Starting /dee2/code/volunteer_pipeline.sh SRR7804211 current disk space = 1540869201920 free memory = 1600884744 SRR7804211 SRAfilesize 47e8dc26d6a6aabb71757a17825d523b SRR7804211.sra SRR7804211.sra file validated SRR7804211 is paired end SRR7804211 is conventional basespace SRR7804211 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804211_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.13525 37.0 37.0 37.0 37.0 37.0 2 36.087 37.0 37.0 37.0 37.0 37.0 3 36.231 37.0 37.0 37.0 37.0 37.0 4 36.4675 37.0 37.0 37.0 37.0 37.0 5 36.539 37.0 37.0 37.0 37.0 37.0 6 36.4625 37.0 37.0 37.0 37.0 37.0 7 36.289 37.0 37.0 37.0 37.0 37.0 8 36.428 37.0 37.0 37.0 37.0 37.0 9 36.409 37.0 37.0 37.0 37.0 37.0 10-14 36.4528 37.0 37.0 37.0 37.0 37.0 15-19 36.446 37.0 37.0 37.0 37.0 37.0 20-24 36.408300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.361900000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.291999999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.255700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2173 37.0 37.0 37.0 37.0 37.0 45-49 36.165499999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.173 37.0 37.0 37.0 37.0 37.0 55-59 36.1079 37.0 37.0 37.0 37.0 37.0 60-64 36.108000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0599 37.0 37.0 37.0 37.0 37.0 70-74 35.9821 37.0 37.0 37.0 37.0 37.0 75-79 35.94969999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.9617 37.0 37.0 37.0 37.0 37.0 85-89 35.9304 37.0 37.0 37.0 37.0 37.0 90-94 35.8928 37.0 37.0 37.0 37.0 37.0 95-99 35.7452 37.0 37.0 37.0 37.0 37.0 100-104 35.7428 37.0 37.0 37.0 37.0 37.0 105-109 35.733900000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.732600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6379 37.0 37.0 37.0 37.0 37.0 120-124 35.4895 37.0 37.0 37.0 37.0 37.0 125-129 35.519999999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.3107 37.0 37.0 37.0 32.2 37.0 135-139 35.3098 37.0 37.0 37.0 32.2 37.0 140-144 35.3135 37.0 37.0 37.0 29.8 37.0 145-149 35.189499999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.476 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 4.0 24 4.0 25 6.0 26 13.0 27 10.0 28 22.0 29 21.0 30 44.0 31 47.0 32 78.0 33 126.0 34 199.0 35 484.0 36 2724.0 37 215.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.74166875469807 13.204710598847408 9.596592332748685 36.457028313705834 2 24.224999999999998 18.099999999999998 34.2 23.474999999999998 3 23.025000000000002 24.474999999999998 23.0 29.5 4 26.1 30.75 20.599999999999998 22.55 5 26.575 30.875000000000004 22.325 20.225 6 21.925 32.9 24.0 21.175 7 17.75 20.1 41.325 20.825 8 20.5 19.950000000000003 28.000000000000004 31.55 9 20.95 21.375 30.95 26.724999999999998 10-14 23.57 26.345000000000002 24.66 25.424999999999997 15-19 23.595 24.465 25.874999999999996 26.064999999999998 20-24 22.985 25.174999999999997 25.380000000000003 26.46 25-29 23.45 25.419999999999998 25.035 26.095000000000002 30-34 23.82 25.215 25.185000000000002 25.779999999999998 35-39 23.990000000000002 25.16 24.945 25.905 40-44 24.055 25.290000000000003 24.755 25.900000000000002 45-49 23.919999999999998 24.705 24.625 26.75 50-54 