Starting /dee2/code/volunteer_pipeline.sh SRR7804213 current disk space = 1540846333952 free memory = 1456696280 SRR7804213 SRAfilesize a85ad057863bcb8617500868325817ad SRR7804213.sra SRR7804213.sra file validated SRR7804213 is paired end SRR7804213 is conventional basespace SRR7804213 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804213_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.10475 37.0 37.0 37.0 37.0 37.0 2 36.265 37.0 37.0 37.0 37.0 37.0 3 36.257 37.0 37.0 37.0 37.0 37.0 4 36.414 37.0 37.0 37.0 37.0 37.0 5 36.4675 37.0 37.0 37.0 37.0 37.0 6 36.476 37.0 37.0 37.0 37.0 37.0 7 36.412 37.0 37.0 37.0 37.0 37.0 8 36.479 37.0 37.0 37.0 37.0 37.0 9 36.4315 37.0 37.0 37.0 37.0 37.0 10-14 36.5096 37.0 37.0 37.0 37.0 37.0 15-19 36.507099999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.476099999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4309 37.0 37.0 37.0 37.0 37.0 30-34 36.4289 37.0 37.0 37.0 37.0 37.0 35-39 36.3966 37.0 37.0 37.0 37.0 37.0 40-44 36.3215 37.0 37.0 37.0 37.0 37.0 45-49 36.2395 37.0 37.0 37.0 37.0 37.0 50-54 36.232299999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1634 37.0 37.0 37.0 37.0 37.0 60-64 36.1423 37.0 37.0 37.0 37.0 37.0 65-69 36.1501 37.0 37.0 37.0 37.0 37.0 70-74 36.095200000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.027499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0786 37.0 37.0 37.0 37.0 37.0 85-89 36.0122 37.0 37.0 37.0 37.0 37.0 90-94 35.9305 37.0 37.0 37.0 37.0 37.0 95-99 35.792699999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8231 37.0 37.0 37.0 37.0 37.0 105-109 35.799800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.8038 37.0 37.0 37.0 37.0 37.0 115-119 35.644999999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.5158 37.0 37.0 37.0 37.0 37.0 125-129 35.600199999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.4414 37.0 37.0 37.0 37.0 37.0 135-139 35.3636 37.0 37.0 37.0 37.0 37.0 140-144 35.363699999999994 37.0 37.0 37.0 32.2 37.0 145-149 35.096199999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.561499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 5.0 25 1.0 26 5.0 27 13.0 28 22.0 29 19.0 30 39.0 31 57.0 32 60.0 33 128.0 34 199.0 35 452.0 36 2728.0 37 270.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.51390628915059 13.781007266349285 9.29591581057379 37.40917063392634 2 24.775 19.425 34.849999999999994 20.95 3 22.15 24.349999999999998 25.224999999999998 28.275 4 27.075 32.550000000000004 18.5 21.875 5 26.424999999999997 31.45 22.575 19.55 6 21.125 31.900000000000002 23.35 23.625 7 16.5 19.2 41.349999999999994 22.95 8 20.325 20.474999999999998 27.474999999999998 31.724999999999998 9 20.424999999999997 18.85 32.0 28.725 10-14 23.724999999999998 25.900000000000002 24.34 26.035000000000004 15-19 23.535 25.040000000000003 24.759999999999998 26.665 20-24 24.255 24.825 24.62 26.3 25-29 24.08 24.81 24.099999999999998 27.01 30-34 23.69 25.41 24.27 26.63 35-39 23.7 25.009999999999998 24.560000000000002 26.729999999999997 40-44 24.48 25.480000000000004 23.925 26.115 45-49 24.605 24.725 23.919999999999998 26.75 50-54 23.775 24.925 24.395 26.905 55-59 24.255 25.040000000000003 24.46 26.245 60-64 24.610000000000003 24.490000000000002 24.125 26.775 65-69 24.855 24.015 24.175 26.955000000000002 70-74 24.975 23.965 24.3 26.76 75-79 24.985 24.38 23.895 26.740000000000002 80-84 24.695 23.72 24.09 27.495000000000005 85-89 25.115 24.104999999999997 23.995 26.784999999999997 90-94 25.555 23.919999999999998 24.060000000000002 26.465 95-99 25.5 24.0 23.945 26.555 100-104 25.240000000000002 23.95 24.01 26.8 105-109 25.05 23.5 24.15 27.3 110-114 25.505 24.335 23.75 26.41 115-119 25.230000000000004 23.77 24.02 26.979999999999997 120-124 25.305 24.22 23.285 27.189999999999998 125-129 25.569999999999997 23.48 23.974999999999998 26.974999999999998 130-134 26.215 23.485 23.285 27.015 135-139 25.430000000000003 23.555 23.635 27.38 140-144 25.83 23.69 23.215 27.265 145-149 25.540000000000003 23.47 23.62 27.37 150-151 26.174999999999997 22.912499999999998 23.5 27.