 0.006830828 145.0 4 GCTACAC 10 0.006830828 145.0 7 >>END_MODULE SRR7804205 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804205_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4205 37.0 37.0 37.0 37.0 37.0 2 36.2825 37.0 37.0 37.0 37.0 37.0 3 36.289 37.0 37.0 37.0 37.0 37.0 4 36.338 37.0 37.0 37.0 37.0 37.0 5 36.3765 37.0 37.0 37.0 37.0 37.0 6 36.292 37.0 37.0 37.0 37.0 37.0 7 36.26 37.0 37.0 37.0 37.0 37.0 8 36.4125 37.0 37.0 37.0 37.0 37.0 9 36.365 37.0 37.0 37.0 37.0 37.0 10-14 36.308499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3121 37.0 37.0 37.0 37.0 37.0 20-24 36.278999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.266999999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1849 37.0 37.0 37.0 37.0 37.0 35-39 36.171 37.0 37.0 37.0 37.0 37.0 40-44 36.1484 37.0 37.0 37.0 37.0 37.0 45-49 36.05030000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.058499999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.035900000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.946799999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.882099999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.890600000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.86749999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.7976 37.0 37.0 37.0 37.0 37.0 85-89 35.7388 37.0 37.0 37.0 37.0 37.0 90-94 35.6732 37.0 37.0 37.0 37.0 37.0 95-99 35.5326 37.0 37.0 37.0 37.0 37.0 100-104 35.4593 37.0 37.0 37.0 37.0 37.0 105-109 35.450199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.3909 37.0 37.0 37.0 37.0 37.0 115-119 35.2465 37.0 37.0 37.0 32.2 37.0 120-124 35.2868 37.0 37.0 37.0 32.2 37.0 125-129 35.147400000000005 37.0 37.0 37.0 25.0 37.0 130-134 35.1511 37.0 37.0 37.0 25.0 37.0 135-139 34.7871 37.0 37.0 37.0 25.0 37.0 140-144 34.72 37.0 37.0 37.0 25.0 37.0 145-149 34.5801 37.0 37.0 37.0 25.0 37.0 150-151 33.7995 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 2.0 16 0.0 17 1.0 18 2.0 19 3.0 20 2.0 21 4.0 22 4.0 23 9.0 24 6.0 25 8.0 26 7.0 27 14.0 28 17.0 29 15.0 30 30.0 31 45.0 32 76.0 33 130.0 34 246.0 35 741.0 36 2502.0 37 131.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.75 13.3 11.225 36.725 2 29.549999999999997 18.425 29.75 22.275 3 24.0 22.05 26.150000000000002 27.800000000000004 4 29.125 29.525000000000002 16.325 25.025 5 29.425 30.95 16.875 22.75 6 23.375 32.225 19.3 25.1 7 22.5 15.25 34.050000000000004 28.199999999999996 8 22.875 19.2 22.25 35.675000000000004 9 23.849999999999998 21.75 22.575 31.825 10-14 26.724999999999998 24.560000000000002 21.6 27.115000000000002 15-19 26.705000000000002 23.735 21.6 27.96 20-24 27.295 23.974999999999998 21.55 27.18 25-29 27.04 23.515 22.105 27.339999999999996 30-34 26.505000000000003 23.47 22.5 27.525 35-39 27.089999999999996 24.115000000000002 21.815 26.979999999999997 40-44 27.11 23.380000000000003 21.94 27.57 45-49 26.97 23.75 22.37 26.91 50-54 26.955000000000002 23.294999999999998 22.075 27.675 55-59 26.939999999999998 22.95 22.770000000000003 27.339999999999996 60-64 27.189999999999998 22.99 22.165000000000003 27.655 65-69 27.215 23.79 22.35 26.645000000000003 70-74 27.26 23.549999999999997 22.18 27.01 75-79 27.495000000000005 23.09 22.21 27.205000000000002 80-84 27.150000000000002 23.3 22.415 27.134999999999998 85-89 27.255000000000003 23.325000000000003 22.62 26.8 90-94 27.72 22.66 22.485 27.134999999999998 95-99 27.474999999999998 23.7 21.785 27.04 100-104 27.245 23.56 21.86 27.334999999999997 105-109 27.435 23.044999999999998 22.515 27.005000000000003 110-114 27.82 23.445 21.64 27.095000000000002 115-119 27.584999999999997 23.380000000000003 22.045 26.99 120-124 28.01 23.78 21.865000000000002 26.345000000000002 125-129 27.625 23.830000000000002 22.535 26.009999999999998 130-134 28.110000000000003 23.06 22.535 26.295 135-139 27.639999999999997 23.93 22.34 26.090000000000003 140-144 27.750000000000004 24.01 21.895 26.345000000000002 145-149 28.035 23.810000000000002 22.165000000000003 25.990000000000002 150-151 27.6625 24.3 21.9625 26.