Starting /dee2/code/volunteer_pipeline.sh SRR7804206 current disk space = 1540742193152 free memory = 1411607304 SRR7804206 SRAfilesize b3d2cf4d122749231d73cd896f14aeba SRR7804206.sra SRR7804206.sra file validated SRR7804206 is paired end SRR7804206 is conventional basespace SRR7804206 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804206_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.21025 37.0 37.0 37.0 37.0 37.0 2 36.205 37.0 37.0 37.0 37.0 37.0 3 36.42 37.0 37.0 37.0 37.0 37.0 4 36.524 37.0 37.0 37.0 37.0 37.0 5 36.475 37.0 37.0 37.0 37.0 37.0 6 36.57 37.0 37.0 37.0 37.0 37.0 7 36.395 37.0 37.0 37.0 37.0 37.0 8 36.5335 37.0 37.0 37.0 37.0 37.0 9 36.491 37.0 37.0 37.0 37.0 37.0 10-14 36.5508 37.0 37.0 37.0 37.0 37.0 15-19 36.4682 37.0 37.0 37.0 37.0 37.0 20-24 36.413799999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4019 37.0 37.0 37.0 37.0 37.0 30-34 36.3501 37.0 37.0 37.0 37.0 37.0 35-39 36.342600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2923 37.0 37.0 37.0 37.0 37.0 45-49 36.3053 37.0 37.0 37.0 37.0 37.0 50-54 36.243700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.218599999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.22 37.0 37.0 37.0 37.0 37.0 65-69 36.1634 37.0 37.0 37.0 37.0 37.0 70-74 36.1117 37.0 37.0 37.0 37.0 37.0 75-79 36.0699 37.0 37.0 37.0 37.0 37.0 80-84 36.0586 37.0 37.0 37.0 37.0 37.0 85-89 35.9789 37.0 37.0 37.0 37.0 37.0 90-94 35.9009 37.0 37.0 37.0 37.0 37.0 95-99 35.827299999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.8193 37.0 37.0 37.0 37.0 37.0 105-109 35.742000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.7755 37.0 37.0 37.0 37.0 37.0 115-119 35.6755 37.0 37.0 37.0 37.0 37.0 120-124 35.5293 37.0 37.0 37.0 37.0 37.0 125-129 35.582499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.3846 37.0 37.0 37.0 34.6 37.0 135-139 35.292500000000004 37.0 37.0 37.0 29.8 37.0 140-144 35.3012 37.0 37.0 37.0 32.2 37.0 145-149 35.1488 37.0 37.0 37.0 29.8 37.0 150-151 34.62275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 1.0 25 7.0 26 5.0 27 15.0 28 17.0 29 31.0 30 42.0 31 52.0 32 56.0 33 120.0 34 194.0 35 459.0 36 2750.0 37 248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.70644271747305 12.634745550263224 10.303334168964653 38.355477563299075 2 26.075 18.65 33.15 22.125 3 22.175 26.0 23.549999999999997 28.275 4 27.200000000000003 31.900000000000002 18.75 22.15 5 27.200000000000003 31.65 20.95 20.200000000000003 6 21.75 33.25 21.525 23.474999999999998 7 17.599999999999998 18.725 40.6 23.075000000000003 8 21.5 18.775 25.674999999999997 34.050000000000004 9 21.45 19.625 29.175 29.75 10-14 24.38 25.03 24.51 26.08 15-19 24.6 24.935 24.205 26.26 20-24 24.474999999999998 24.485 24.21 26.83 25-29 24.98 24.205 24.055 26.76 30-34 24.555 24.57 24.795 26.08 35-39 25.290000000000003 23.73 23.86 27.12 40-44 25.4 24.395 23.189999999999998 27.015 45-49 25.005 24.48 23.56 26.955000000000002 50-54 24.87 23.79 23.835 27.505000000000003 55-59 25.245 24.275 23.3 27.18 60-64 24.6 24.18 23.57 27.650000000000002 65-69 25.045 23.955000000000002 23.849999999999998 27.150000000000002 70-74 25.314999999999998 23.965 23.36 27.36 75-79 25.36 24.435000000000002 23.294999999999998 26.91 80-84 25.180000000000003 23.974999999999998 23.745 27.1 85-89 25.074999999999996 23.575 24.175 27.175 90-94 25.195 23.669999999999998 