Starting /dee2/code/volunteer_pipeline.sh SRR7804214 current disk space = 1540807299072 free memory = 1468088192 SRR7804214 SRAfilesize 86477a13360ff08782893dbdfaf2d7e4 SRR7804214.sra SRR7804214.sra file validated SRR7804214 is paired end SRR7804214 is conventional basespace SRR7804214 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804214_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.15575 37.0 37.0 37.0 37.0 37.0 2 36.287 37.0 37.0 37.0 37.0 37.0 3 36.3395 37.0 37.0 37.0 37.0 37.0 4 36.446 37.0 37.0 37.0 37.0 37.0 5 36.5285 37.0 37.0 37.0 37.0 37.0 6 36.507 37.0 37.0 37.0 37.0 37.0 7 36.291 37.0 37.0 37.0 37.0 37.0 8 36.47 37.0 37.0 37.0 37.0 37.0 9 36.478 37.0 37.0 37.0 37.0 37.0 10-14 36.5315 37.0 37.0 37.0 37.0 37.0 15-19 36.4765 37.0 37.0 37.0 37.0 37.0 20-24 36.5229 37.0 37.0 37.0 37.0 37.0 25-29 36.4394 37.0 37.0 37.0 37.0 37.0 30-34 36.360299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.356199999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3515 37.0 37.0 37.0 37.0 37.0 45-49 36.2837 37.0 37.0 37.0 37.0 37.0 50-54 36.293600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.213 37.0 37.0 37.0 37.0 37.0 60-64 36.174 37.0 37.0 37.0 37.0 37.0 65-69 36.130100000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0616 37.0 37.0 37.0 37.0 37.0 75-79 36.1333 37.0 37.0 37.0 37.0 37.0 80-84 36.0499 37.0 37.0 37.0 37.0 37.0 85-89 35.9663 37.0 37.0 37.0 37.0 37.0 90-94 35.8978 37.0 37.0 37.0 37.0 37.0 95-99 35.832 37.0 37.0 37.0 37.0 37.0 100-104 35.8489 37.0 37.0 37.0 37.0 37.0 105-109 35.8204 37.0 37.0 37.0 37.0 37.0 110-114 35.7588 37.0 37.0 37.0 37.0 37.0 115-119 35.664199999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.5618 37.0 37.0 37.0 37.0 37.0 125-129 35.5723 37.0 37.0 37.0 37.0 37.0 130-134 35.425599999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.3466 37.0 37.0 37.0 34.6 37.0 140-144 35.3937 37.0 37.0 37.0 37.0 37.0 145-149 35.13869999999999 37.0 37.0 37.0 27.4 37.0 150-151 34.51525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 2.0 25 4.0 26 5.0 27 15.0 28 12.0 29 29.0 30 37.0 31 50.0 32 67.0 33 123.0 34 184.0 35 495.0 36 2736.0 37 238.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.16854495366892 12.697220135236664 10.894064613072878 37.24017029802154 2 24.2 17.925 34.75 23.125 3 23.0 24.025 24.0 28.975 4 27.175 29.7 18.625 24.5 5 25.424999999999997 31.424999999999997 21.55 21.6 6 20.825 31.65 23.474999999999998 24.05 7 16.375 20.974999999999998 41.75 20.9 8 22.05 19.55 27.35 31.05 9 20.7 18.9 31.624999999999996 28.775000000000002 10-14 23.915 25.840000000000003 23.845 26.400000000000002 15-19 23.95 24.525 25.09 26.435 20-24 23.69 24.995 24.935 26.38 25-29 23.915 24.834999999999997 24.705 26.545 30-34 23.775 24.73 24.38 27.115000000000002 35-39 23.82 24.75 24.765 26.665 40-44 23.875 24.95 24.555 26.619999999999997 45-49 24.705 24.490000000000002 24.65 26.155 50-54 24.065 24.825 24.57 26.540000000000003 55-59 23.78 24.34 24.515 27.365000000000002 60-64 24.325 24.495 23.895 27.284999999999997 65-69 24.4 24.695 23.91 26.995 70-74 24.41 24.485 24.615000000000002 26.490000000000002 75-79 25.105 24.22 23.515 27.16 80-84 25.009999999999998 24.4 23.990000000000002 26.6 85-89 24.965 24.060000000000002 24.245 