Starting /dee2/code/volunteer_pipeline.sh SRR7804210 current disk space = 1540856606720 free memory = 1439064592 SRR7804210 SRAfilesize 30a289b8075baed60beaa474f19578c0 SRR7804210.sra SRR7804210.sra file validated SRR7804210 is paired end SRR7804210 is conventional basespace SRR7804210 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804210_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.199 37.0 37.0 37.0 37.0 37.0 2 36.236 37.0 37.0 37.0 37.0 37.0 3 36.4145 37.0 37.0 37.0 37.0 37.0 4 36.537 37.0 37.0 37.0 37.0 37.0 5 36.4785 37.0 37.0 37.0 37.0 37.0 6 36.418 37.0 37.0 37.0 37.0 37.0 7 36.3825 37.0 37.0 37.0 37.0 37.0 8 36.473 37.0 37.0 37.0 37.0 37.0 9 36.446 37.0 37.0 37.0 37.0 37.0 10-14 36.536199999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5229 37.0 37.0 37.0 37.0 37.0 20-24 36.482 37.0 37.0 37.0 37.0 37.0 25-29 36.41439999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3829 37.0 37.0 37.0 37.0 37.0 35-39 36.3632 37.0 37.0 37.0 37.0 37.0 40-44 36.3094 37.0 37.0 37.0 37.0 37.0 45-49 36.3098 37.0 37.0 37.0 37.0 37.0 50-54 36.27 37.0 37.0 37.0 37.0 37.0 55-59 36.2471 37.0 37.0 37.0 37.0 37.0 60-64 36.173500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.119600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.0532 37.0 37.0 37.0 37.0 37.0 75-79 36.031 37.0 37.0 37.0 37.0 37.0 80-84 36.0465 37.0 37.0 37.0 37.0 37.0 85-89 36.009699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9151 37.0 37.0 37.0 37.0 37.0 95-99 35.8365 37.0 37.0 37.0 37.0 37.0 100-104 35.8029 37.0 37.0 37.0 37.0 37.0 105-109 35.745000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.769600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6982 37.0 37.0 37.0 37.0 37.0 120-124 35.5567 37.0 37.0 37.0 37.0 37.0 125-129 35.552099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.365500000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.3641 37.0 37.0 37.0 37.0 37.0 140-144 35.3319 37.0 37.0 37.0 32.2 37.0 145-149 35.127500000000005 37.0 37.0 37.0 27.4 37.0 150-151 34.5795 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 2.0 24 2.0 25 10.0 26 8.0 27 14.0 28 16.0 29 26.0 30 37.0 31 51.0 32 70.0 33 116.0 34 177.0 35 436.0 36 2743.0 37 288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.8796992481203 13.43358395989975 10.200501253132831 34.48621553884712 2 24.675 17.4 34.599999999999994 23.325000000000003 3 24.2 24.125 22.925 28.749999999999996 4 26.325 31.55 17.625 24.5 5 25.124999999999996 31.75 22.725 20.4 6 20.5 31.85 23.474999999999998 24.175 7 17.325 19.05 41.175 22.45 8 21.45 19.7 26.875 31.974999999999998 9 22.425 20.05 28.325 29.2 10-14 23.724999999999998 26.1 24.349999999999998 25.825 15-19 23.44 25.555 24.945 26.06 20-24 23.505000000000003 25.105 24.959999999999997 26.43 25-29 23.580000000000002 25.569999999999997 25.275 25.575 30-34 23.89 25.174999999999997 24.465 26.47 35-39 23.885 24.349999999999998 24.94 26.825 40-44 23.895 24.795 24.715 26.595000000000002 45-49 24.279999999999998 24.765 24.785 26.169999999999998 50-54 23.855 25.145 25.119999999999997 25.88 55-59 23.91 25.09 24.585 26.415 60-64 23.62 24.935 24.135 27.310000000000002 65-69 24.060000000000002 24.759999999999998 24.135 27.045 70-74 24.295 24.465 24.22 27.02 75-79 24.635 25.0 24.224999999999998 