Starting /dee2/code/volunteer_pipeline.sh SRR7804207 current disk space = 1540712706048 free memory = 1411742008 SRR7804207 SRAfilesize e0426f9374ff9f1714a7211f3d9d398a SRR7804207.sra SRR7804207.sra file validated SRR7804207 is paired end SRR7804207 is conventional basespace SRR7804207 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804207_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.30525 37.0 37.0 37.0 37.0 37.0 2 36.2165 37.0 37.0 37.0 37.0 37.0 3 36.4365 37.0 37.0 37.0 37.0 37.0 4 36.51 37.0 37.0 37.0 37.0 37.0 5 36.5255 37.0 37.0 37.0 37.0 37.0 6 36.519 37.0 37.0 37.0 37.0 37.0 7 36.318 37.0 37.0 37.0 37.0 37.0 8 36.5625 37.0 37.0 37.0 37.0 37.0 9 36.49 37.0 37.0 37.0 37.0 37.0 10-14 36.5178 37.0 37.0 37.0 37.0 37.0 15-19 36.51520000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5 37.0 37.0 37.0 37.0 37.0 25-29 36.43319999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3995 37.0 37.0 37.0 37.0 37.0 35-39 36.4311 37.0 37.0 37.0 37.0 37.0 40-44 36.322799999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.273700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2654 37.0 37.0 37.0 37.0 37.0 55-59 36.230500000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.235600000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2322 37.0 37.0 37.0 37.0 37.0 70-74 36.1206 37.0 37.0 37.0 37.0 37.0 75-79 36.10880000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.099900000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.038799999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.976 37.0 37.0 37.0 37.0 37.0 95-99 35.874900000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8698 37.0 37.0 37.0 37.0 37.0 105-109 35.8471 37.0 37.0 37.0 37.0 37.0 110-114 35.8257 37.0 37.0 37.0 37.0 37.0 115-119 35.759499999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.5654 37.0 37.0 37.0 37.0 37.0 125-129 35.605199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.487700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.347699999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.33969999999999 37.0 37.0 37.0 34.6 37.0 145-149 35.1706 37.0 37.0 37.0 29.8 37.0 150-151 34.487750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 3.0 26 3.0 27 14.0 28 26.0 29 21.0 30 33.0 31 42.0 32 79.0 33 111.0 34 161.0 35 468.0 36 2810.0 37 225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.71950914099674 13.423491109441525 10.117705985474581 36.73929376408715 2 26.075 19.375 33.875 20.674999999999997 3 22.175 25.95 23.724999999999998 28.15 4 27.900000000000002 30.275000000000002 19.3 22.525000000000002 5 25.974999999999998 33.074999999999996 20.5 20.45 6 20.8 32.074999999999996 23.05 24.075 7 17.45 19.35 40.8 22.400000000000002 8 21.325 19.575 25.75 33.35 9 20.849999999999998 18.55 29.549999999999997 31.05 10-14 23.27 26.21 23.555 26.965 15-19 24.15 24.775 24.19 26.884999999999998 20-24 23.685000000000002 24.72 24.990000000000002 26.605 25-29 23.425 25.35 24.349999999999998 26.875 30-34 23.880000000000003 25.145 24.77 26.205000000000002 35-39 24.279999999999998 24.585 23.87 27.265 40-44 24.32 24.83 24.12 26.729999999999997 45-49 24.705 24.11 24.275 26.91 50-54 24.310000000000002 24.51 24.63 26.55 55-59 24.415 24.635 24.46 26.490000000000002 60-64 24.635 24.83 23.705000000000002 26.83 65-69 24.185000000000002 24.610000000000003 24.54 26.665 70-74 24.8 23.835 24.05 27.315 75-79 24.15 23.98 24.985 26.884999999999998 80-84 25.11 23.905 24.044999999999998 26.939999999999998 85-89 24.775 24.11 24.12 26.995 90-94 25.009999999999998 23.79 24.529999999999998 26.669999999999998 95-99 25.7 23.615 24.435000000000002 26.25 100-104 25.21 23.715 24.15 26.924999999999997 105-109 24.825 23.9 24.12 27.155 110-114 25.230000000000004 24.145 23.785 26.840000000000003 115-119 25.380000000000003 23.955000000000002 23.24 27.425 120-124 25.385 23.645 23.515 27.455000000000002 125-129 25.44 23.94 24.060000000000002 26.56 130-134 25.94 23.580000000000002 23.51 26.97 135-139 25.674999999999997 23.43 23.325000000000003 27.57 140-144 25.865 23.53 23.695 26.91 145-149 26.005 23.215 23.66 27.12 150-151 27.4125 23.4125 22.275 26.