24.13 27.005000000000003 95-99 25.840000000000003 23.810000000000002 23.195 27.155 100-104 26.009999999999998 23.705000000000002 23.225 27.060000000000002 105-109 26.105 23.215 23.57 27.11 110-114 25.474999999999998 23.369999999999997 23.96 27.195000000000004 115-119 25.82 23.605 23.1 27.474999999999998 120-124 25.86 23.34 23.385 27.415 125-129 25.615 23.724999999999998 23.455000000000002 27.205000000000002 130-134 26.090000000000003 23.34 23.13 27.439999999999998 135-139 26.11 23.31 23.23 27.35 140-144 26.305 23.635 23.455000000000002 26.605 145-149 26.55 23.09 23.66 26.700000000000003 150-151 26.950000000000003 22.912499999999998 23.200000000000003 26.937499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 1.0 28 1.5 29 3.0 30 4.5 31 8.5 32 12.5 33 21.0 34 28.5 35 37.0 36 47.0 37 55.0 38 61.5 39 76.5 40 102.5 41 115.0 42 145.0 43 167.5 44 158.5 45 151.0 46 157.0 47 158.0 48 150.0 49 143.5 50 137.5 51 138.5 52 128.0 53 109.5 54 95.0 55 92.5 56 99.0 57 99.5 58 98.5 59 96.5 60 94.5 61 84.0 62 80.0 63 86.0 64 90.5 65 90.0 66 82.0 67 81.5 68 70.5 69 55.5 70 56.0 71 47.5 72 38.5 73 40.0 74 28.5 75 17.0 76 14.0 77 10.5 78 8.0 79 7.5 80 4.0 81 3.0 82 3.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57671957671958 89.375 2 5.079365079365079 9.6 3 0.291005291005291 0.8250000000000001 4 0.052910052910052914 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.0875 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.3 0.0 0.0 0.0 0.0 120-121 0.3 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.325 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.475 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.7375 0.0 0.0 0.0 0.0 134-135 0.7875000000000001 0.0 0.0 0.0 0.0 136-137 1.0375 0.0 0.0 0.0 0.0 138-139 1.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCGAC 10 0.006830828 145.0 5 >>END_MODULE SRR7804206 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804206_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.269 37.0 37.0 37.0 37.0 37.0 2 35.7955 37.0 37.0 37.0 37.0 37.0 3 36.014 37.0 37.0 37.0 37.0 37.0 4 36.0695 37.0 37.0 37.0 37.0 37.0 5 36.089 37.0 37.0 37.0 37.0 37.0 6 36.005 37.0 37.0 37.0 37.0 37.0 7 36.006 37.0 37.0 37.0 37.0 37.0 8 36.1295 37.0 37.0 37.0 37.0 37.0 9 36.1295 37.0 37.0 37.0 37.0 37.0 10-14 36.122 37.0 37.0 37.0 37.0 37.0 15-19 36.041700000000006 37.0 37.0 37.0 37.0 37.0 20-24 35.9994 37.0 37.0 37.0 37.0 37.0 25-29 35.8942 37.0 37.0 37.0 37.0 37.0 30-34 35.924400000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.8637 37.0 37.0 37.0 37.0 37.0 40-44 35.8467 37.0 37.0 37.0 37.0 37.0 45-49 35.7118 37.0 37.0 37.0 37.0 37.0 50-54 35.6989 37.0 37.0 37.0 37.0 37.0 55-59 35.66480000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.5769 37.0 37.0 37.0 37.0 37.0 65-69 35.4874 37.0 37.0 37.0 37.0 37.0 70-74 35.4615 37.0 37.0 37.0 37.0 37.0 75-79 35.4213 37.0 37.0 37.0 37.0 37.0 80-84 35.3668 37.0 37.0 37.0 37.0 37.0 85-89 35.3236 37.0 37.0 37.0 32.2 37.0 90-94 35.15780000000001 37.0 37.0 37.0 25.0 37.0 95-99 35.1071 37.0 37.0 37.0 27.4 37.0 100-104 35.0645 37.0 37.0 37.0 25.0 37.0 105-109 35.0122 37.0 37.0 37.0 25.0 37.0 110-114 34.8176 37.0 37.0 37.0 25.0 37.0 115-119 34.8275 37.0 37.0 37.0 25.0 37.0 120-124 34.7555 37.0 37.0 37.0 25.0 37.0 125-129 34.5991 37.0 37.0 37.0 25.0 37.0 130-134 34.527100000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.34069999999999 37.0 37.0 37.0 25.0 37.0 140-144 34.037400000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.07040000000001 37.0 37.0 37.0 25.0 37.0 150-151 33.329750000000004 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 3.0 16 1.0 17 2.0 18 1.0 19 3.0 20 3.0 21 8.0 22 8.0 23 3.0 24 10.0 25 6.0 26 16.0 27 15.0 28 22.0 29 53.0 30 50.0 31 73.0 32 107.0 33 184.0 34 330.0 35 959.0 36 2081.0 37 58.