26.14 80-84 24.27 25.105 24.21 26.415 85-89 24.325 24.154999999999998 24.665 26.855 90-94 24.33 24.195 24.94 26.534999999999997 95-99 24.845 23.95 24.26 26.945000000000004 100-104 24.515 24.595 24.51 26.38 105-109 24.545 24.16 24.625 26.669999999999998 110-114 25.15 24.395 24.07 26.384999999999998 115-119 25.305 24.425 23.73 26.540000000000003 120-124 25.72 23.595 24.04 26.645000000000003 125-129 25.4 24.085 24.3 26.215 130-134 24.7 23.635 24.69 26.974999999999998 135-139 24.965 24.115000000000002 23.97 26.950000000000003 140-144 24.895 23.73 24.404999999999998 26.97 145-149 25.34 23.505000000000003 24.12 27.034999999999997 150-151 25.4 23.5375 23.849999999999998 27.212500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 0.5 3 1.0 4 2.0 5 2.0 6 1.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 3.0 26 2.5 27 1.5 28 3.0 29 8.5 30 11.5 31 9.5 32 13.0 33 19.0 34 25.5 35 36.5 36 51.0 37 63.5 38 73.0 39 80.0 40 100.0 41 130.5 42 155.0 43 158.5 44 168.0 45 181.5 46 187.0 47 193.5 48 175.5 49 157.5 50 148.5 51 136.5 52 117.0 53 112.0 54 109.0 55 100.5 56 97.0 57 98.5 58 96.5 59 78.5 60 70.5 61 77.0 62 71.5 63 63.0 64 69.0 65 69.0 66 63.0 67 55.0 68 54.0 69 51.5 70 41.5 71 41.5 72 37.5 73 31.5 74 29.5 75 22.0 76 13.0 77 7.0 78 5.5 79 4.5 80 2.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.40441176470588 90.825 2 4.227941176470589 8.05 3 0.34138655462184875 0.975 4 0.0 0.0 5 0.0 0.0 6 0.026260504201680673 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.5874999999999999 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 0.9125000000000001 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.0875 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3 0.0 0.0 0.0 0.0 132-133 1.3375 0.0 0.0 0.0 0.0 134-135 1.4875 0.0 0.0 0.0 0.0 136-137 1.5625 0.0 0.0 0.0 0.0 138-139 1.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAAA 10 0.006830828 145.0 6 GCCCTGG 10 0.006830828 145.0 145 >>END_MODULE SRR7804210 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804210_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0745 37.0 37.0 37.0 37.0 37.0 2 35.7215 37.0 37.0 37.0 37.0 37.0 3 35.806 37.0 37.0 37.0 37.0 37.0 4 36.0155 37.0 37.0 37.0 37.0 37.0 5 36.162 37.0 37.0 37.0 37.0 37.0 6 35.896 37.0 37.0 37.0 37.0 37.0 7 35.7485 37.0 37.0 37.0 37.0 37.0 8 35.9635 37.0 37.0 37.0 37.0 37.0 9 36.0255 37.0 37.0 37.0 37.0 37.0 10-14 35.924099999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.8304 37.0 37.0 37.0 37.0 37.0 20-24 35.7695 37.0 37.0 37.0 37.0 37.0 25-29 35.7512 37.0 37.0 37.0 37.0 37.0 30-34 35.695899999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.5661 37.0 37.0 37.0 37.0 37.0 40-44 35.601600000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.474599999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.4247 37.0 37.0 37.0 37.0 37.0 55-59 35.4105 37.0 37.0 37.0 37.0 37.0 60-64 35.3172 37.0 37.0 37.0 34.6 37.0 65-69 35.2682 37.0 37.0 37.0 32.2 37.0 70-74 35.1625 37.0 37.0 37.0 29.8 37.0 75-79 35.205799999999996 37.0 37.0 37.0 29.8 37.0 80-84 35.11540000000001 37.0 37.0 37.0 27.4 37.0 85-89 35.03580000000001 37.0 37.0 37.0 27.4 37.0 90-94 34.981700000000004 37.0 37.0 37.0 25.0 37.0 95-99 34.80200000000001 37.0 37.0 37.0 25.0 37.0 100-104 34.803700000000006 37.0 37.0 37.0 