26.729999999999997 90-94 25.174999999999997 23.775 24.355 26.695 95-99 25.66 23.59 24.135 26.615 100-104 24.755 24.785 23.599999999999998 26.86 105-109 24.72 23.880000000000003 24.055 27.345000000000002 110-114 25.174999999999997 23.244999999999997 24.555 27.025 115-119 25.355 23.830000000000002 24.095 26.72 120-124 25.895000000000003 23.585 23.919999999999998 26.6 125-129 25.290000000000003 23.775 23.765 27.169999999999998 130-134 25.735000000000003 23.815 24.25 26.200000000000003 135-139 25.41 23.615 24.104999999999997 26.87 140-144 25.525 23.580000000000002 24.125 26.77 145-149 25.074999999999996 23.34 24.19 27.395000000000003 150-151 25.1875 22.9375 24.0625 27.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 2.0 29 3.0 30 4.5 31 9.0 32 13.0 33 16.5 34 24.0 35 32.0 36 43.5 37 60.0 38 77.5 39 93.0 40 116.0 41 138.0 42 153.0 43 161.5 44 157.0 45 160.5 46 175.0 47 178.0 48 182.0 49 176.0 50 140.0 51 122.0 52 128.0 53 116.5 54 108.5 55 104.0 56 94.0 57 89.0 58 83.0 59 85.0 60 88.5 61 79.0 62 74.0 63 76.0 64 74.5 65 74.0 66 69.0 67 65.0 68 60.0 69 59.0 70 50.5 71 33.0 72 29.5 73 30.5 74 25.0 75 17.0 76 14.5 77 12.0 78 5.5 79 4.0 80 4.5 81 2.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 95.1354194057323 90.45 2 4.5753352616355505 8.7 3 0.2629503023928477 0.75 4 0.026295030239284777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2625 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.3625 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9125000000000001 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.1749999999999998 0.0 0.0 0.0 0.0 138-139 1.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGAAA 10 0.006830828 145.0 9 >>END_MODULE SRR7804214 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804214_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4465 37.0 37.0 37.0 37.0 37.0 2 36.089 37.0 37.0 37.0 37.0 37.0 3 36.2725 37.0 37.0 37.0 37.0 37.0 4 36.3165 37.0 37.0 37.0 37.0 37.0 5 36.358 37.0 37.0 37.0 37.0 37.0 6 36.309 37.0 37.0 37.0 37.0 37.0 7 36.268 37.0 37.0 37.0 37.0 37.0 8 36.3515 37.0 37.0 37.0 37.0 37.0 9 36.39 37.0 37.0 37.0 37.0 37.0 10-14 36.2675 37.0 37.0 37.0 37.0 37.0 15-19 36.26100000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.182500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1653 37.0 37.0 37.0 37.0 37.0 30-34 36.0711 37.0 37.0 37.0 37.0 37.0 35-39 35.9869 37.0 37.0 37.0 37.0 37.0 40-44 36.045399999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9006 37.0 37.0 37.0 37.0 37.0 50-54 35.946400000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.91329999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.7673 37.0 37.0 37.0 37.0 37.0 65-69 35.7081 37.0 37.0 37.0 37.0 37.0 70-74 35.7257 37.0 37.0 37.0 37.0 37.0 75-79 35.6712 37.0 37.0 37.0 37.0 37.0 80-84 35.5995 37.0 37.0 37.0 37.0 37.0 85-89 35.4837 37.0 37.0 37.0 37.0 37.0 90-94 35.4243 37.0 37.0 37.0 37.0 37.0 95-99 35.39209999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.3014 37.0 37.0 37.0 34.6 37.0 105-109 35.3099 37.0 37.0 37.0 34.6 37.0 110-114 35.206 37.0 37.0 37.0 27.4 37.0 115-119 35.0042 37.0 37.0 37.0 25.0 37.0 120-124 35.0071 37.0 37.0 37.0 25.0 37.0 125-129 34.861599999999996 37.0 37.0 37.0 25.0 37.0 130-134 34.8828 37.0 37.0 37.0 25.0 37.0 135-139 34.6411 37.0 37.0 37.0 25.0 37.0 140-144 34.5079 37.0 37.0 37.0 25.0 37.0 145-149 34.4292 37.0 37.0 37.0 25.0 37.0 150-151 33.826499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 0.0 18 1.0 19 3.0 20 2.0 21 7.0 22 1.0 23 6.0 24 15.0 25 9.0 26 9.0 27 11.0 28 19.0 29 24.0 30 56.0 31 53.0 32 79.0 33 140.0 34 291.0 35 803.0 36 2358.0 37 106.