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 4.0 29 6.0 30 7.5 31 14.0 32 20.0 33 22.0 34 25.0 35 35.5 36 45.0 37 58.5 38 77.0 39 94.0 40 108.0 41 108.5 42 121.0 43 155.0 44 180.0 45 182.5 46 166.5 47 159.5 48 165.5 49 162.5 50 153.0 51 137.0 52 126.5 53 120.0 54 105.5 55 100.0 56 107.0 57 99.5 58 89.5 59 90.5 60 86.5 61 82.0 62 76.5 63 68.0 64 69.5 65 74.0 66 71.0 67 73.0 68 58.0 69 42.5 70 43.0 71 41.5 72 39.0 73 33.5 74 23.5 75 18.5 76 19.0 77 11.5 78 6.0 79 5.5 80 4.0 81 2.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.38904899135446 91.025 2 4.427560911710768 8.450000000000001 3 0.18339009693476552 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.5249999999999999 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138-139 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCGA 10 0.006830828 145.0 4 GTACTCG 10 0.006830828 145.0 8 GACAATC 10 0.006830828 145.0 2 TACTCGG 10 0.006830828 145.0 9 GGTACTC 10 0.006830828 145.0 7 >>END_MODULE SRR7804207 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804207_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5725 37.0 37.0 37.0 37.0 37.0 2 36.2405 37.0 37.0 37.0 37.0 37.0 3 36.376 37.0 37.0 37.0 37.0 37.0 4 36.4475 37.0 37.0 37.0 37.0 37.0 5 36.5095 37.0 37.0 37.0 37.0 37.0 6 36.38 37.0 37.0 37.0 37.0 37.0 7 36.333 37.0 37.0 37.0 37.0 37.0 8 36.4465 37.0 37.0 37.0 37.0 37.0 9 36.4495 37.0 37.0 37.0 37.0 37.0 10-14 36.3956 37.0 37.0 37.0 37.0 37.0 15-19 36.39640000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.357400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3493 37.0 37.0 37.0 37.0 37.0 30-34 36.2906 37.0 37.0 37.0 37.0 37.0 35-39 36.1737 37.0 37.0 37.0 37.0 37.0 40-44 36.2361 37.0 37.0 37.0 37.0 37.0 45-49 36.1871 37.0 37.0 37.0 37.0 37.0 50-54 36.183499999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.113699999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.009 37.0 37.0 37.0 37.0 37.0 65-69 35.9166 37.0 37.0 37.0 37.0 37.0 70-74 35.953199999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.924899999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.7726 37.0 37.0 37.0 37.0 37.0 85-89 35.7906 37.0 37.0 37.0 37.0 37.0 90-94 35.768299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.650800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.584199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.6365 37.0 37.0 37.0 37.0 37.0 110-114 35.4254 37.0 37.0 37.0 37.0 37.0 115-119 35.343 37.0 37.0 37.0 34.6 37.0 120-124 35.3443 37.0 37.0 37.0 34.6 37.0 125-129 35.2078 37.0 37.0 37.0 29.8 37.0 130-134 35.1349 37.0 37.0 37.0 25.0 37.0 135-139 34.9636 37.0 37.0 37.0 25.0 37.0 140-144 34.8207 37.0 37.0 37.0 25.0 37.0 145-149 34.7406 37.0 37.0 37.0 25.0 37.0 150-151 34.0685 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 3.0 16 1.0 17 0.0 18 1.0 19 2.0 20 1.0 21 2.0 22 8.0 23 4.0 24 5.0 25 7.0 26 7.0 27 11.0 28 21.0 29 18.0 30 21.0 31 48.0 32 71.0 33 121.0 34 228.0 35 673.0 36 2603.0 37 142.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.324999999999996 12.35 11.799999999999999 37.525 2 29.025000000000002 19.075 29.7 22.2 3 24.2 22.900000000000002 25.775 27.125 4 26.650000000000002 29.425 17.275 26.650000000000002 5 28.499999999999996 31.900000000000002 17.9 21.7 6 23.150000000000002 32.1 19.7 25.05 7 20.825 14.549999999999999 36.25 28.375 8 22.55 20.25 20.75 36.449999999999996 9 24.575 21.05 24.224999999999998 30.15 10-14 26.3 24.515 21.865000000000002 27.32 15-19 27.41 23.145 22.285 27.16 20-24 26.46 24.08 21.97 27.49 25-29 26.584999999999997 24.115000000000002 22.07 27.229999999999997 30-34 27.025 23.369999999999997 22.485 27.12 35-39 26.72 23.645 22.43 27.205000000000002 40-44 26.775 24.095 22.07 27.060000000000002 45-49 27.49 24.05 21.695 26.765 50-54 27.24 24.11 22.285 26.365 55-59 27.805000000000003 23.68 21.955 26.56 60-64 27.694999999999997 23.255 22.009999999999998 