25.0 37.0 105-109 34.7583 37.0 37.0 37.0 25.0 37.0 110-114 34.5947 37.0 37.0 37.0 25.0 37.0 115-119 34.527300000000004 37.0 37.0 37.0 25.0 37.0 120-124 34.435599999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.3392 37.0 37.0 37.0 25.0 37.0 130-134 34.3281 37.0 37.0 37.0 25.0 37.0 135-139 34.121 37.0 37.0 37.0 25.0 37.0 140-144 33.8977 37.0 37.0 37.0 25.0 37.0 145-149 33.782300000000006 37.0 37.0 37.0 25.0 37.0 150-151 33.23975 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 9.0 15 5.0 16 2.0 17 2.0 18 3.0 19 4.0 20 5.0 21 12.0 22 6.0 23 8.0 24 14.0 25 8.0 26 19.0 27 23.0 28 24.0 29 34.0 30 56.0 31 68.0 32 141.0 33 232.0 34 348.0 35 947.0 36 1968.0 37 54.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.3 13.950000000000001 11.275 33.475 2 27.450000000000003 19.325 29.575000000000003 23.65 3 25.624999999999996 22.525000000000002 25.525 26.325 4 27.875 31.4 16.525000000000002 24.2 5 28.125 31.7 18.35 21.825 6 23.35 32.324999999999996 18.375 25.95 7 21.325 15.475 35.35 27.85 8 22.425 19.85 22.325 35.4 9 24.875 20.424999999999997 23.65 31.05 10-14 26.235000000000003 25.064999999999998 21.94 26.76 15-19 26.605 23.66 23.13 26.605 20-24 26.22 24.375 22.56 26.845000000000002 25-29 26.540000000000003 24.08 22.509999999999998 26.87 30-34 26.82 23.76 22.545 26.875 35-39 26.185000000000002 24.759999999999998 22.345000000000002 26.71 40-44 26.96 24.14 22.53 26.369999999999997 45-49 27.145000000000003 24.044999999999998 22.6 26.21 50-54 26.515 24.47 23.09 25.924999999999997 55-59 27.134999999999998 24.075 22.14 26.650000000000002 60-64 27.015 23.91 23.09 25.985000000000003 65-69 27.400000000000002 23.965 23.200000000000003 25.435000000000002 70-74 27.08 23.695 22.650000000000002 26.575 75-79 27.255000000000003 24.065 22.325 26.355 80-84 26.865 24.099999999999998 23.26 25.775 85-89 27.800000000000004 24.02 22.295 25.885 90-94 27.785 23.97 22.41 25.835 95-99 27.505000000000003 23.78 22.97 25.745 100-104 27.155 23.705000000000002 23.119999999999997 26.02 105-109 27.405 23.895 22.395 26.305 110-114 27.865000000000002 24.0 22.445 25.69 115-119 26.950000000000003 24.279999999999998 22.869999999999997 25.900000000000002 120-124 28.084999999999997 24.205 22.55 25.16 125-129 27.750000000000004 24.335 22.43 25.485000000000003 130-134 27.62 24.2 22.720000000000002 25.46 135-139 28.205000000000002 23.715 22.665 25.415 140-144 27.925 24.525 22.43 25.119999999999997 145-149 28.26 24.34 22.59 24.81 150-151 28.475 24.1375 22.7125 24.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 1.0 6 1.5 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 1.5 26 0.5 27 2.5 28 3.5 29 1.5 30 2.5 31 4.0 32 7.0 33 11.0 34 13.5 35 22.5 36 34.0 37 39.0 38 58.5 39 77.0 40 84.5 41 101.5 42 115.5 43 127.0 44 136.5 45 148.0 46 153.0 47 141.5 48 138.0 49 137.0 50 148.0 51 147.5 52 117.0 53 114.5 54 112.0 55 106.0 56 102.5 57 94.0 58 97.0 59 116.5 60 112.0 61 93.5 62 100.5 63 99.0 64 89.0 65 80.5 66 82.0 67 82.5 68 86.5 69 86.0 70 65.5 71 51.5 72 53.5 73 50.0 74 36.0 75 19.5 76 16.0 77 17.0 78 10.5 79 7.5 80 5.0 81 2.5 82 2.0 83 2.5 84 2.5 85 1.5 86 1.0 87 1.0 88 0.5 89 1.0 90 1.5 91 0.5 92 0.0 93 0.0 94 0.0 95 1.0 96 1.5 97 0.5 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.41984732824427 90.625 2 4.027375625164517 