Starting /dee2/code/volunteer_pipeline.sh SRR7804212 current disk space = 1515888463872 free memory = 1570808420 SRR7804212 SRAfilesize 694e44fb92dacb03b95e2d6a8fbf8114 SRR7804212.sra SRR7804212.sra file validated SRR7804212 is paired end SRR7804212 is conventional basespace SRR7804212 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804212_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.28225 37.0 37.0 37.0 37.0 37.0 2 36.205 37.0 37.0 37.0 37.0 37.0 3 36.368 37.0 37.0 37.0 37.0 37.0 4 36.463 37.0 37.0 37.0 37.0 37.0 5 36.5515 37.0 37.0 37.0 37.0 37.0 6 36.464 37.0 37.0 37.0 37.0 37.0 7 36.3555 37.0 37.0 37.0 37.0 37.0 8 36.447 37.0 37.0 37.0 37.0 37.0 9 36.464 37.0 37.0 37.0 37.0 37.0 10-14 36.524100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.507600000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4783 37.0 37.0 37.0 37.0 37.0 25-29 36.4434 37.0 37.0 37.0 37.0 37.0 30-34 36.4269 37.0 37.0 37.0 37.0 37.0 35-39 36.3975 37.0 37.0 37.0 37.0 37.0 40-44 36.3658 37.0 37.0 37.0 37.0 37.0 45-49 36.2765 37.0 37.0 37.0 37.0 37.0 50-54 36.2793 37.0 37.0 37.0 37.0 37.0 55-59 36.283100000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.271 37.0 37.0 37.0 37.0 37.0 65-69 36.1826 37.0 37.0 37.0 37.0 37.0 70-74 36.115 37.0 37.0 37.0 37.0 37.0 75-79 36.085300000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1082 37.0 37.0 37.0 37.0 37.0 85-89 36.018499999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.998599999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8976 37.0 37.0 37.0 37.0 37.0 100-104 35.825399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.7807 37.0 37.0 37.0 37.0 37.0 110-114 35.8123 37.0 37.0 37.0 37.0 37.0 115-119 35.6649 37.0 37.0 37.0 37.0 37.0 120-124 35.5843 37.0 37.0 37.0 37.0 37.0 125-129 35.6133 37.0 37.0 37.0 37.0 37.0 130-134 35.4925 37.0 37.0 37.0 37.0 37.0 135-139 35.3124 37.0 37.0 37.0 34.6 37.0 140-144 35.3215 37.0 37.0 37.0 34.6 37.0 145-149 35.1716 37.0 37.0 37.0 27.4 37.0 150-151 34.68075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 3.0 24 2.0 25 6.0 26 7.0 27 12.0 28 16.0 29 29.0 30 44.0 31 35.0 32 58.0 33 92.0 34 178.0 35 444.0 36 2828.0 37 243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.43873715860687 12.853921322976698 9.922325231771485 37.785016286644954 2 25.374999999999996 19.25 34.1 21.275 3 21.224999999999998 26.0 24.325 28.449999999999996 4 26.6 31.474999999999998 18.65 23.275000000000002 5 24.474999999999998 32.85 22.35 20.325 6 21.85 32.975 21.95 23.225 7 17.175 18.325 41.85 22.650000000000002 8 20.549999999999997 20.1 26.525 32.824999999999996 9 21.5 20.4 29.425 28.675 10-14 23.945 26.424999999999997 23.64 25.990000000000002 15-19 24.09 25.080000000000002 24.55 26.279999999999998 20-24 23.755000000000003 24.740000000000002 25.34 26.165 25-29 23.325000000000003 25.31 24.685000000000002 26.68 30-34 23.724999999999998 24.865000000000002 24.86 26.55 35-39 23.695 25.295 24.435000000000002 26.575 40-44 23.865 25.6 23.77 26.765 45-49 24.005000000000003 25.215 24.235 26.545 50-54 23.805 24.725 24.935 26.534999999999997 55-59 23.49 25.21 24.14 27.16 60-64 23.905 25.259999999999998 24.2 26.634999999999998 65-69 24.715 24.94 24.035 26.31 70-74 24.695 24.52 24.47 26.314999999999998 75-79 24.855 23.630000000000003 24.605 26.91 80-84 24.93 24.235 