27.04 65-69 26.884999999999998 23.21 22.41 27.495000000000005 70-74 27.339999999999996 23.235 22.91 26.515 75-79 27.834999999999997 23.145 22.07 26.950000000000003 80-84 27.515 23.215 22.56 26.71 85-89 27.615000000000002 23.32 22.425 26.640000000000004 90-94 27.72 23.845 21.740000000000002 26.695 95-99 27.83 23.185 22.345000000000002 26.640000000000004 100-104 27.425 23.64 22.220000000000002 26.715 105-109 27.85 23.005 22.68 26.465 110-114 27.425 23.65 22.275 26.650000000000002 115-119 27.88 23.294999999999998 22.470000000000002 26.355 120-124 27.29 23.44 22.735 26.534999999999997 125-129 27.495000000000005 24.32 22.45 25.735000000000003 130-134 27.66 23.48 22.455 26.405 135-139 27.839999999999996 23.36 23.415 25.385 140-144 27.800000000000004 23.505000000000003 22.845 25.85 145-149 27.63 24.195 22.245 25.929999999999996 150-151 28.1375 23.8875 22.3875 25.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 0.5 27 1.5 28 2.0 29 3.5 30 4.0 31 4.0 32 10.0 33 15.5 34 15.5 35 17.5 36 27.5 37 44.0 38 51.5 39 54.0 40 68.0 41 93.0 42 112.0 43 124.5 44 123.0 45 135.5 46 141.5 47 131.0 48 135.0 49 137.0 50 129.5 51 119.5 52 122.5 53 118.0 54 115.5 55 111.5 56 109.0 57 111.5 58 110.0 59 112.5 60 107.5 61 102.5 62 96.5 63 94.0 64 97.5 65 97.5 66 95.0 67 92.5 68 89.0 69 86.0 70 82.0 71 75.0 72 68.5 73 48.5 74 38.0 75 35.0 76 23.5 77 16.5 78 13.0 79 9.5 80 5.5 81 3.0 82 1.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.05 #Duplication Level Percentage of deduplicated Percentage of total 1 95.1867438190426 90.47500000000001 2 4.523934771173066 8.6 3 0.23671751709626512 0.675 4 0.0 0.0 5 0.052603892688058915 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGT 5 0.125 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.5249999999999999 0.0 0.0 0.0 0.0 122-123 0.6625000000000001 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.9125 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGTAT 10 0.006830828 145.0 1 AGCATAC 10 0.006830828 145.0 2 ATACCTC 10 0.006830828 145.0 5 TACCTCA 10 0.006830828 145.0 6 CTCACTG 10 0.006830828 145.0 9 CTCAAAA 10 0.006830828 145.0 6 CATGTCA 10 0.006830828 145.0 145 >>END_MODULE Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351254 spots for SRR7804207.sra Written 1351254 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra Read 1351243 spots for SRR7804207.sra Written 1351243 spots for SRR7804207.sra SRR ids: ['SRR7804207.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__rq4odi3 SRR7804207.sra spots: 27024871 blocks: [[1, 1351243], [1351244, 2702486], [2702487, 4053729], [4053730, 5404972], [5404973, 6756215], [6756216, 8107458], [8107459, 9458701], [9458702, 10809944], [10809945, 12161187], [12161188, 13512430], [13512431, 14863673], [14863674, 16214916], [16214917, 17566159], [17566160, 18917402], [18917403, 20268645], [20268646, 21619888], [21619889, 22971131], [22971132, 24322374], [24322375, 25673617], [25673618, 27024871]] SRR7804207 file size 9136141 SRR7804207 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804207 SRR7804207_1.fastq SRR7804207_2.fastq Input file: SRR7804207_1.fastq Paired file: SRR7804207_2.fastq trimmed: SRR7804207-trimmed-pair1.fastq, SRR7804207-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:01:54 2024 >> started Sat Dec 7 18:02:25 2024 >> done (31.280s) 27024871 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 788 ( 0.00%) empty read pairs filtered out after trimming by size control 27024003 (100.00%) read pairs available; of these: 797605 ( 2.95%) trimmed read pairs available after processing 26226398 (97.