23.615 25.365 24.310000000000002 26.71 55-59 24.11 25.305 23.91 26.674999999999997 60-64 24.025 24.925 24.575 26.474999999999998 65-69 24.165 24.265 24.765 26.805 70-74 24.305 24.915000000000003 24.645 26.135 75-79 24.635 23.875 24.665 26.825 80-84 24.66 24.575 24.64 26.125 85-89 24.55 24.0 24.740000000000002 26.71 90-94 25.064999999999998 24.135 24.2 26.6 95-99 25.06 23.974999999999998 24.58 26.384999999999998 100-104 25.145 24.285 24.310000000000002 26.26 105-109 25.035 24.055 24.47 26.44 110-114 24.65 24.825 23.96 26.565 115-119 25.285000000000004 23.935000000000002 24.205 26.575 120-124 24.355 23.915 24.560000000000002 27.169999999999998 125-129 24.745 24.035 24.47 26.75 130-134 25.82 23.669999999999998 24.485 26.025 135-139 25.86 23.91 24.075 26.155 140-144 25.27 24.36 23.885 26.484999999999996 145-149 25.55 23.82 24.03 26.6 150-151 26.4625 23.275000000000002 24.0125 26.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 1.5 20 0.0 21 1.5 22 1.5 23 0.0 24 0.5 25 0.5 26 0.0 27 3.5 28 6.0 29 4.5 30 7.0 31 9.5 32 18.5 33 22.5 34 24.5 35 43.5 36 53.0 37 54.5 38 75.5 39 99.0 40 108.5 41 125.0 42 147.5 43 171.0 44 174.5 45 161.5 46 176.0 47 188.5 48 171.5 49 152.0 50 154.0 51 165.0 52 144.5 53 122.0 54 103.5 55 91.0 56 95.5 57 88.0 58 81.0 59 81.0 60 87.0 61 82.5 62 75.5 63 71.5 64 65.5 65 64.5 66 61.5 67 61.0 68 51.0 69 39.5 70 38.0 71 35.5 72 35.5 73 27.5 74 16.0 75 15.0 76 11.0 77 6.5 78 7.0 79 6.0 80 3.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.275 #Duplication Level Percentage of deduplicated Percentage of total 1 95.53922854893729 91.025 2 4.040934138021517 7.7 3 0.36735764891104694 1.05 4 0.026239832065074783 0.1 5 0.026239832065074783 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.037500000000000006 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.5 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.8125 0.0 0.0 0.0 0.0 138-139 0.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATTT 10 0.006830828 145.0 7 AAAGGGC 10 0.006830828 145.0 9 >>END_MODULE SRR7804211 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804211_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.142 37.0 37.0 37.0 37.0 37.0 2 35.903 37.0 37.0 37.0 37.0 37.0 3 35.978 37.0 37.0 37.0 37.0 37.0 4 36.152 37.0 37.0 37.0 37.0 37.0 5 36.0835 37.0 37.0 37.0 37.0 37.0 6 35.9615 37.0 37.0 37.0 37.0 37.0 7 35.973 37.0 37.0 37.0 37.0 37.0 8 36.1415 37.0 37.0 37.0 37.0 37.0 9 36.0805 37.0 37.0 37.0 37.0 37.0 10-14 36.0569 37.0 37.0 37.0 37.0 37.0 15-19 35.9534 37.0 37.0 37.0 37.0 37.0 20-24 35.942899999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.8512 37.0 37.0 37.0 37.0 37.0 30-34 35.8125 37.0 37.0 37.0 37.0 37.0 35-39 35.736 37.0 37.0 37.0 37.0 37.0 40-44 35.763 37.0 37.0 37.0 37.0 37.0 45-49 35.697500000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.6242 37.0 37.0 37.0 37.0 37.0 55-59 35.6071 37.0 37.0 37.0 37.0 37.0 60-64 35.496700000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.4069 37.0 37.0 37.0 37.0 37.0 70-74 35.4063 37.0 37.0 37.0 37.0 37.0 75-79 35.4305 37.0 37.0 37.0 37.0 37.0 80-84 35.2709 37.0 37.0 37.0 32.2 37.0 85-89 35.1759 37.0 37.0 37.0 29.8 