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 1.5 13 1.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 3.0 25 2.0 26 0.0 27 0.0 28 3.0 29 4.0 30 4.5 31 7.5 32 10.0 33 11.0 34 12.0 35 20.5 36 28.5 37 32.0 38 50.5 39 64.5 40 67.5 41 84.0 42 104.0 43 128.0 44 128.0 45 127.0 46 140.5 47 145.5 48 143.5 49 123.0 50 118.0 51 119.0 52 101.0 53 101.5 54 112.5 55 110.0 56 107.0 57 110.0 58 115.5 59 110.5 60 104.0 61 103.0 62 110.0 63 113.0 64 101.5 65 87.5 66 89.0 67 101.0 68 101.5 69 90.5 70 79.5 71 74.0 72 60.0 73 48.5 74 44.0 75 33.5 76 26.5 77 24.5 78 15.5 79 7.5 80 5.5 81 4.0 82 4.5 83 4.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.95 #Duplication Level Percentage of deduplicated Percentage of total 1 95.4449710373881 90.625 2 4.160084254870985 7.9 3 0.18430753027909424 0.525 4 0.105318588730911 0.4 5 0.0526592943654555 0.25 6 0.0526592943654555 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.8875 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.325 0.0 0.0 0.0 0.0 138-139 1.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107594 spots for SRR7804205.sra Written 1107594 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra Read 1107593 spots for SRR7804205.sra Written 1107593 spots for SRR7804205.sra SRR ids: ['SRR7804205.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4umll1uz SRR7804205.sra spots: 22151861 blocks: [[1, 1107593], [1107594, 2215186], [2215187, 3322779], [3322780, 4430372], [4430373, 5537965], [5537966, 6645558], [6645559, 7753151], [7753152, 8860744], [8860745, 9968337], [9968338, 11075930], [11075931, 12183523], [12183524, 13291116], [13291117, 14398709], [14398710, 15506302], [15506303, 16613895], [16613896, 17721488], [17721489, 18829081], [18829082, 19936674], [19936675, 21044267], [21044268, 22151861]] SRR7804205 file size 7484838 SRR7804205 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804205 SRR7804205_1.fastq SRR7804205_2.fastq Input file: SRR7804205_1.fastq Paired file: SRR7804205_2.fastq trimmed: SRR7804205-trimmed-pair1.fastq, SRR7804205-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:09:29 2024 >> started Tue Dec 10 04:09:55 2024 >> done (26.213s) 22151861 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 792 ( 0.00%) empty read pairs filtered out after trimming by size control 22151014 (100.00%) read pairs available; of these: 656734 ( 2.96%) trimmed read pairs available after processing 21494280 (97.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 14 0.00% 20 5 0.00% 21 9 0.00% 22 15 0.00% 23 14 0.00% 24 20 0.00% 25 16 0.00% 26 22 0.00% 27 14 0.00% 28 24 0.00% 29 19 0.00% 30 43 0.00% 31 33 0.00% 32 34 0.00% 33 33 0.00% 34 27 0.00% 35 44 0.00% 36 29 0.00% 37 44 0.00% 38 41 0.00% 39 30 0.00% 40 48 0.00% 41 37 0.00% 42 32 0.00% 43 38 0.00% 44 52 0.00% 45 43 0.00% 46 42 0.00% 47 46 0.00% 48 60 0.00% 49 52 0.00% 50 48 0.00% 51 58 0.00% 52 52 0.00% 53 68 0.00% 54 66 0.00% 55 68 0.00% 56 70 0.00% 57 53 0.00% 58 62 0.00% 59 78 0.00% 60 91 0.00% 61 73 0.00% 62 83 0.00% 63 89 0.00% 64 89 0.00% 65 105 0.00% 66 100 0.00% 67 118 0.00% 68 125 0.00% 69 118 0.00% 70 133 0.00% 71 150 0.00% 72 184 0.00% 73 187 0.00% 74 180 0.00% 75 200 0.00% 76 201 0.00% 77 236 0.00% 78 295 0.00% 79 296 0.00% 80 291 0.00% 81 