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 0.0 26 0.5 27 2.5 28 5.5 29 8.0 30 8.5 31 11.0 32 12.5 33 19.0 34 31.0 35 35.5 36 43.0 37 54.0 38 83.0 39 110.0 40 118.0 41 121.5 42 139.5 43 159.5 44 155.5 45 158.0 46 169.0 47 168.0 48 157.5 49 158.0 50 148.5 51 127.0 52 127.5 53 125.5 54 107.0 55 101.0 56 97.5 57 95.0 58 92.0 59 94.0 60 94.5 61 85.0 62 77.5 63 60.5 64 69.5 65 80.5 66 67.0 67 61.0 68 52.5 69 49.5 70 55.5 71 49.0 72 36.0 73 25.0 74 20.0 75 18.0 76 14.5 77 12.0 78 10.5 79 6.5 80 2.5 81 2.5 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.06726457399103 90.10000000000001 2 4.431548404115009 8.4 3 0.4220522289633343 1.2 4 0.07913479293062516 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.23750000000000002 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.6625 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.2375 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804213 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804213_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1825 37.0 37.0 37.0 37.0 37.0 2 35.9285 37.0 37.0 37.0 37.0 37.0 3 36.0145 37.0 37.0 37.0 37.0 37.0 4 36.226 37.0 37.0 37.0 37.0 37.0 5 36.252 37.0 37.0 37.0 37.0 37.0 6 36.0455 37.0 37.0 37.0 37.0 37.0 7 36.058 37.0 37.0 37.0 37.0 37.0 8 36.2345 37.0 37.0 37.0 37.0 37.0 9 36.2255 37.0 37.0 37.0 37.0 37.0 10-14 36.0809 37.0 37.0 37.0 37.0 37.0 15-19 36.0381 37.0 37.0 37.0 37.0 37.0 20-24 35.998 37.0 37.0 37.0 37.0 37.0 25-29 35.9704 37.0 37.0 37.0 37.0 37.0 30-34 35.942699999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.82560000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.7738 37.0 37.0 37.0 37.0 37.0 45-49 35.7663 37.0 37.0 37.0 37.0 37.0 50-54 35.7456 37.0 37.0 37.0 37.0 37.0 55-59 35.7207 37.0 37.0 37.0 37.0 37.0 60-64 35.6353 37.0 37.0 37.0 37.0 37.0 65-69 35.504000000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.5112 37.0 37.0 37.0 37.0 37.0 75-79 35.531099999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.423500000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.313900000000004 37.0 37.0 37.0 34.6 37.0 90-94 35.277499999999996 37.0 37.0 37.0 34.6 37.0 95-99 35.12179999999999 37.0 37.0 37.0 25.0 37.0 100-104 35.085 37.0 37.0 37.0 25.0 37.0 105-109 35.081 37.0 37.0 37.0 25.0 37.0 110-114 34.9534 37.0 37.0 37.0 25.0 37.0 115-119 34.795300000000005 37.0 37.0 37.0 25.0 37.0 120-124 34.813900000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.6286 37.0 37.0 37.0 25.0 37.0 130-134 34.5496 37.0 37.0 37.0 25.0 37.0 135-139 34.32899999999999 37.0 37.0 37.0 25.0 37.0 140-144 34.184 37.0 37.0 37.0 25.0 37.0 145-149 34.0638 37.0 37.0 37.0 25.0 37.0 150-151 33.4105 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 6.0 15 1.0 16 1.0 17 1.0 18 1.0 19 2.0 20 5.0 21 2.0 22 8.0 23 10.0 24 6.0 25 13.0 26 16.0 27 17.0 28 26.0 29 42.0 30 51.0 31 54.0 32 94.0 33 189.0 34 345.0 35 887.0 36 2149.0 37 71.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.574999999999996 14.374999999999998 10.8 37.25 2 30.175 19.400000000000002 28.925 21.5 3 23.75 23.525 26.974999999999998 25.75 4 27.075 31.324999999999996 16.975 24.625 5 28.175 32.324999999999996 18.05 21.45 6 21.9 33.85 18.525 25.724999999999998 7 20.674999999999997 14.299999999999999 36.7 28.325 8 22.975 20.45 21.2 35.375 9 24.175 21.95 23.625 30.25 10-14 26.33 24.315 22.264999999999997 27.089999999999996 15-19 26.525 23.82 22.884999999999998 26.77 20-24 26.634999999999998 24.545 22.175 26.645000000000003 25-29 27.07 23.94 22.375 26.615 30-34 26.200000000000003 24.015 22.439999999999998 27.345000000000002 35-39 26.99 24.125 21.834999999999997 27.05 40-44 27.1 24.245 22.255 26.400000000000002 45-49 27.165 23.29 22.67 26.875 50-54 27.439999999999998 23.419999999999998 22.325 26.815 55-59 27.48 23.49 22.475 26.555 60-64 27.07 24.03 22.485 26.415 65-69 27.29 24.21 21.92 26.58 70-74 