24.395 26.44 85-89 24.695 24.01 24.63 26.665 90-94 24.610000000000003 24.279999999999998 24.255 26.855 95-99 25.395 24.185000000000002 24.240000000000002 26.179999999999996 100-104 25.3 24.560000000000002 23.805 26.334999999999997 105-109 25.019999999999996 23.875 24.615000000000002 26.490000000000002 110-114 25.245 24.07 24.27 26.415 115-119 25.1 24.065 23.785 27.05 120-124 25.4 23.724999999999998 23.645 27.229999999999997 125-129 25.52 24.005000000000003 24.104999999999997 26.369999999999997 130-134 25.490000000000002 24.08 23.755000000000003 26.674999999999997 135-139 25.34 24.18 23.630000000000003 26.85 140-144 25.779999999999998 23.86 24.044999999999998 26.314999999999998 145-149 26.095000000000002 23.799999999999997 23.395 26.71 150-151 26.474999999999998 22.8 23.5625 27.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.0 28 4.0 29 7.5 30 9.5 31 12.0 32 14.5 33 17.5 34 27.0 35 43.5 36 52.0 37 59.5 38 74.5 39 102.5 40 118.5 41 122.0 42 139.5 43 155.5 44 167.5 45 171.5 46 169.5 47 172.0 48 180.5 49 183.0 50 155.0 51 121.0 52 113.0 53 119.0 54 113.0 55 93.0 56 92.5 57 98.5 58 92.5 59 86.5 60 87.5 61 84.0 62 69.5 63 66.0 64 78.5 65 75.5 66 65.0 67 59.0 68 54.5 69 53.0 70 40.5 71 35.5 72 33.0 73 26.0 74 23.5 75 18.5 76 10.5 77 5.0 78 5.0 79 5.5 80 3.5 81 2.5 82 1.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 95.12773242033184 90.3 2 4.477218856992363 8.5 3 0.31603897814063736 0.8999999999999999 4 0.07900974453515934 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.8875 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.1749999999999998 0.0 0.0 0.0 0.0 128-129 1.2 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.5625 0.0 0.0 0.0 0.0 138-139 1.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTACG 10 0.006830828 145.0 3 TACGGAT 10 0.006830828 145.0 6 GGATCTC 10 0.006830828 145.0 9 CGGATCT 10 0.006830828 145.0 8 GGCTTTA 10 0.006830828 145.0 1 CACCAGT 10 0.006830828 145.0 1 TTTACGG 10 0.006830828 145.0 4 ACGGATC 10 0.006830828 145.0 7 TTACGGA 10 0.006830828 145.0 5 AAGTTCC 10 0.006830828 145.0 3 >>END_MODULE SRR7804212 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804212_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4105 37.0 37.0 37.0 37.0 37.0 2 36.078 37.0 37.0 37.0 37.0 37.0 3 36.116 37.0 37.0 37.0 37.0 37.0 4 36.3 37.0 37.0 37.0 37.0 37.0 5 36.376 37.0 37.0 37.0 37.0 37.0 6 36.1015 37.0 37.0 37.0 37.0 37.0 7 36.1605 37.0 37.0 37.0 37.0 37.0 8 36.2945 37.0 37.0 37.0 37.0 37.0 9 36.253 37.0 37.0 37.0 37.0 37.0 10-14 36.1776 37.0 37.0 37.0 37.0 37.0 15-19 36.1094 37.0 37.0 37.0 37.0 37.0 20-24 36.1289 37.0 37.0 37.0 37.0 37.0 25-29 36.03060000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.9467 37.0 37.0 37.0 37.0 37.0 35-39 35.8495 37.0 37.0 37.0 37.0 37.0 40-44 35.877599999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.78349999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.8044 37.0 37.0 37.0 37.0 37.0 55-59 35.821799999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.6517 37.0 37.0 37.0 37.0 37.0 65-69 35.589 37.0 37.0 37.0 37.0 37.0 70-74 35.6169 37.0 37.0 37.0 37.0 37.0 75-79 35.598 37.0 37.0 37.0 37.0 37.0 80-84 35.5244 37.0 37.0 37.0 37.0 37.0 85-89 35.441599999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.3628 37.0 37.0 37.0 37.0 37.0 95-99 35.1939 