7.6499999999999995 3 0.47380889707817847 1.35 4 0.026322716504343247 0.1 5 0.026322716504343247 0.125 6 0.026322716504343247 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTCGAATCTCCATTCCCAAGGAAGGAAGAAAATCCAGCGAAACCAGAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.825 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.9875 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.2 0.0 0.0 0.0 0.0 132-133 1.2375 0.0 0.0 0.0 0.0 134-135 1.3875 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACTT 10 0.006830828 145.0 2 TCAATGC 10 0.006830828 145.0 3 TCACTTC 10 0.006830828 145.0 3 >>END_MODULE Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400861 spots for SRR7804210.sra Written 1400861 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra Read 1400854 spots for SRR7804210.sra Written 1400854 spots for SRR7804210.sra SRR ids: ['SRR7804210.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tbkfn1a9 SRR7804210.sra spots: 28017087 blocks: [[1, 1400854], [1400855, 2801708], [2801709, 4202562], [4202563, 5603416], [5603417, 7004270], [7004271, 8405124], [8405125, 9805978], [9805979, 11206832], [11206833, 12607686], [12607687, 14008540], [14008541, 15409394], [15409395, 16810248], [16810249, 18211102], [18211103, 19611956], [19611957, 21012810], [21012811, 22413664], [22413665, 23814518], [23814519, 25215372], [25215373, 26616226], [26616227, 28017087]] SRR7804210 file size 9472371 SRR7804210 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804210 SRR7804210_1.fastq SRR7804210_2.fastq Input file: SRR7804210_1.fastq Paired file: SRR7804210_2.fastq trimmed: SRR7804210-trimmed-pair1.fastq, SRR7804210-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:09:20 2024 >> started Sat Dec 7 18:10:02 2024 >> done (42.141s) 28017087 read pairs processed; of these: 87 ( 0.00%) short read pairs filtered out after trimming by size control 4208 ( 0.02%) empty read pairs filtered out after trimming by size control 28012792 (99.98%) read pairs available; of these: 794569 ( 2.84%) trimmed read pairs available after processing 27218223 (97.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 10 0.00% 20 19 0.00% 21 22 0.00% 22 20 0.00% 23 25 0.00% 24 21 0.00% 25 35 0.00% 26 29 0.00% 27 32 0.00% 28 42 0.00% 29 41 0.00% 30 43 0.00% 31 37 0.00% 32 65 0.00% 33 41 0.00% 34 54 0.00% 35 51 0.00% 36 65 0.00% 37 66 0.00% 38 63 0.00% 39 61 0.00% 40 51 0.00% 41 64 0.00% 42 64 0.00% 43 60 0.00% 44 64 0.00% 45 59 0.00% 46 81 0.00% 47 73 0.00% 48 77 0.00% 49 72 0.00% 50 84 0.00% 51 77 0.00% 52 85 0.00% 53 96 0.00% 54 106 0.00% 55 103 0.00% 56 108 0.00% 57 106 0.00% 58 101 0.00% 59 121 0.00% 60 148 0.00% 61 125 0.00% 62 151 0.00% 63 153 0.00% 64 139 0.00% 65 171 0.00% 66 168 0.00% 67 184 0.00% 68 209 0.00% 69 232 0.00% 70 230 0.00% 71 265 0.00% 72 311 0.00% 73 364 0.00% 74 359 0.00% 75 394 0.00% 76 463 0.00% 77 465 0.00% 78 493 0.00% 79 660 0.00% 80 652 0.00% 81 767 0.00% 82 842 0.00% 83 939 0.00% 84 1023 0.00% 85 1138 0.00% 86 1179 0.00% 87 1361 0.00% 88 1440 0.01% 89 1516 0.01% 90 1803 0.01% 91 1875 0.01% 92 2052 0.01% 93 2276 0.01% 94 2488 0.01% 95 2675 0.01% 96 2830 0.01% 97 3153 0.01% 98 3346 0.01% 99 3463 0.01% 100 3698 0.01% 101 3904 0.01% 102 4197 0.01% 103 4661 0.02% 104 4741 0.02% 105 5088 0.02% 106 5425 