Starting /dee2/code/volunteer_pipeline.sh SRR7804209 current disk space = 1540850114560 free memory = 1408565096 SRR7804209 SRAfilesize 0fac43bd35dfc603ba376dff17678716 SRR7804209.sra SRR7804209.sra file validated SRR7804209 is paired end SRR7804209 is conventional basespace SRR7804209 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804209_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23175 37.0 37.0 37.0 37.0 37.0 2 36.2245 37.0 37.0 37.0 37.0 37.0 3 36.342 37.0 37.0 37.0 37.0 37.0 4 36.4005 37.0 37.0 37.0 37.0 37.0 5 36.423 37.0 37.0 37.0 37.0 37.0 6 36.489 37.0 37.0 37.0 37.0 37.0 7 36.257 37.0 37.0 37.0 37.0 37.0 8 36.477 37.0 37.0 37.0 37.0 37.0 9 36.4955 37.0 37.0 37.0 37.0 37.0 10-14 36.515699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.4335 37.0 37.0 37.0 37.0 37.0 20-24 36.456 37.0 37.0 37.0 37.0 37.0 25-29 36.32770000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.382000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.347699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2401 37.0 37.0 37.0 37.0 37.0 45-49 36.206599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.1674 37.0 37.0 37.0 37.0 37.0 55-59 36.1745 37.0 37.0 37.0 37.0 37.0 60-64 36.14190000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.1424 37.0 37.0 37.0 37.0 37.0 70-74 36.0158 37.0 37.0 37.0 37.0 37.0 75-79 36.0338 37.0 37.0 37.0 37.0 37.0 80-84 35.9722 37.0 37.0 37.0 37.0 37.0 85-89 35.9309 37.0 37.0 37.0 37.0 37.0 90-94 35.874199999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7677 37.0 37.0 37.0 37.0 37.0 100-104 35.807599999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.6481 37.0 37.0 37.0 37.0 37.0 110-114 35.6714 37.0 37.0 37.0 37.0 37.0 115-119 35.590700000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.5128 37.0 37.0 37.0 37.0 37.0 125-129 35.526399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.3598 37.0 37.0 37.0 37.0 37.0 135-139 35.3104 37.0 37.0 37.0 34.6 37.0 140-144 35.335300000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.077000000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.411 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 1.0 23 1.0 24 8.0 25 7.0 26 7.0 27 12.0 28 18.0 29 36.0 30 37.0 31 62.0 32 68.0 33 109.0 34 165.0 35 484.0 36 2746.0 37 237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.97371714643304 14.292866082603254 9.411764705882353 37.32165206508135 2 25.2 19.25 34.575 20.974999999999998 3 22.05 26.825 23.5 27.625 4 27.325 30.45 19.025 23.200000000000003 5 25.124999999999996 32.574999999999996 21.349999999999998 20.95 6 20.325 32.6 22.925 24.15 7 17.25 18.85 41.825 22.075 8 20.599999999999998 19.375 27.975 32.05 9 21.15 18.975 31.1 28.775000000000002 10-14 23.305 26.055 24.315 26.325 15-19 24.23 24.529999999999998 25.44 25.8 20-24 23.93 24.915000000000003 25.305 25.85 25-29 23.59 24.965 24.755 26.69 30-34 23.54 25.295 24.97 26.195 35-39 23.79 25.185000000000002 24.68 26.345000000000002 40-44 23.285 24.83 25.135 26.75 45-49 23.425 25.505 24.54 26.529999999999998 50-54 23.885 25.055 24.815 26.245 55-59 24.245 24.529999999999998 24.125 27.1 60-64 24.42 25.290000000000003 24.25 26.040000000000003 65-69 24.05 25.035 24.325 26.590000000000003 70-74 24.095 25.255 24.775 25.874999999999996 75-79 24.605 24.465 24.285 26.645000000000003 80-84 24.965 24.58 24.535 25.919999999999998 85-89 24.3 24.205 24.560000000000002 26.935 90-94 25.035 24.335 24.055 26.575 95-99 24.545 24.0 24.775 26.68 100-104 24.795 24.67 23.82 26.715 105-109 24.7 25.085 23.64 26.575 110-114 24.95 23.525 24.845 26.68 115-119 25.275 24.425 23.875 26.424999999999997 120-124 24.735 24.465 23.91 26.889999999999997 125-129 24.745 24.32 24.025 26.91 130-134 24.995 24.215 24.12 26.669999999999998 135-139 25.345000000000002 24.495 23.974999999999998 26.185000000000002 140-144 24.965 24.0 24.21 26.825 145-149 24.865000000000002 23.974999999999998 24.02 27.139999999999997 150-151 25.525 24.625 23.962500000000002 25.