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.824999999999996 13.05 10.4 37.724999999999994 2 29.599999999999998 18.3 29.049999999999997 23.05 3 24.2 23.65 25.424999999999997 26.724999999999998 4 27.025 30.575000000000003 17.325 25.074999999999996 5 30.15 30.575000000000003 18.35 20.925 6 22.275 33.074999999999996 18.099999999999998 26.55 7 22.375 13.375 36.075 28.175 8 22.55 20.025000000000002 21.275 36.15 9 23.799999999999997 19.85 25.05 31.3 10-14 26.25 23.985 21.455 28.310000000000002 15-19 26.68 23.419999999999998 22.05 27.85 20-24 26.650000000000002 24.044999999999998 22.259999999999998 27.045 25-29 27.155 22.95 22.67 27.224999999999998 30-34 26.939999999999998 23.485 22.25 27.325 35-39 26.96 23.369999999999997 21.785 27.884999999999998 40-44 27.084999999999997 22.865 22.245 27.805000000000003 45-49 28.060000000000002 22.75 22.27 26.919999999999998 50-54 26.965 23.105 22.18 27.750000000000004 55-59 27.24 23.355 22.6 26.805 60-64 27.889999999999997 22.475 22.68 26.955000000000002 65-69 27.785 22.555 22.675 26.985 70-74 27.529999999999998 22.37 22.695 27.405 75-79 27.37 22.98 22.665 26.985 80-84 27.99 22.79 22.065 27.155 85-89 27.400000000000002 23.330000000000002 21.990000000000002 27.279999999999998 90-94 27.43 22.759999999999998 22.1 27.71 95-99 27.665 23.005 22.36 26.97 100-104 28.12 22.830000000000002 22.05 27.0 105-109 27.944999999999997 22.770000000000003 22.264999999999997 27.02 110-114 27.47 23.185 21.785 27.560000000000002 115-119 28.095 23.39 21.654999999999998 26.86 120-124 28.375 23.135 21.605 26.884999999999998 125-129 27.97 23.244999999999997 22.35 26.435 130-134 28.299999999999997 22.985 22.235 26.479999999999997 135-139 27.615000000000002 23.345 22.31 26.729999999999997 140-144 27.82 23.87 22.42 25.89 145-149 28.165000000000003 22.85 22.325 26.66 150-151 28.575 23.9875 21.6125 25.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 0.0 25 0.0 26 1.0 27 1.0 28 2.0 29 4.0 30 3.5 31 6.5 32 9.5 33 12.0 34 17.0 35 22.5 36 26.5 37 36.0 38 51.0 39 62.0 40 71.0 41 89.0 42 116.0 43 124.5 44 135.0 45 135.5 46 127.0 47 136.0 48 128.5 49 121.5 50 126.5 51 124.0 52 110.5 53 109.5 54 100.0 55 85.5 56 87.5 57 87.5 58 97.5 59 104.5 60 94.0 61 103.5 62 123.5 63 122.5 64 111.0 65 103.5 66 93.5 67 94.5 68 102.5 69 101.5 70 90.0 71 77.5 72 68.5 73 56.5 74 49.0 75 42.5 76 29.0 77 17.0 78 14.0 79 7.0 80 5.5 81 5.5 82 3.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 1.0 92 1.