27.029999999999998 23.544999999999998 22.91 26.515 75-79 26.91 23.7 22.595000000000002 26.795 80-84 26.965 23.39 22.384999999999998 27.26 85-89 27.27 23.36 22.685 26.685 90-94 27.455000000000002 23.625 22.595000000000002 26.325 95-99 27.215 23.724999999999998 22.27 26.790000000000003 100-104 27.825 23.62 22.105 26.450000000000003 105-109 27.089999999999996 23.605 22.395 26.91 110-114 27.725 23.86 22.015 26.400000000000002 115-119 27.13 24.5 21.765 26.605 120-124 27.485 23.87 22.295 26.35 125-129 27.785 23.830000000000002 22.2 26.185000000000002 130-134 28.199999999999996 23.544999999999998 22.35 25.905 135-139 27.58 24.175 22.355 25.89 140-144 27.72 23.465 23.150000000000002 25.665 145-149 27.72 23.805 22.8 25.674999999999997 150-151 27.437499999999996 24.675 22.675 25.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 1.5 13 1.0 14 0.5 15 0.5 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.0 27 1.5 28 2.5 29 2.5 30 2.0 31 4.0 32 7.0 33 9.5 34 14.5 35 21.5 36 25.5 37 35.5 38 61.5 39 82.0 40 91.0 41 104.5 42 119.0 43 135.0 44 141.0 45 129.5 46 126.5 47 132.5 48 134.5 49 136.0 50 125.0 51 124.5 52 120.5 53 98.5 54 104.5 55 110.0 56 101.0 57 98.0 58 103.5 59 104.5 60 99.5 61 111.0 62 120.0 63 101.0 64 96.0 65 98.5 66 92.0 67 93.5 68 95.5 69 100.5 70 76.0 71 51.0 72 51.5 73 47.0 74 34.5 75 28.5 76 24.5 77 18.0 78 15.0 79 7.0 80 2.0 81 3.5 82 3.5 83 1.5 84 0.5 85 0.5 86 1.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.86364839819963 89.575 2 4.633306857294149 8.75 3 0.3706645485835319 1.05 4 0.07942811755361398 0.3 5 0.026476039184537992 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026476039184537992 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 8 0.2 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.1875 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.6625 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.2875 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGGCG 10 0.006830828 145.0 6 CGAACCT 10 0.006830828 145.0 1 GTTAGCT 10 0.006830828 145.0 2 >>END_MODULE Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445166 spots for SRR7804213.sra Written 1445166 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra Read 1445151 spots for SRR7804213.sra Written 1445151 spots for SRR7804213.sra SRR ids: ['SRR7804213.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v73yfcfc SRR7804213.sra spots: 28903035 blocks: [[1, 1445151], [1445152, 2890302], [2890303, 4335453], [4335454, 5780604], [5780605, 7225755], [7225756, 8670906], [8670907, 10116057], [10116058, 11561208], [11561209, 13006359], [13006360, 14451510], [14451511, 15896661], [15896662, 17341812], [17341813, 18786963], [18786964, 20232114], [20232115, 21677265], [21677266, 23122416], [23122417, 24567567], [24567568, 26012718], [26012719, 27457869], [27457870, 28903035]] SRR7804213 file size 9772589 SRR7804213 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804213 SRR7804213_1.fastq SRR7804213_2.fastq Input file: SRR7804213_1.fastq Paired file: SRR7804213_2.fastq trimmed: SRR7804213-trimmed-pair1.fastq, SRR7804213-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:13:34 2024 >> started Sat Dec 7 18:14:08 2024 >> done (33.828s) 28903035 read pairs processed; of these: 108 ( 0.00%) short read pairs filtered out after trimming by size control 945 ( 0.00%) empty read pairs filtered out after trimming by size control 28901982 (100.00%) read pairs available; of these: 759537 ( 2.63%) trimmed read pairs available after processing 28142445 (97.