379 0.00% 82 409 0.00% 83 482 0.00% 84 543 0.00% 85 606 0.00% 86 640 0.00% 87 691 0.00% 88 703 0.00% 89 787 0.00% 90 971 0.00% 91 1061 0.00% 92 1187 0.01% 93 1242 0.01% 94 1583 0.01% 95 1596 0.01% 96 1754 0.01% 97 1962 0.01% 98 2052 0.01% 99 2151 0.01% 100 2382 0.01% 101 2654 0.01% 102 2934 0.01% 103 3166 0.01% 104 3426 0.02% 105 3674 0.02% 106 3951 0.02% 107 4115 0.02% 108 4270 0.02% 109 4609 0.02% 110 4924 0.02% 111 5025 0.02% 112 5581 0.03% 113 6010 0.03% 114 6634 0.03% 115 7049 0.03% 116 7119 0.03% 117 7160 0.03% 118 7734 0.03% 119 8235 0.04% 120 8560 0.04% 121 8861 0.04% 122 9353 0.04% 123 9949 0.04% 124 10754 0.05% 125 11346 0.05% 126 11700 0.05% 127 11838 0.05% 128 12377 0.06% 129 12896 0.06% 130 13069 0.06% 131 13559 0.06% 132 14839 0.07% 133 15429 0.07% 134 16070 0.07% 135 16996 0.08% 136 17526 0.08% 137 17837 0.08% 138 18683 0.08% 139 19255 0.09% 140 19235 0.09% 141 19909 0.09% 142 20924 0.09% 143 21731 0.10% 144 22800 0.10% 145 23923 0.11% 146 24665 0.11% 147 25617 0.12% 148 26284 0.12% 149 26766 0.12% 150 27580 0.12% 151 21494280 97.04% 22151014 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=19 prefix-density=1.17 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.33 sequence-density-rank=22 fanout-score=8.31 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=3.0 sequence=ATGGCGAGGATGCTCTG criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=11 prefix-density=0.94 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.26 sequence-density-rank=23 fanout-score=9.90 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=4.0 sequence=CAGAGCATCCTCGCCAT SRR7804205 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:10:43 Started mapping on | Dec 10 04:10:43 Finished on | Dec 10 04:14:06 Mapping speed, Million of reads per hour | 392.83 Number of input reads | 22151014 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20928323 Uniquely mapped reads % | 94.48% Average mapped length | 299.92 Number of splices: Total | 20136976 Number of splices: Annotated (sjdb) | 19046864 Number of splices: GT/AG | 19886308 Number of splices: GC/AG | 214554 Number of splices: AT/AC | 7709 Number of splices: Non-canonical | 28405 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231656 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 21818 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 991035 991035 991035 N_multimapping 231656 231656 231656 N_noFeature 516872 20332377 696975 N_ambiguous 508589 2852 93561 UnstrandedReadsAssigned:19902862 PositiveStrandReadsAssigned:593094 NegativeStrandReadsAssigned:20137787 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804205 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804205-trimmed-pair1.fastq SRR7804205-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,151,014 reads, 20,297,762 reads pseudoaligned [quant] estimated average fragment length: 322.06 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52973 SRR7804205.ke.tsv 35125 SRR7804205.se.tsv 88098 total ==> SRR7804205.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 615.995 0 0 PNS24247 1044 722.94 32.8452 2.76265 PNS24249 1928 1606.94 92.642 3.50562 PNS24246 1044 722.94 32.8452 2.76265 PNS24248 1044 722.94 32.8452 2.76265 PNS24244 1471 1149.94 39.8225 2.10577 PNS24243 293 74.0925 0 0 KQK14069 1603 1281.94 3901.2 185.049 KQK14071 474 195.19 32.7917 10.2156 ==> SRR7804205.se.tsv <== BRADI_1g14170v3 4085 BRADI_1g53295v3 249 BRADI_1g59795v3 481 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 3737 BRADI_1g74790v3 506 BRADI_1g09890v3 14 BRADI_1g77505v3 228 BRADI_1g48960v3 0 SRR7804205 completed mapping pipeline successfully