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.05491868834977 88.2 2 5.385230605171954 10.100000000000001 3 0.4798720341242335 1.35 4 0.026659557451346308 0.1 5 0.053319114902692616 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0125 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.037500000000000006 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.05 0.0 0.0 0.0 0.025 96-97 0.05 0.0 0.0 0.0 0.025 98-99 0.05 0.0 0.0 0.0 0.025 100-101 0.05 0.0 0.0 0.0 0.025 102-103 0.05 0.0 0.0 0.0 0.025 104-105 0.0875 0.0 0.0 0.0 0.025 106-107 0.1125 0.0 0.0 0.0 0.025 108-109 0.1375 0.0 0.0 0.0 0.025 110-111 0.2 0.0 0.0 0.0 0.025 112-113 0.2 0.0 0.0 0.0 0.025 114-115 0.225 0.0 0.0 0.0 0.025 116-117 0.275 0.0 0.0 0.0 0.025 118-119 0.325 0.0 0.0 0.0 0.025 120-121 0.325 0.0 0.0 0.0 0.025 122-123 0.35 0.0 0.0 0.0 0.025 124-125 0.35 0.0 0.0 0.0 0.025 126-127 0.4375 0.0 0.0 0.0 0.025 128-129 0.5 0.0 0.0 0.0 0.025 130-131 0.575 0.0 0.0 0.0 0.025 132-133 0.7625 0.0 0.0 0.0 0.025 134-135 0.8125 0.0 0.0 0.0 0.025 136-137 1.05 0.0 0.0 0.0 0.025 138-139 1.1875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACACA 10 0.006830828 145.0 6 TACACAG 10 0.006830828 145.0 7 GCTGAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458611 spots for SRR7804206.sra Written 1458611 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra Read 1458593 spots for SRR7804206.sra Written 1458593 spots for SRR7804206.sra SRR ids: ['SRR7804206.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1u5_co33 SRR7804206.sra spots: 29171878 blocks: [[1, 1458593], [1458594, 2917186], [2917187, 4375779], [4375780, 5834372], [5834373, 7292965], [7292966, 8751558], [8751559, 10210151], [10210152, 11668744], [11668745, 13127337], [13127338, 14585930], [14585931, 16044523], [16044524, 17503116], [17503117, 18961709], [18961710, 20420302], [20420303, 21878895], [21878896, 23337488], [23337489, 24796081], [24796082, 26254674], [26254675, 27713267], [27713268, 29171878]] SRR7804206 file size 9863691 SRR7804206 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804206 SRR7804206_1.fastq SRR7804206_2.fastq Input file: SRR7804206_1.fastq Paired file: SRR7804206_2.fastq trimmed: SRR7804206-trimmed-pair1.fastq, SRR7804206-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 17:59:03 2024 >> started Sat Dec 7 17:59:39 2024 >> done (35.678s) 29171878 read pairs processed; of these: 79 ( 0.00%) short read pairs filtered out after trimming by size control 597 ( 0.00%) empty read pairs filtered out after trimming by size control 29171202 (100.00%) read pairs available; of these: 685951 ( 2.35%) trimmed read pairs available after processing 28485251 (97.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 18 0.00% 21 15 0.00% 22 28 0.00% 23 23 0.00% 24 32 0.00% 25 32 0.00% 26 33 0.00% 27 41 0.00% 28 34 0.00% 29 41 0.00% 30 44 0.00% 31 41 0.00% 32 41 0.00% 33 40 0.00% 34 57 0.00% 35 50 0.00% 36 52 0.00% 37 51 0.00% 38 66 0.00% 39 67 0.00% 40 48 0.00% 41 65 0.00% 42 65 0.00% 43 85 0.00% 44 70 0.00% 45 67 0.00% 46 77 0.00% 47 71 0.00% 48 79 0.00% 49 64 0.00% 50 69 0.00% 51 87 0.00% 52 92 0.00% 53 106 0.00% 54 87 0.00% 55 95 0.00% 56 85 0.00% 57 102 0.00% 58 110 0.00% 59 109 0.00% 60 106 0.00% 61 120 0.00% 62 119 0.00% 63 142 0.00% 64 134 0.00% 65 110 0.00% 66 124 0.00% 67 147 0.00% 68 155 0.00% 69 147 0.00% 70 165 0.00% 71 153 0.00% 72 209 0.00% 73 209 0.00% 74 201 0.00% 75 223 0.00% 76 237 0.00% 77 249 0.00% 78 285 0.00% 79 313 0.00% 80 313 0.00% 81 328 0.00% 82 367 0.00% 83 449 0.00% 84 431 0.00% 85 544 0.00% 86 581 0.00% 87 560 0.00% 88 683 0.00% 89 747 0.00% 90 791 0.00% 91 926 0.00% 92 1040 0.00% 93 1218 0.00% 94 1337 0.00% 95 1459 0.01% 96 1551 0.01% 97 1646 0.01% 98 1741 0.01% 99 1961 0.01% 100 2088 0.01% 101 2256 0.01% 102 2600 0.01% 103 2777 0.01% 104 3071 0.01% 105 3355 0.01% 