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 2.5 29 6.0 30 9.0 31 10.0 32 17.0 33 22.5 34 26.0 35 35.5 36 46.0 37 61.5 38 73.5 39 90.5 40 125.0 41 149.5 42 161.0 43 166.5 44 171.5 45 165.0 46 161.0 47 167.5 48 166.0 49 164.5 50 156.0 51 138.0 52 128.0 53 122.0 54 116.0 55 108.0 56 95.0 57 95.5 58 90.5 59 85.0 60 77.0 61 75.0 62 79.0 63 70.5 64 65.0 65 64.5 66 65.0 67 63.5 68 55.0 69 41.0 70 35.0 71 33.5 72 32.5 73 28.5 74 21.0 75 16.0 76 13.0 77 9.0 78 5.5 79 3.5 80 2.0 81 1.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 95.35920293654956 90.925 2 4.457262716308338 8.5 3 0.13109596224436287 0.375 4 0.05243838489774515 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0125 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.025 0.0 0.0 0.0 0.025 76-77 0.025 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.05 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.05 0.0 0.0 0.0 0.025 96-97 0.075 0.0 0.0 0.0 0.025 98-99 0.1 0.0 0.0 0.0 0.025 100-101 0.1 0.0 0.0 0.0 0.025 102-103 0.15 0.0 0.0 0.0 0.025 104-105 0.175 0.0 0.0 0.0 0.025 106-107 0.2125 0.0 0.0 0.0 0.025 108-109 0.2625 0.0 0.0 0.0 0.025 110-111 0.2875 0.0 0.0 0.0 0.025 112-113 0.32499999999999996 0.0 0.0 0.0 0.025 114-115 0.375 0.0 0.0 0.0 0.025 116-117 0.4125 0.0 0.0 0.0 0.025 118-119 0.4875 0.0 0.0 0.0 0.025 120-121 0.525 0.0 0.0 0.0 0.025 122-123 0.5874999999999999 0.0 0.0 0.0 0.025 124-125 0.6625000000000001 0.0 0.0 0.0 0.025 126-127 0.7625 0.0 0.0 0.0 0.025 128-129 0.975 0.0 0.0 0.0 0.025 130-131 1.0625 0.0 0.0 0.0 0.025 132-133 1.1625 0.0 0.0 0.0 0.025 134-135 1.2375 0.0 0.0 0.0 0.025 136-137 1.3 0.0 0.0 0.0 0.025 138-139 1.55 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACGAAA 10 0.006830828 145.0 1 CCTTCTT 40 0.005621335 54.375 145 >>END_MODULE SRR7804209 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804209_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.186 37.0 37.0 37.0 37.0 37.0 2 35.757 37.0 37.0 37.0 37.0 37.0 3 35.924 37.0 37.0 37.0 37.0 37.0 4 35.9785 37.0 37.0 37.0 37.0 37.0 5 36.198 37.0 37.0 37.0 37.0 37.0 6 36.057 37.0 37.0 37.0 37.0 37.0 7 35.954 37.0 37.0 37.0 37.0 37.0 8 36.1605 37.0 37.0 37.0 37.0 37.0 9 36.119 37.0 37.0 37.0 37.0 37.0 10-14 36.0823 37.0 37.0 37.0 37.0 37.0 15-19 35.9461 37.0 37.0 37.0 37.0 37.0 20-24 35.9656 37.0 37.0 37.0 37.0 37.0 25-29 35.8798 37.0 37.0 37.0 37.0 37.0 30-34 35.8965 37.0 37.0 37.0 37.0 37.0 35-39 35.7477 37.0 37.0 37.0 37.0 37.0 40-44 35.730599999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.6734 37.0 37.0 37.0 37.0 37.0 50-54 35.670500000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.616600000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.5766 37.0 37.0 37.0 37.0 37.0 65-69 35.51559999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.4397 37.0 37.0 37.0 37.0 37.0 75-79 35.3962 37.0 37.0 37.0 37.0 37.0 80-84 35.3037 37.0 37.0 37.0 34.6 37.0 85-89 35.244400000000006 37.0 37.0 37.0 