37.0 37.0 37.0 29.8 37.0 100-104 35.24 37.0 37.0 37.0 32.2 37.0 105-109 35.177800000000005 37.0 37.0 37.0 27.4 37.0 110-114 35.0032 37.0 37.0 37.0 25.0 37.0 115-119 34.9899 37.0 37.0 37.0 25.0 37.0 120-124 35.013099999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.843 37.0 37.0 37.0 25.0 37.0 130-134 34.7644 37.0 37.0 37.0 25.0 37.0 135-139 34.5612 37.0 37.0 37.0 25.0 37.0 140-144 34.42829999999999 37.0 37.0 37.0 25.0 37.0 145-149 34.2802 37.0 37.0 37.0 25.0 37.0 150-151 33.698 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 4.0 16 1.0 17 1.0 18 2.0 19 4.0 20 5.0 21 6.0 22 9.0 23 11.0 24 5.0 25 14.0 26 13.0 27 20.0 28 18.0 29 27.0 30 41.0 31 55.0 32 83.0 33 158.0 34 292.0 35 793.0 36 2363.0 37 69.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.824999999999996 13.8 11.875 35.5 2 29.549999999999997 18.9 30.375000000000004 21.175 3 25.35 22.225 26.900000000000002 25.525 4 28.475 30.475 16.6 24.45 5 28.575 31.175000000000004 17.974999999999998 22.275 6 22.95 33.0 18.7 25.35 7 20.1 14.399999999999999 37.375 28.125 8 22.15 19.725 23.225 34.9 9 23.625 21.099999999999998 23.95 31.324999999999996 10-14 26.240000000000002 24.2 21.715 27.845 15-19 26.615 23.645 22.63 27.11 20-24 26.815 23.799999999999997 22.525000000000002 26.86 25-29 27.48 24.005000000000003 22.03 26.484999999999996 30-34 26.889999999999997 24.145 22.21 26.755000000000003 35-39 27.169999999999998 23.79 22.66 26.38 40-44 27.01 24.035 22.805 26.150000000000002 45-49 26.590000000000003 24.07 22.405 26.935 50-54 27.005000000000003 23.84 23.025000000000002 26.13 55-59 27.26 23.105 22.78 26.855 60-64 27.355 23.445 22.605 26.595000000000002 65-69 26.19 23.525 23.294999999999998 26.99 70-74 27.55 23.29 22.55 26.61 75-79 27.250000000000004 23.215 22.99 26.545 80-84 26.47 23.695 22.475 27.36 85-89 27.779999999999998 23.435 22.285 26.5 90-94 27.505000000000003 23.64 22.505 26.35 95-99 27.310000000000002 23.625 22.720000000000002 26.345000000000002 100-104 27.700000000000003 23.595 22.63 26.075 105-109 26.86 23.765 22.79 26.584999999999997 110-114 27.675 24.085 22.025 26.215 115-119 27.474999999999998 24.240000000000002 22.155 26.13 120-124 27.689999999999998 24.044999999999998 22.12 26.145000000000003 125-129 27.01 24.245 22.7 26.045 130-134 27.72 24.355 22.49 25.435000000000002 135-139 27.900000000000002 24.355 22.75 24.995 140-144 28.28 24.279999999999998 22.93 24.51 145-149 27.935 24.82 22.82 24.425 150-151 27.875 23.375 22.575 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 1.0 27 0.5 28 1.5 29 5.5 30 7.0 31 8.5 32 12.0 33 13.0 34 17.0 35 24.5 36 28.5 37 34.5 38 46.0 39 73.5 40 103.5 41 101.5 42 104.5 43 131.5 44 136.0 45 138.5 46 146.0 47 151.5 48 152.5 49 131.5 50 125.0 51 122.5 52 109.0 53 105.5 54 97.5 55 91.5 56 86.5 57 87.5 58 104.5 59 106.5 60 111.5 61 120.0 62 106.5 63 100.5 64 95.5 65 93.0 66 109.0 67 94.0 68 77.0 69 82.0 70 79.5 71 65.5 72 54.0 73 51.5 74 44.0 75 28.5 76 14.5 77 8.5 78 8.5 79 8.0 80 5.0 81 6.0 82 5.5 83 2.0 84 0.0 85 1.5 86 1.5 87 0.5 88 1.0 89 1.0 90 1.0 91 1.0 92 0.5 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.95376486129459 89.85 2 4.570673712021136 8.649999999999999 3 0.34346103038309117 0.975 4 0.10568031704095111 0.4 5 0.02642007926023778 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.025 112-113 0.6125 