0.02% 107 5703 0.02% 108 6119 0.02% 109 6476 0.02% 110 6720 0.02% 111 6958 0.02% 112 7289 0.03% 113 7777 0.03% 114 8369 0.03% 115 8707 0.03% 116 9054 0.03% 117 9241 0.03% 118 9833 0.04% 119 10322 0.04% 120 10684 0.04% 121 11181 0.04% 122 11594 0.04% 123 12388 0.04% 124 13007 0.05% 125 13417 0.05% 126 13892 0.05% 127 14336 0.05% 128 14802 0.05% 129 15403 0.05% 130 15687 0.06% 131 16626 0.06% 132 17504 0.06% 133 17718 0.06% 134 18674 0.07% 135 19670 0.07% 136 20119 0.07% 137 20579 0.07% 138 21138 0.08% 139 21721 0.08% 140 22323 0.08% 141 22928 0.08% 142 23628 0.08% 143 24770 0.09% 144 25793 0.09% 145 26903 0.10% 146 27815 0.10% 147 28719 0.10% 148 29571 0.11% 149 30011 0.11% 150 32677 0.12% 151 27218223 97.16% 28012792 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=23 prefix-density=0.64 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=210.57 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=11.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=18 prefix-density=0.49 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=19.11 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.3 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804210 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:11:00 Started mapping on | Dec 07 18:11:00 Finished on | Dec 07 18:14:45 Mapping speed, Million of reads per hour | 448.20 Number of input reads | 28012792 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 26315835 Uniquely mapped reads % | 93.94% Average mapped length | 299.60 Number of splices: Total | 27503509 Number of splices: Annotated (sjdb) | 25956939 Number of splices: GT/AG | 27158838 Number of splices: GC/AG | 294475 Number of splices: AT/AC | 12067 Number of splices: Non-canonical | 38129 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305871 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 22648 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.26% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1391086 1391086 1391086 N_multimapping 305871 305871 305871 N_noFeature 760778 25534106 1036838 N_ambiguous 617627 4203 112247 UnstrandedReadsAssigned:24937430 PositiveStrandReadsAssigned:777526 NegativeStrandReadsAssigned:25166750 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804210 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804210-trimmed-pair1.fastq SRR7804210-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,012,792 reads, 25,521,821 reads pseudoaligned [quant] estimated average fragment length: 330.877 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52973 SRR7804210.ke.tsv 35125 SRR7804210.se.tsv 88098 total ==> SRR7804210.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 607.5 0 0 PNS24247 1044 714.123 112.449 7.48482 PNS24249 1928 1598.12 213.191 6.34102 PNS24246 1044 714.123 112.449 7.48482 PNS24248 1044 714.123 112.449 7.48482 PNS24244 1471 1141.12 157.463 6.55911 PNS24243 293 72.9172 0 0 KQK14069 1603 1273.12 6152.86 229.724 KQK14071 474 191.71 88.5529 21.9562 ==> SRR7804210.se.tsv <== BRADI_1g14170v3 6673 BRADI_1g53295v3 624 BRADI_1g59795v3 844 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 1734 BRADI_1g74790v3 1543 BRADI_1g09890v3 1 BRADI_1g77505v3 376 BRADI_1g48960v3 2 SRR7804210 completed mapping pipeline successfully