29.8 37.0 90-94 35.2344 37.0 37.0 37.0 32.2 37.0 95-99 35.0594 37.0 37.0 37.0 27.4 37.0 100-104 35.0325 37.0 37.0 37.0 25.0 37.0 105-109 35.0154 37.0 37.0 37.0 25.0 37.0 110-114 34.7873 37.0 37.0 37.0 25.0 37.0 115-119 34.739700000000006 37.0 37.0 37.0 25.0 37.0 120-124 34.6982 37.0 37.0 37.0 25.0 37.0 125-129 34.6088 37.0 37.0 37.0 25.0 37.0 130-134 34.5758 37.0 37.0 37.0 25.0 37.0 135-139 34.3126 37.0 37.0 37.0 25.0 37.0 140-144 34.1777 37.0 37.0 37.0 25.0 37.0 145-149 34.122800000000005 37.0 37.0 37.0 25.0 37.0 150-151 33.35825 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 3.0 15 1.0 16 2.0 17 2.0 18 0.0 19 3.0 20 5.0 21 1.0 22 7.0 23 8.0 24 6.0 25 10.0 26 13.0 27 23.0 28 23.0 29 39.0 30 52.0 31 75.0 32 114.0 33 173.0 34 390.0 35 946.0 36 2037.0 37 61.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.275 13.075000000000001 11.125 37.525 2 28.775000000000002 19.85 30.825000000000003 20.549999999999997 3 23.525 23.45 25.374999999999996 27.650000000000002 4 26.974999999999998 33.025 17.8 22.2 5 27.425 32.425 18.525 21.625 6 21.2 34.075 19.15 25.575 7 21.5 14.774999999999999 36.85 26.875 8 23.25 19.375 23.0 34.375 9 24.25 21.775 23.75 30.225 10-14 25.845000000000002 24.92 22.165000000000003 27.07 15-19 25.915 24.19 23.165 26.729999999999997 20-24 26.450000000000003 24.535 22.485 26.529999999999998 25-29 26.575 24.240000000000002 22.564999999999998 26.619999999999997 30-34 26.119999999999997 24.215 22.91 26.755000000000003 35-39 26.534999999999997 24.73 22.125 26.61 40-44 26.735 23.785 22.994999999999997 26.484999999999996 45-49 27.229999999999997 24.490000000000002 22.63 25.650000000000002 50-54 27.195000000000004 24.145 22.82 25.840000000000003 55-59 27.98 23.915 22.45 25.655 60-64 27.41 24.05 22.525000000000002 26.015 65-69 27.655 23.835 22.545 25.965 70-74 27.275 24.18 22.435 26.11 75-79 27.250000000000004 23.74 22.85 26.16 80-84 27.54 23.799999999999997 23.03 25.629999999999995 85-89 27.195000000000004 23.465 23.055 26.284999999999997 90-94 27.11 23.935000000000002 22.96 25.995 95-99 27.21 24.355 22.52 25.915 100-104 26.905 23.75 22.97 26.375 105-109 27.860000000000003 23.635 22.605 25.900000000000002 110-114 27.825 24.12 22.665 25.39 115-119 27.42 24.21 22.645 25.724999999999998 120-124 27.245 23.810000000000002 23.41 25.535000000000004 125-129 27.365000000000002 24.015 23.25 25.369999999999997 130-134 27.71 24.22 22.770000000000003 25.3 135-139 27.32 25.005 22.71 24.965 140-144 27.275 24.375 22.875 25.474999999999998 145-149 27.634999999999998 25.314999999999998 22.21 24.84 150-151 27.375 24.125 23.3625 25.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.5 25 2.5 26 3.0 27 1.5 28 3.0 29 4.0 30 3.0 31 6.5 32 11.5 33 13.0 34 12.5 35 21.5 36 32.5 37 40.0 38 48.0 39 71.5 40 94.5 41 101.0 42 115.5 43 124.0 44 134.0 45 150.5 46 160.0 47 153.5 48 151.0 49 148.5 50 135.5 51 133.5 52 139.0 53 130.0 54 106.0 55 102.0 56 101.5 57 93.0 58 98.5 59 99.5 60 95.0 61 100.0 62 96.5 63 94.5 64 94.5 65 92.0 66 86.0 67 85.0 68 86.5 69 76.0 70 62.5 71 58.0 72 55.0 73 41.5 74 36.0 75 29.0 76 15.0 77 9.0 78 9.0 79 7.0 80 4.5 81 2.5 82 2.