37.0 90-94 35.1279 37.0 37.0 37.0 29.8 37.0 95-99 35.0481 37.0 37.0 37.0 25.0 37.0 100-104 34.9891 37.0 37.0 37.0 25.0 37.0 105-109 34.9248 37.0 37.0 37.0 25.0 37.0 110-114 34.80219999999999 37.0 37.0 37.0 25.0 37.0 115-119 34.7497 37.0 37.0 37.0 25.0 37.0 120-124 34.667 37.0 37.0 37.0 25.0 37.0 125-129 34.60679999999999 37.0 37.0 37.0 25.0 37.0 130-134 34.493100000000005 37.0 37.0 37.0 25.0 37.0 135-139 34.3238 37.0 37.0 37.0 25.0 37.0 140-144 34.1648 37.0 37.0 37.0 25.0 37.0 145-149 34.1517 37.0 37.0 37.0 25.0 37.0 150-151 33.50125 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 3.0 15 4.0 16 2.0 17 2.0 18 3.0 19 3.0 20 1.0 21 1.0 22 6.0 23 11.0 24 6.0 25 9.0 26 17.0 27 28.0 28 37.0 29 47.0 30 50.0 31 64.0 32 115.0 33 174.0 34 336.0 35 899.0 36 2089.0 37 88.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.525 13.575000000000001 10.299999999999999 36.6 2 29.299999999999997 21.925 29.099999999999998 19.675 3 24.975 21.525 26.075 27.425 4 28.375 30.225 16.975 24.425 5 28.549999999999997 30.85 18.099999999999998 22.5 6 22.175 33.675 19.075 25.074999999999996 7 21.7 15.725 34.925 27.650000000000002 8 21.625 19.75 22.925 35.699999999999996 9 23.974999999999998 20.150000000000002 24.8 31.075000000000003 10-14 26.13 24.959999999999997 21.89 27.02 15-19 26.384999999999998 24.05 23.064999999999998 26.5 20-24 26.305 24.07 23.05 26.575 25-29 26.865 23.895 22.8 26.44 30-34 26.119999999999997 24.18 22.955000000000002 26.745 35-39 26.705000000000002 23.82 22.48 26.995 40-44 27.155 23.849999999999998 22.115000000000002 26.88 45-49 26.63 24.07 22.66 26.640000000000004 50-54 26.615 24.275 22.53 26.58 55-59 27.060000000000002 24.15 22.755 26.035000000000004 60-64 26.71 24.09 22.855 26.345000000000002 65-69 26.51 24.665 22.48 26.345000000000002 70-74 27.485 23.98 22.21 26.325 75-79 26.669999999999998 24.5 22.445 26.384999999999998 80-84 26.495 23.825 23.05 26.63 85-89 26.99 24.12 22.52 26.369999999999997 90-94 26.68 24.245 22.865 26.21 95-99 27.025 24.44 22.67 25.865 100-104 26.945000000000004 24.565 21.765 26.724999999999998 105-109 27.084999999999997 24.275 22.495 26.145000000000003 110-114 27.355 24.5 22.325 25.82 115-119 27.025 24.474999999999998 22.634999999999998 25.865 120-124 26.810000000000002 24.59 22.53 26.07 125-129 27.29 24.41 23.165 25.135 130-134 27.43 24.05 22.98 25.540000000000003 135-139 27.334999999999997 24.365000000000002 22.485 25.814999999999998 140-144 27.57 24.315 22.45 25.665 145-149 27.71 24.73 22.6 24.959999999999997 150-151 27.5625 25.112499999999997 21.875 25.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 1.0 20 1.5 21 1.0 22 1.0 23 0.5 24 0.0 25 1.0 26 3.0 27 2.5 28 2.5 29 3.5 30 6.5 31 8.0 32 7.0 33 10.0 34 15.5 35 24.0 36 27.0 37 34.0 38 53.5 39 75.0 40 86.5 41 113.5 42 140.0 43 130.5 44 128.0 45 147.5 46 155.0 47 153.5 48 146.5 49 132.0 50 126.0 51 115.0 52 111.5 53 107.5 54 100.5 55 105.5 56 104.5 57 96.5 58 107.5 59 109.5 60 96.0 61 103.5 62 107.0 63 108.5 64 105.0 65 87.0 66 78.5 67 84.0 68 80.5 69 80.5 70 80.5 71 67.0 72 53.0 73 41.5 74 33.0 75 24.5 76 20.0 77 12.5 78 8.0 79 7.5 80 4.0 81 3.5 82 3.