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 15 0.00% 20 17 0.00% 21 16 0.00% 22 23 0.00% 23 23 0.00% 24 20 0.00% 25 25 0.00% 26 20 0.00% 27 30 0.00% 28 24 0.00% 29 34 0.00% 30 34 0.00% 31 50 0.00% 32 48 0.00% 33 30 0.00% 34 44 0.00% 35 56 0.00% 36 44 0.00% 37 46 0.00% 38 51 0.00% 39 59 0.00% 40 61 0.00% 41 53 0.00% 42 39 0.00% 43 64 0.00% 44 64 0.00% 45 56 0.00% 46 75 0.00% 47 70 0.00% 48 90 0.00% 49 76 0.00% 50 66 0.00% 51 63 0.00% 52 75 0.00% 53 77 0.00% 54 94 0.00% 55 94 0.00% 56 79 0.00% 57 85 0.00% 58 89 0.00% 59 105 0.00% 60 118 0.00% 61 115 0.00% 62 127 0.00% 63 93 0.00% 64 111 0.00% 65 124 0.00% 66 134 0.00% 67 122 0.00% 68 144 0.00% 69 174 0.00% 70 150 0.00% 71 189 0.00% 72 209 0.00% 73 227 0.00% 74 225 0.00% 75 277 0.00% 76 272 0.00% 77 327 0.00% 78 322 0.00% 79 365 0.00% 80 392 0.00% 81 449 0.00% 82 524 0.00% 83 601 0.00% 84 639 0.00% 85 707 0.00% 86 771 0.00% 87 783 0.00% 88 887 0.00% 89 982 0.00% 90 1120 0.00% 91 1201 0.00% 92 1369 0.01% 93 1605 0.01% 94 1831 0.01% 95 1958 0.01% 96 2151 0.01% 97 2258 0.01% 98 2469 0.01% 99 2677 0.01% 100 2931 0.01% 101 3170 0.01% 102 3469 0.01% 103 3873 0.01% 104 4073 0.02% 105 4475 0.02% 106 4775 0.02% 107 5070 0.02% 108 5146 0.02% 109 5554 0.02% 110 5929 0.02% 111 6355 0.02% 112 6942 0.03% 113 7451 0.03% 114 7731 0.03% 115 8520 0.03% 116 8821 0.03% 117 9085 0.03% 118 9671 0.04% 119 9693 0.04% 120 10459 0.04% 121 10845 0.04% 122 11300 0.04% 123 12291 0.05% 124 13060 0.05% 125 13554 0.05% 126 14488 0.05% 127 15010 0.06% 128 15256 0.06% 129 15557 0.06% 130 16172 0.06% 131 16810 0.06% 132 17826 0.07% 133 18571 0.07% 134 19770 0.07% 135 20892 0.08% 136 21312 0.08% 137 21954 0.08% 138 22333 0.08% 139 22944 0.08% 140 23392 0.09% 141 24274 0.09% 142 25498 0.09% 143 26319 0.10% 144 27412 0.10% 145 28830 0.11% 146 29727 0.11% 147 30827 0.11% 148 31660 0.12% 149 32193 0.12% 150 32944 0.12% 151 26226398 97.05% 27024003 reads passed initial QC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=17 prefix-density=1.00 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.24 sequence-density-rank=18 fanout-score=7.95 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=3.0 sequence=ATGGCGAGGATGCTCTG criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=19 prefix-density=0.79 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=13.62 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804207 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:03:29 Started mapping on | Dec 07 18:03:30 Finished on | Dec 07 18:07:51 Mapping speed, Million of reads per hour | 372.74 Number of input reads | 27024003 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25287602 Uniquely mapped reads % | 93.57% Average mapped length | 299.93 Number of splices: Total | 25672951 Number of splices: Annotated (sjdb) | 24256282 Number of splices: GT/AG | 25352003 Number of splices: GC/AG | 274411 Number of splices: AT/AC | 11129 Number of splices: Non-canonical | 35408 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285396 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 29112 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1451005 1451005 1451005 N_multimapping 285396 285396 285396 N_noFeature 672625 24545270 920962 N_ambiguous 604664 3771 110919 UnstrandedReadsAssigned:24010313 PositiveStrandReadsAssigned:738561 NegativeStrandReadsAssigned:24255721 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804207 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804207-trimmed-pair1.fastq SRR7804207-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,024,003 reads, 24,456,823 reads pseudoaligned [quant] estimated average fragment length: 322.68 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52973 SRR7804207.ke.tsv 35125 SRR7804207.se.tsv 88098 total ==> SRR7804207.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 615.32 0 0 PNS24247 1044 722.32 66.8194 4.31514 PNS24249 1928 1606.32 156.21 4.53627 PNS24246 1044 722.32 66.8194 4.31514 PNS24248 1044 722.32 66.8194 4.31514 PNS24244 1471 1149.32 118.331 4.80264 PNS24243 293 73.739 0 0 KQK14069 1603 1281.32 7958.58 289.734 KQK14071 474 194.141 131.071 31.4928 ==> SRR7804207.se.tsv <== BRADI_1g14170v3 8812 BRADI_1g53295v3 532 BRADI_1g59795v3 626 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 2730 BRADI_1g74790v3 1299 BRADI_1g09890v3 23 BRADI_1g77505v3 359 BRADI_1g48960v3 0 SRR7804207 completed mapping pipeline successfully