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.5 88 2.0 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 95.73410102067521 91.45 2 3.9518450667364564 7.55 3 0.20936927505888508 0.6 4 0.10468463752944254 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0125 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.025 0.0 0.025 0.0 0.0 86-87 0.05 0.0 0.025 0.0 0.0 88-89 0.05 0.0 0.025 0.0 0.0 90-91 0.05 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.05 0.0 0.025 0.0 0.0 96-97 0.075 0.0 0.025 0.0 0.0 98-99 0.1 0.0 0.025 0.0 0.0 100-101 0.1 0.0 0.025 0.0 0.0 102-103 0.15 0.0 0.025 0.0 0.0 104-105 0.175 0.0 0.025 0.0 0.0 106-107 0.2 0.0 0.025 0.0 0.0 108-109 0.2375 0.0 0.025 0.0 0.0 110-111 0.2625 0.0 0.025 0.0 0.0 112-113 0.30000000000000004 0.0 0.025 0.0 0.0 114-115 0.35 0.0 0.025 0.0 0.0 116-117 0.3875 0.0 0.025 0.0 0.0 118-119 0.4625 0.0 0.025 0.0 0.0 120-121 0.5 0.0 0.025 0.0 0.0 122-123 0.5625 0.0 0.025 0.0 0.0 124-125 0.6375 0.0 0.025 0.0 0.0 126-127 0.7375 0.0 0.025 0.0 0.0 128-129 0.95 0.0 0.025 0.0 0.0 130-131 1.0375 0.0 0.025 0.0 0.0 132-133 1.1375 0.0 0.025 0.0 0.0 134-135 1.2125 0.0 0.025 0.0 0.0 136-137 1.275 0.0 0.025 0.0 0.0 138-139 1.525 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAGA 10 0.006830828 145.0 1 AAAAGCA 10 0.006830828 145.0 3 CTTGTGC 10 0.006830828 145.0 8 >>END_MODULE Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245781 spots for SRR7804209.sra Written 1245781 spots for SRR7804209.sra Read 1245798 spots for SRR7804209.sra Written 1245798 spots for SRR7804209.sra SRR ids: ['SRR7804209.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_81yrdex8 SRR7804209.sra spots: 24915637 blocks: [[1, 1245781], [1245782, 2491562], [2491563, 3737343], [3737344, 4983124], [4983125, 6228905], [6228906, 7474686], [7474687, 8720467], [8720468, 9966248], [9966249, 11212029], [11212030, 12457810], [12457811, 13703591], [13703592, 14949372], [14949373, 16195153], [16195154, 17440934], [17440935, 18686715], [18686716, 19932496], [19932497, 21178277], [21178278, 22424058], [22424059, 23669839], [23669840, 24915637]] SRR7804209 file size 8421391 SRR7804209 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804209 SRR7804209_1.fastq SRR7804209_2.fastq Input file: SRR7804209_1.fastq Paired file: SRR7804209_2.fastq trimmed: SRR7804209-trimmed-pair1.fastq, SRR7804209-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:05:40 2024 >> started Sat Dec 7 18:06:20 2024 >> done (40.645s) 24915637 read pairs processed; of these: 82 ( 0.00%) short read pairs filtered out after trimming by size control 563 ( 0.00%) empty read pairs filtered out after trimming by size control 24914992 (100.00%) read pairs available; of these: 668150 ( 2.68%) trimmed read pairs available after processing 24246842 (97.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 19 0.00% 20 8 0.00% 21 20 0.00% 22 21 0.00% 23 23 0.00% 24 25 0.00% 25 34 0.00% 26 24 0.00% 27 27 0.00% 28 36 0.00% 29 31 0.00% 30 38 0.00% 31 46 0.00% 32 36 0.00% 33 59 0.00% 34 43 0.00% 35 59 0.00% 36 37 0.00% 37 42 0.00% 38 63 0.00% 39 49 0.00% 40 46 0.00% 41 50 0.00% 42 58 0.00% 43 48 0.00% 44 61 0.00% 45 71 0.00% 46 66 0.00% 47 51 0.00% 48 56 0.00% 49 69 0.00% 50 77 0.00% 51 68 0.00% 52 69 0.00% 53 91 0.00% 54 91 0.00% 55 92 0.00% 56 105 0.00% 57 89 0.00% 58 95 0.00% 59 101 0.00% 60 112 0.00% 61 113 0.00% 62 118 0.00% 63 111 0.00% 64 110 0.00% 65 119 0.00% 66 132 0.00% 67 124 0.00% 68 159 0.00% 69 172 0.00% 70 188 0.00% 71 181 0.00% 72 229 0.00% 73 238 0.00% 74 257 0.00% 75 283 0.00% 76 299 0.00% 77 294 0.00% 78 351 0.00% 79 374 0.00% 80 406 0.00% 81 489 0.00% 82 587 0.00% 83 617 0.00% 84 749 0.00% 85 798 0.00% 86 788 0.00% 87 830 0.00% 88 945 0.00% 89 1042 0.00% 90 1229 0.00% 91 1321 0.01% 92 1409 0.01% 93 1588 0.01% 94 1793 