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 95.20295202952029 90.3 2 4.348972061149183 8.25 3 0.36900369003690037 1.05 4 0.02635740643120717 0.1 5 0.0 0.0 6 0.05271481286241434 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.037500000000000006 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.0625 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.725 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.825 0.0 0.0 0.0 0.0 136-137 0.8374999999999999 0.0 0.0 0.0 0.0 138-139 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAAGC 10 0.006830828 145.0 7 >>END_MODULE Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484317 spots for SRR7804211.sra Written 1484317 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra Read 1484312 spots for SRR7804211.sra Written 1484312 spots for SRR7804211.sra SRR ids: ['SRR7804211.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zesz28dz SRR7804211.sra spots: 29686245 blocks: [[1, 1484312], [1484313, 2968624], [2968625, 4452936], [4452937, 5937248], [5937249, 7421560], [7421561, 8905872], [8905873, 10390184], [10390185, 11874496], [11874497, 13358808], [13358809, 14843120], [14843121, 16327432], [16327433, 17811744], [17811745, 19296056], [19296057, 20780368], [20780369, 22264680], [22264681, 23748992], [23748993, 25233304], [25233305, 26717616], [26717617, 28201928], [28201929, 29686245]] SRR7804211 file size 10037993 SRR7804211 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804211 SRR7804211_1.fastq SRR7804211_2.fastq Input file: SRR7804211_1.fastq Paired file: SRR7804211_2.fastq trimmed: SRR7804211-trimmed-pair1.fastq, SRR7804211-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:07:51 2024 >> started Sat Dec 7 18:08:24 2024 >> done (33.393s) 29686245 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 1093 ( 0.00%) empty read pairs filtered out after trimming by size control 29685079 (100.00%) read pairs available; of these: 646408 ( 2.18%) trimmed read pairs available after processing 29038671 (97.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 12 0.00% 20 8 0.00% 21 19 0.00% 22 17 0.00% 23 9 0.00% 24 16 0.00% 25 23 0.00% 26 23 0.00% 27 22 0.00% 28 22 0.00% 29 21 0.00% 30 39 0.00% 31 33 0.00% 32 52 0.00% 33 31 0.00% 34 36 0.00% 35 52 0.00% 36 36 0.00% 37 32 0.00% 38 42 0.00% 39 54 0.00% 40 51 0.00% 41 35 0.00% 42 38 0.00% 43 46 0.00% 44 48 0.00% 45 55 0.00% 46 58 0.00% 47 44 0.00% 48 53 0.00% 49 67 0.00% 50 64 0.00% 51 65 0.00% 52 67 0.00% 53 60 0.00% 54 71 0.00% 55 71 0.00% 56 70 0.00% 57 58 0.00% 58 81 0.00% 59 81 0.00% 60 86 0.00% 61 89 0.00% 62 63 0.00% 63 86 0.00% 64 98 0.00% 65 98 0.00% 66 123 0.00% 67 99 0.00% 68 124 0.00% 69 122 0.00% 70 157 0.00% 71 124 0.00% 72 178 0.00% 73 173 0.00% 74 199 0.00% 75 202 0.00% 76 236 0.00% 77 264 0.00% 78 257 0.00% 79 319 0.00% 80 328 0.00% 81 344 0.00% 82 397 0.00% 83 443 0.00% 84 539 0.00% 85 544 0.00% 86 656 0.00% 87 677 0.00% 88 757 0.00% 89 836 0.00% 90 917 0.00% 91 975 0.00% 92 1135 0.00% 93 1345 0.00% 94 1415 0.00% 95 1494 0.01% 96 1656 0.01% 97 1774 0.01% 98 1939 0.01% 99 2093 0.01% 100 2268 0.01% 101 2467 0.01% 102 2687 0.01% 103 2948 0.01% 104 3299 0.01% 105 3376 0.01% 106 3677 0.01% 107 3934 0.01% 108 