106 3643 0.01% 107 3756 0.01% 108 4013 0.01% 109 4369 0.01% 110 4662 0.02% 111 4949 0.02% 112 5329 0.02% 113 5841 0.02% 114 6346 0.02% 115 6757 0.02% 116 7101 0.02% 117 7332 0.03% 118 7650 0.03% 119 7829 0.03% 120 8344 0.03% 121 8791 0.03% 122 9545 0.03% 123 9999 0.03% 124 10843 0.04% 125 11613 0.04% 126 11911 0.04% 127 12314 0.04% 128 12481 0.04% 129 13487 0.05% 130 13748 0.05% 131 14240 0.05% 132 15261 0.05% 133 16199 0.06% 134 16983 0.06% 135 17952 0.06% 136 18994 0.07% 137 19324 0.07% 138 19794 0.07% 139 20539 0.07% 140 20832 0.07% 141 21656 0.07% 142 22622 0.08% 143 23607 0.08% 144 24921 0.09% 145 26096 0.09% 146 26768 0.09% 147 27920 0.10% 148 29106 0.10% 149 29169 0.10% 150 30488 0.10% 151 28485251 97.65% 29171202 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=21 prefix-density=0.88 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=31 fanout-score=19.46 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=4.6 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTA criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=19 prefix-density=0.89 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=51.22 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.4 sequence=AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804206 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:00:33 Started mapping on | Dec 07 18:00:33 Finished on | Dec 07 18:05:02 Mapping speed, Million of reads per hour | 390.40 Number of input reads | 29171202 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 27397233 Uniquely mapped reads % | 93.92% Average mapped length | 300.03 Number of splices: Total | 25899389 Number of splices: Annotated (sjdb) | 24499152 Number of splices: GT/AG | 25567716 Number of splices: GC/AG | 284317 Number of splices: AT/AC | 8547 Number of splices: Non-canonical | 38809 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307548 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 24070 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.24% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1466421 1466421 1466421 N_multimapping 307548 307548 307548 N_noFeature 743054 26578512 988690 N_ambiguous 719316 4080 147724 UnstrandedReadsAssigned:25934863 PositiveStrandReadsAssigned:814641 NegativeStrandReadsAssigned:26260819 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804206 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804206-trimmed-pair1.fastq SRR7804206-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,171,202 reads, 26,453,859 reads pseudoaligned [quant] estimated average fragment length: 328.027 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR7804206.ke.tsv 35125 SRR7804206.se.tsv 88098 total ==> SRR7804206.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 609.737 0 0 PNS24247 1044 716.973 53.4689 3.48152 PNS24249 1928 1600.97 171.691 5.00651 PNS24246 1044 716.973 53.4689 3.48152 PNS24248 1044 716.973 53.4689 3.48152 PNS24244 1471 1143.97 96.9023 3.95448 PNS24243 293 71.1017 0 0 KQK14069 1603 1275.97 7400.02 270.747 KQK14071 474 189.609 51.2133 12.6095 ==> SRR7804206.se.tsv <== BRADI_1g14170v3 7723 BRADI_1g53295v3 239 BRADI_1g59795v3 627 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 1712 BRADI_1g74790v3 690 BRADI_1g09890v3 14 BRADI_1g77505v3 299 BRADI_1g48960v3 0 SRR7804206 completed mapping pipeline successfully