0.0 0.0 0.0 0.025 114-115 0.7 0.0 0.0 0.0 0.025 116-117 0.75 0.0 0.0 0.0 0.025 118-119 0.825 0.0 0.0 0.0 0.025 120-121 0.9 0.0 0.0 0.0 0.025 122-123 0.9625 0.0 0.0 0.0 0.025 124-125 1.05 0.0 0.0 0.0 0.025 126-127 1.2000000000000002 0.0 0.0 0.0 0.025 128-129 1.225 0.0 0.0 0.0 0.025 130-131 1.2875 0.0 0.0 0.0 0.025 132-133 1.4 0.0 0.0 0.0 0.025 134-135 1.5375 0.0 0.0 0.0 0.025 136-137 1.5875 0.0 0.0 0.0 0.025 138-139 1.7125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTGT 10 0.006830828 145.0 145 ATCAGAT 10 0.006830828 145.0 5 CCCCGGG 10 0.006830828 145.0 7 TCAGATG 10 0.006830828 145.0 6 GCTCGAC 10 0.006830828 145.0 1 CCGGGCC 10 0.006830828 145.0 9 GACCCCG 20 3.5877043E-4 108.75 5 CGACCCC 25 8.7132835E-4 87.0 4 >>END_MODULE Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra Read 1789037 spots for SRR7804212.sra Written 1789037 spots for SRR7804212.sra Read 1789035 spots for SRR7804212.sra Written 1789035 spots for SRR7804212.sra SRR ids: ['SRR7804212.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9jsm9nem SRR7804212.sra spots: 35780702 blocks: [[1, 1789035], [1789036, 3578070], [3578071, 5367105], [5367106, 7156140], [7156141, 8945175], [8945176, 10734210], [10734211, 12523245], [12523246, 14312280], [14312281, 16101315], [16101316, 17890350], [17890351, 19679385], [19679386, 21468420], [21468421, 23257455], [23257456, 25046490], [25046491, 26835525], [26835526, 28624560], [28624561, 30413595], [30413596, 32202630], [32202631, 33991665], [33991666, 35780702]] SRR7804212 file size 12103205 SRR7804212 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804212 SRR7804212_1.fastq SRR7804212_2.fastq Input file: SRR7804212_1.fastq Paired file: SRR7804212_2.fastq trimmed: SRR7804212-trimmed-pair1.fastq, SRR7804212-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:35:24 2024 >> started Thu Dec 12 02:36:06 2024 >> done (42.219s) 35780702 read pairs processed; of these: 97 ( 0.00%) short read pairs filtered out after trimming by size control 1284 ( 0.00%) empty read pairs filtered out after trimming by size control 35779321 (100.00%) read pairs available; of these: 1033869 ( 2.89%) trimmed read pairs available after processing 34745452 (97.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 18 0.00% 20 20 0.00% 21 24 0.00% 22 17 0.00% 23 29 0.00% 24 32 0.00% 25 29 0.00% 26 35 0.00% 27 36 0.00% 28 55 0.00% 29 33 0.00% 30 58 0.00% 31 49 0.00% 32 63 0.00% 33 49 0.00% 34 56 0.00% 35 66 0.00% 36 74 0.00% 37 73 0.00% 38 68 0.00% 39 60 0.00% 40 68 0.00% 41 73 0.00% 42 90 0.00% 43 73 0.00% 44 81 0.00% 45 90 0.00% 46 87 0.00% 47 78 0.00% 48 85 0.00% 49 113 0.00% 50 89 0.00% 51 85 0.00% 52 107 0.00% 53 118 0.00% 54 103 0.00% 55 125 0.00% 56 130 0.00% 57 125 0.00% 58 113 0.00% 59 135 0.00% 60 135 0.00% 61 151 0.00% 62 147 0.00% 63 151 0.00% 64 171 0.00% 65 179 0.00% 66 165 0.00% 67 203 0.00% 68 226 0.00% 69 233 0.00% 70 256 0.00% 71 296 0.00% 72 313 0.00% 73 358 0.00% 74 343 0.00% 75 388 0.00% 76 449 0.00% 77 408 0.00% 78 532 0.00% 79 582 0.00% 80 658 0.00% 81 729 0.00% 82 835 0.00% 83 945 0.00% 84 1107 0.00% 85 1249 0.00% 86 1310 0.00% 87 1334 0.00% 88 1512 0.00% 89 1695 0.00% 90 1779 0.00% 91 2067 0.01% 92 2375 0.01% 93 2623 0.01% 94 2872 0.01% 95 3140 0.01% 96 3280 0.01% 97 3459 0.01% 98 3685 0.01% 99 3942 0.01% 100 4184 0.01% 