4065 0.01% 109 4422 0.01% 110 4474 0.02% 111 4963 0.02% 112 5398 0.02% 113 5753 0.02% 114 6156 0.02% 115 6429 0.02% 116 6784 0.02% 117 7221 0.02% 118 7393 0.02% 119 7893 0.03% 120 7893 0.03% 121 8542 0.03% 122 9061 0.03% 123 9430 0.03% 124 10148 0.03% 125 10974 0.04% 126 11435 0.04% 127 11744 0.04% 128 11918 0.04% 129 12377 0.04% 130 12887 0.04% 131 13456 0.05% 132 13981 0.05% 133 14943 0.05% 134 15662 0.05% 135 16587 0.06% 136 17081 0.06% 137 17799 0.06% 138 18467 0.06% 139 18920 0.06% 140 19354 0.07% 141 19925 0.07% 142 20960 0.07% 143 21543 0.07% 144 22581 0.08% 145 24040 0.08% 146 24808 0.08% 147 25709 0.09% 148 26917 0.09% 149 27048 0.09% 150 29461 0.10% 151 29038671 97.82% 29685079 reads passed initial QC criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=17 prefix-density=1.15 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=130.72 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=9.7 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=11 prefix-density=0.82 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=14.39 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804211 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:09:32 Started mapping on | Dec 07 18:09:32 Finished on | Dec 07 18:13:52 Mapping speed, Million of reads per hour | 411.02 Number of input reads | 29685079 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 27879524 Uniquely mapped reads % | 93.92% Average mapped length | 300.08 Number of splices: Total | 29170077 Number of splices: Annotated (sjdb) | 27425303 Number of splices: GT/AG | 28781098 Number of splices: GC/AG | 335335 Number of splices: AT/AC | 13542 Number of splices: Non-canonical | 40102 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355114 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 28836 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1450441 1450441 1450441 N_multimapping 355114 355114 355114 N_noFeature 863905 27109614 1059462 N_ambiguous 710100 5188 136559 UnstrandedReadsAssigned:26305519 PositiveStrandReadsAssigned:764722 NegativeStrandReadsAssigned:26683503 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804211 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804211-trimmed-pair1.fastq SRR7804211-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,685,079 reads, 27,015,211 reads pseudoaligned [quant] estimated average fragment length: 338.537 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52973 SRR7804211.ke.tsv 35125 SRR7804211.se.tsv 88098 total ==> SRR7804211.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 599.773 0 0 PNS24247 1044 706.463 87.9477 5.67491 PNS24249 1928 1590.46 183.245 5.25209 PNS24246 1044 706.463 87.9477 5.67491 PNS24248 1044 706.463 87.9477 5.67491 PNS24244 1471 1133.46 101.912 4.09866 PNS24243 293 70.1082 0 0 KQK14069 1603 1265.46 18580.4 669.313 KQK14071 474 186.666 207.331 50.6319 ==> SRR7804211.se.tsv <== BRADI_1g14170v3 19902 BRADI_1g53295v3 49 BRADI_1g59795v3 832 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 1988 BRADI_1g74790v3 625 BRADI_1g09890v3 8 BRADI_1g77505v3 371 BRADI_1g48960v3 0 SRR7804211 completed mapping pipeline successfully