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 13 0.00% 21 15 0.00% 22 14 0.00% 23 19 0.00% 24 24 0.00% 25 23 0.00% 26 29 0.00% 27 25 0.00% 28 27 0.00% 29 34 0.00% 30 30 0.00% 31 37 0.00% 32 38 0.00% 33 26 0.00% 34 40 0.00% 35 38 0.00% 36 41 0.00% 37 59 0.00% 38 31 0.00% 39 37 0.00% 40 52 0.00% 41 48 0.00% 42 35 0.00% 43 53 0.00% 44 49 0.00% 45 57 0.00% 46 64 0.00% 47 69 0.00% 48 49 0.00% 49 66 0.00% 50 63 0.00% 51 66 0.00% 52 55 0.00% 53 59 0.00% 54 64 0.00% 55 78 0.00% 56 82 0.00% 57 73 0.00% 58 73 0.00% 59 85 0.00% 60 84 0.00% 61 86 0.00% 62 82 0.00% 63 87 0.00% 64 93 0.00% 65 84 0.00% 66 80 0.00% 67 93 0.00% 68 92 0.00% 69 142 0.00% 70 150 0.00% 71 150 0.00% 72 167 0.00% 73 156 0.00% 74 183 0.00% 75 190 0.00% 76 202 0.00% 77 218 0.00% 78 194 0.00% 79 281 0.00% 80 299 0.00% 81 309 0.00% 82 385 0.00% 83 411 0.00% 84 520 0.00% 85 533 0.00% 86 555 0.00% 87 643 0.00% 88 671 0.00% 89 760 0.00% 90 885 0.00% 91 998 0.00% 92 1154 0.00% 93 1252 0.00% 94 1385 0.00% 95 1613 0.01% 96 1703 0.01% 97 1820 0.01% 98 1912 0.01% 99 2044 0.01% 100 2249 0.01% 101 2489 0.01% 102 2910 0.01% 103 3133 0.01% 104 3370 0.01% 105 3683 0.01% 106 4058 0.01% 107 4295 0.01% 108 4509 0.02% 109 4830 0.02% 110 4942 0.02% 111 5456 0.02% 112 6125 0.02% 113 6649 0.02% 114 6952 0.02% 115 7533 0.03% 116 7854 0.03% 117 8077 0.03% 118 8627 0.03% 119 8757 0.03% 120 9192 0.03% 121 10281 0.04% 122 10607 0.04% 123 11453 0.04% 124 12259 0.04% 125 13012 0.05% 126 13615 0.05% 127 14052 0.05% 128 14193 0.05% 129 14657 0.05% 130 15174 0.05% 131 15921 0.06% 132 17086 0.06% 133 17820 0.06% 134 18963 0.07% 135 20017 0.07% 136 21120 0.07% 137 21737 0.08% 138 22040 0.08% 139 22743 0.08% 140 23164 0.08% 141 23918 0.08% 142 24855 0.09% 143 25748 0.09% 144 27634 0.10% 145 28613 0.10% 146 29951 0.10% 147 30672 0.11% 148 32032 0.11% 149 31938 0.11% 150 34036 0.12% 151 28142445 97.37% 28901982 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=19 prefix-density=0.98 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=167.73 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=10.0 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=16 prefix-density=0.76 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=15.61 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.4 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804213 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:15:11 Started mapping on | Dec 07 18:15:11 Finished on | Dec 07 18:21:03 Mapping speed, Million of reads per hour | 295.59 Number of input reads | 28901982 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 26982491 Uniquely mapped reads % | 93.36% Average mapped length | 299.99 Number of splices: Total | 27518326 Number of splices: Annotated (sjdb) | 25887511 Number of splices: GT/AG | 27153249 Number of splices: GC/AG | 312055 Number of splices: AT/AC | 13342 Number of splices: Non-canonical | 39680 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353741 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 27001 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.58% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1565750 1565750 1565750 N_multimapping 353741 353741 353741 N_noFeature 774425 26247314 971096 N_ambiguous 671558 4240 133852 UnstrandedReadsAssigned:25536508 PositiveStrandReadsAssigned:730937 NegativeStrandReadsAssigned:25877543 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804213 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804213-trimmed-pair1.fastq SRR7804213-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,901,982 reads, 26,149,154 reads pseudoaligned [quant] estimated average fragment length: 325.54 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR7804213.ke.tsv 35125 SRR7804213.se.tsv 88098 total ==> SRR7804213.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 612.815 0 0 PNS24247 1044 719.46 79.2297 4.93166 PNS24249 1928 1603.46 211.259 5.90022 PNS24246 1044 719.46 79.2297 4.93166 PNS24248 1044 719.46 79.2297 4.93166 PNS24244 1471 1146.46 134.052 5.23632 PNS24243 293 72.5495 0 0 KQK14069 1603 1278.46 18097 633.914 KQK14071 474 192.824 231.383 53.7381 ==> SRR7804213.se.tsv <== BRADI_1g14170v3 19667 BRADI_1g53295v3 233 BRADI_1g59795v3 781 BRADI_1g07683v3 0 BRADI_1g00485v3 65 BRADI_1g20270v3 2391 BRADI_1g74790v3 778 BRADI_1g09890v3 9 BRADI_1g77505v3 342 BRADI_1g48960v3 0 SRR7804213 completed mapping pipeline successfully