101 4638 0.01% 102 4872 0.01% 103 5598 0.02% 104 5958 0.02% 105 6390 0.02% 106 6697 0.02% 107 7114 0.02% 108 7342 0.02% 109 7712 0.02% 110 8143 0.02% 111 8407 0.02% 112 9408 0.03% 113 9781 0.03% 114 10444 0.03% 115 11259 0.03% 116 11659 0.03% 117 12150 0.03% 118 12584 0.04% 119 12830 0.04% 120 13319 0.04% 121 13977 0.04% 122 14986 0.04% 123 15735 0.04% 124 17007 0.05% 125 17685 0.05% 126 18627 0.05% 127 18856 0.05% 128 19351 0.05% 129 19931 0.06% 130 20503 0.06% 131 21208 0.06% 132 22944 0.06% 133 23554 0.07% 134 24906 0.07% 135 26374 0.07% 136 26736 0.07% 137 27665 0.08% 138 28337 0.08% 139 29363 0.08% 140 29804 0.08% 141 30752 0.09% 142 32175 0.09% 143 33138 0.09% 144 34759 0.10% 145 36374 0.10% 146 37818 0.11% 147 38717 0.11% 148 40230 0.11% 149 40506 0.11% 150 42158 0.12% 151 34745452 97.11% 35779321 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=20 prefix-density=0.99 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=137.45 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=9.5 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=14 prefix-density=0.77 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=18.99 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.2 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804212 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:37:04 Started mapping on | Dec 12 02:37:04 Finished on | Dec 12 02:42:32 Mapping speed, Million of reads per hour | 392.70 Number of input reads | 35779321 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 33672379 Uniquely mapped reads % | 94.11% Average mapped length | 299.73 Number of splices: Total | 34671949 Number of splices: Annotated (sjdb) | 32649213 Number of splices: GT/AG | 34209036 Number of splices: GC/AG | 392391 Number of splices: AT/AC | 14804 Number of splices: Non-canonical | 55718 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430868 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 23031 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1676074 1676074 1676074 N_multimapping 430868 430868 430868 N_noFeature 949700 32754105 1186472 N_ambiguous 837823 5286 157361 UnstrandedReadsAssigned:31884856 PositiveStrandReadsAssigned:912988 NegativeStrandReadsAssigned:32328546 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804212 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804212-trimmed-pair1.fastq SRR7804212-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,779,321 reads, 32,630,018 reads pseudoaligned [quant] estimated average fragment length: 323.194 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR7804212.ke.tsv 35125 SRR7804212.se.tsv 88098 total ==> SRR7804212.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 614.908 0 0 PNS24247 1044 721.806 72.3671 3.83776 PNS24249 1928 1605.81 234.278 5.58466 PNS24246 1044 721.806 72.3671 3.83776 PNS24248 1044 721.806 72.3671 3.83776 PNS24244 1471 1148.81 127.62 4.25237 PNS24243 293 72.9425 0 0 KQK14069 1603 1280.81 26073.3 779.239 KQK14071 474 193.499 401.248 79.3764 ==> SRR7804212.se.tsv <== BRADI_1g14170v3 28721 BRADI_1g53295v3 1454 BRADI_1g59795v3 642 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 3124 BRADI_1g74790v3 858 BRADI_1g09890v3 22 BRADI_1g77505v3 402 BRADI_1g48960v3 0 SRR7804212 completed mapping pipeline successfully