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.25 11.95 12.725 38.074999999999996 2 28.075 19.525000000000002 29.599999999999998 22.8 3 25.45 21.7 25.4 27.450000000000003 4 27.35 30.075000000000003 16.775000000000002 25.8 5 29.725 30.4 17.474999999999998 22.400000000000002 6 23.200000000000003 33.0 18.25 25.55 7 21.075 15.65 35.325 27.950000000000003 8 22.575 19.55 21.65 36.225 9 22.8 20.875 24.925 31.4 10-14 26.115 24.41 22.14 27.334999999999997 15-19 26.334999999999997 23.41 22.56 27.694999999999997 20-24 26.790000000000003 23.419999999999998 21.94 27.85 25-29 26.340000000000003 24.07 21.955 27.634999999999998 30-34 26.27 24.18 22.264999999999997 27.284999999999997 35-39 27.32 23.544999999999998 22.11 27.025 40-44 27.32 23.145 22.495 27.04 45-49 27.26 23.5 22.56 26.68 50-54 27.235 23.825 21.98 26.96 55-59 27.215 23.155 22.395 27.235 60-64 26.985 23.77 22.98 26.265 65-69 27.015 23.74 22.335 26.91 70-74 27.105 23.59 22.89 26.415 75-79 26.700000000000003 23.875 22.725 26.700000000000003 80-84 27.72 23.599999999999998 22.32 26.36 85-89 27.71 23.485 22.42 26.384999999999998 90-94 27.495000000000005 23.445 22.45 26.61 95-99 28.01 23.330000000000002 22.505 26.155 100-104 28.035 23.66 21.95 26.355 105-109 27.365000000000002 23.175 22.814999999999998 26.645000000000003 110-114 27.665 23.745 22.040000000000003 26.55 115-119 27.01 24.07 22.21 26.71 120-124 27.339999999999996 23.93 22.28 26.450000000000003 125-129 27.74 23.74 22.67 25.85 130-134 27.779999999999998 23.62 22.675 25.924999999999997 135-139 27.944999999999997 23.45 23.18 25.424999999999997 140-144 28.444999999999997 24.26 21.84 25.455 145-149 28.139999999999997 23.265 22.919999999999998 25.674999999999997 150-151 27.8625 24.6625 22.725 24.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.5 27 1.0 28 0.5 29 2.0 30 2.5 31 6.5 32 9.0 33 9.0 34 13.5 35 18.5 36 27.0 37 35.5 38 51.0 39 63.0 40 77.5 41 106.5 42 120.0 43 127.5 44 129.5 45 135.5 46 150.0 47 156.5 48 148.0 49 138.0 50 132.0 51 127.0 52 128.0 53 111.5 54 98.0 55 108.5 56 110.5 57 90.0 58 95.5 59 105.5 60 88.5 61 90.5 62 102.5 63 97.0 64 99.5 65 98.0 66 82.0 67 82.5 68 90.5 69 85.0 70 67.5 71 64.0 72 65.5 73 57.5 74 46.5 75 38.0 76 28.5 77 23.0 78 17.0 79 9.0 80 6.5 81 4.5 82 3.0 83 1.5 84 2.0 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.04088630968083 90.075 2 4.5634397256660515 8.649999999999999 3 0.3165391717225006 0.8999999999999999 4 0.026378264310208392 0.1 5 0.026378264310208392 0.125 6 0.026378264310208392 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0125 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0125 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.025 0.0 0.025 0.0 0.0 86-87 0.025 0.0 0.025 0.0 0.0 88-89 0.05 0.0 0.025 0.0 0.0 90-91 0.05 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.075 0.0 0.025 0.0 0.0 96-97 0.075 0.0 0.025 0.0 0.0 98-99 0.1 0.0 