0.01% 95 1914 0.01% 96 2058 0.01% 97 2121 0.01% 98 2393 0.01% 99 2520 0.01% 100 2665 0.01% 101 2986 0.01% 102 3173 0.01% 103 3450 0.01% 104 3766 0.02% 105 4034 0.02% 106 4343 0.02% 107 4442 0.02% 108 4768 0.02% 109 5016 0.02% 110 5076 0.02% 111 5525 0.02% 112 5980 0.02% 113 6253 0.03% 114 6635 0.03% 115 7220 0.03% 116 7602 0.03% 117 7630 0.03% 118 7917 0.03% 119 8153 0.03% 120 8486 0.03% 121 9079 0.04% 122 9756 0.04% 123 10409 0.04% 124 10827 0.04% 125 11412 0.05% 126 11981 0.05% 127 12289 0.05% 128 12428 0.05% 129 12702 0.05% 130 13298 0.05% 131 13662 0.05% 132 14783 0.06% 133 15138 0.06% 134 16031 0.06% 135 16639 0.07% 136 17617 0.07% 137 18161 0.07% 138 18562 0.07% 139 19180 0.08% 140 19615 0.08% 141 20093 0.08% 142 20658 0.08% 143 21223 0.09% 144 22633 0.09% 145 23644 0.09% 146 24455 0.10% 147 25220 0.10% 148 25967 0.10% 149 26285 0.11% 150 27516 0.11% 151 24246842 97.32% 24914992 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=22 prefix-density=0.75 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=33.42 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.9 sequence=CCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=19 prefix-density=0.57 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=15.34 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.0 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804209 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:07:27 Started mapping on | Dec 07 18:07:27 Finished on | Dec 07 18:11:04 Mapping speed, Million of reads per hour | 413.34 Number of input reads | 24914992 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 23455112 Uniquely mapped reads % | 94.14% Average mapped length | 299.81 Number of splices: Total | 24567759 Number of splices: Annotated (sjdb) | 23222095 Number of splices: GT/AG | 24259746 Number of splices: GC/AG | 264297 Number of splices: AT/AC | 10899 Number of splices: Non-canonical | 32817 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 257817 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 19805 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.09% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1202063 1202063 1202063 N_multimapping 257817 257817 257817 N_noFeature 672435 22778269 899104 N_ambiguous 548356 3508 98489 UnstrandedReadsAssigned:22234321 PositiveStrandReadsAssigned:673335 NegativeStrandReadsAssigned:22457519 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804209 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804209-trimmed-pair1.fastq SRR7804209-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,914,992 reads, 22,715,808 reads pseudoaligned [quant] estimated average fragment length: 329.81 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 SRR7804209.ke.tsv 35125 SRR7804209.se.tsv 88098 total ==> SRR7804209.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 608.261 0 0 PNS24247 1044 715.19 88.9507 6.68405 PNS24249 1928 1599.19 144.56 4.85801 PNS24246 1044 715.19 88.9507 6.68405 PNS24248 1044 715.19 88.9507 6.68405 PNS24244 1471 1142.19 132.588 6.23847 PNS24243 293 72.0209 0 0 KQK14069 1603 1274.19 5642.65 237.991 KQK14071 474 191.137 82.5298 23.2048 ==> SRR7804209.se.tsv <== BRADI_1g14170v3 6225 BRADI_1g53295v3 577 BRADI_1g59795v3 675 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1875 BRADI_1g74790v3 1270 BRADI_1g09890v3 4 BRADI_1g77505v3 301 BRADI_1g48960v3 1 SRR7804209 completed mapping pipeline successfully