0.025 0.0 0.0 100-101 0.1 0.0 0.025 0.0 0.0 102-103 0.1 0.0 0.025 0.0 0.0 104-105 0.1125 0.0 0.025 0.0 0.0 106-107 0.125 0.0 0.025 0.0 0.0 108-109 0.1375 0.0 0.025 0.0 0.0 110-111 0.175 0.0 0.025 0.0 0.0 112-113 0.175 0.0 0.025 0.0 0.0 114-115 0.2 0.0 0.025 0.0 0.0 116-117 0.225 0.0 0.025 0.0 0.0 118-119 0.2875 0.0 0.025 0.0 0.0 120-121 0.3625 0.0 0.025 0.0 0.0 122-123 0.3875 0.0 0.025 0.0 0.0 124-125 0.4875 0.0 0.025 0.0 0.0 126-127 0.5625 0.0 0.025 0.0 0.0 128-129 0.6875 0.0 0.025 0.0 0.0 130-131 0.8 0.0 0.025 0.0 0.0 132-133 0.8875 0.0 0.025 0.0 0.0 134-135 1.0125000000000002 0.0 0.025 0.0 0.0 136-137 1.15 0.0 0.025 0.0 0.0 138-139 1.2375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGACTC 10 0.006830828 145.0 7 ACATCCA 10 0.006830828 145.0 3 >>END_MODULE Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231877 spots for SRR7804214.sra Written 1231877 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra Read 1231874 spots for SRR7804214.sra Written 1231874 spots for SRR7804214.sra SRR ids: ['SRR7804214.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fbrpr89j SRR7804214.sra spots: 24637483 blocks: [[1, 1231874], [1231875, 2463748], [2463749, 3695622], [3695623, 4927496], [4927497, 6159370], [6159371, 7391244], [7391245, 8623118], [8623119, 9854992], [9854993, 11086866], [11086867, 12318740], [12318741, 13550614], [13550615, 14782488], [14782489, 16014362], [16014363, 17246236], [17246237, 18478110], [18478111, 19709984], [19709985, 20941858], [20941859, 22173732], [22173733, 23405606], [23405607, 24637483]] SRR7804214 file size 8327134 SRR7804214 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804214 SRR7804214_1.fastq SRR7804214_2.fastq Input file: SRR7804214_1.fastq Paired file: SRR7804214_2.fastq trimmed: SRR7804214-trimmed-pair1.fastq, SRR7804214-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:12:19 2024 >> started Sat Dec 7 18:12:51 2024 >> done (32.383s) 24637483 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 625 ( 0.00%) empty read pairs filtered out after trimming by size control 24636793 (100.00%) read pairs available; of these: 649687 ( 2.64%) trimmed read pairs available after processing 23987106 (97.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 11 0.00% 21 13 0.00% 22 27 0.00% 23 18 0.00% 24 23 0.00% 25 23 0.00% 26 22 0.00% 27 20 0.00% 28 18 0.00% 29 26 0.00% 30 27 0.00% 31 37 0.00% 32 27 0.00% 33 34 0.00% 34 33 0.00% 35 38 0.00% 36 37 0.00% 37 49 0.00% 38 43 0.00% 39 40 0.00% 40 38 0.00% 41 43 0.00% 42 37 0.00% 43 46 0.00% 44 39 0.00% 45 38 0.00% 46 57 0.00% 47 48 0.00% 48 55 0.00% 49 64 0.00% 50 56 0.00% 51 61 0.00% 52 61 0.00% 53 64 0.00% 54 81 0.00% 55 73 0.00% 56 69 0.00% 57 61 0.00% 58 69 0.00% 59 61 0.00% 60 94 0.00% 61 82 0.00% 62 89 0.00% 63 78 0.00% 64 97 0.00% 65 86 0.00% 66 91 0.00% 67 86 0.00% 68 115 0.00% 69 111 0.00% 70 132 0.00% 71 165 0.00% 72 158 0.00% 73 153 0.00% 74 158 0.00% 75 186 0.00% 76 190 0.00% 77 216 0.00% 78 243 0.00% 79 252 0.00% 80 290 0.00% 81 304 0.00% 82 351 0.00% 83 408 0.00% 84 481 0.00% 85 506 0.00% 86 526 0.00% 87 586 0.00% 88 677 0.00% 89 690 0.00% 90 789 0.00% 91 887 0.00% 92 1034 0.00% 93 1076 0.00% 94 1324 0.01% 95 1379 0.01% 96 1527 0.01% 97 1679 0.01% 98 1825 0.01% 99 1963 0.01% 100 2033 0.01% 101 2344 0.01% 102 2538 0.01% 103 2802 0.01% 104 3004 0.01% 105 3301 0.01% 106 3655 0.01% 107 3798 0.02% 108 4151 0.02% 109 4279 0.02% 110 4589 0.02% 111 4906 0.02% 112 5300 0.02% 113 5700 0.02% 114 6196 0.03% 115 6414 0.03% 116 6991 0.03% 117 7205 0.03% 118 7619 0.03% 119 7963 0.03% 120 8337 0.03% 121 8674 0.04% 122 9115 0.04% 123 9616 0.04% 124 10556 0.04% 125 10961 0.04% 126 11444 0.05% 127 11878 0.05% 128 12167 0.05% 129 13025 0.05% 130 13199 0.05% 131 13766 0.06% 132 14637 0.06% 133 15366 0.06% 134 16166 0.07% 135 16992 0.07% 136 17759 0.07% 137 17885 0.07% 138 18427 0.07% 139 19384 0.08% 140 19696 0.08% 141 20215 0.08% 142 21370 0.09% 143 21848 0.09% 144 22733 0.09% 145 23780 0.10% 146 24937 0.10% 147 25954 0.11% 148 26652 0.11% 149 27005 0.11% 150 28565 0.12% 151 23987106 97.36% 24636793 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=21 prefix-density=0.86 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=175.35 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=10.5 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=12 prefix-density=0.66 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=20.97 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804214 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:13:56 Started mapping on | Dec 07 18:13:56 Finished on | Dec 07 18:17:53 Mapping speed, Million of reads per hour | 374.23 Number of input reads | 24636793 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 23126484 Uniquely mapped reads % | 93.87% Average mapped length | 299.99 Number of splices: Total | 23513031 Number of splices: Annotated (sjdb) | 22137375 Number of splices: GT/AG | 23199040 Number of splices: GC/AG | 269013 Number of splices: AT/AC | 10989 Number of splices: Non-canonical | 33989 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 274146 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 21240 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1236163 1236163 1236163 N_multimapping 274146 274146 274146 N_noFeature 598463 22489892 759770 N_ambiguous 586787 3638 112504 UnstrandedReadsAssigned:21941234 PositiveStrandReadsAssigned:632954 NegativeStrandReadsAssigned:22254210 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804214 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804214-trimmed-pair1.fastq SRR7804214-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,636,793 reads, 22,478,080 reads pseudoaligned [quant] estimated average fragment length: 326.817 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR7804214.ke.tsv 35125 SRR7804214.se.tsv 88098 total ==> SRR7804214.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 611.287 0 0 PNS24247 1044 718.183 53.126 4.01075 PNS24249 1928 1602.18 198.859 6.72956 PNS24246 1044 718.183 53.126 4.01075 PNS24248 1044 718.183 53.126 4.01075 PNS24244 1471 1145.18 77.763 3.68173 PNS24243 293 72.1917 0 0 KQK14069 1603 1277.18 14084.6 597.924 KQK14071 474 191.278 202.344 57.356 ==> SRR7804214.se.tsv <== BRADI_1g14170v3 15341 BRADI_1g53295v3 248 BRADI_1g59795v3 634 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 2768 BRADI_1g74790v3 698 BRADI_1g09890v3 16 BRADI_1g77505v3 317 BRADI_1g48960v3 0 SRR7804214 completed mapping pipeline successfully