Starting /dee2/code/volunteer_pipeline.sh SRR7804215 current disk space = 1526168780800 free memory = 1601699948 SRR7804215 SRAfilesize 70b3455c183f889beaec559859044b44 SRR7804215.sra SRR7804215.sra file validated SRR7804215 is paired end SRR7804215 is conventional basespace SRR7804215 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804215_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.03325 37.0 37.0 37.0 37.0 37.0 2 36.172 37.0 37.0 37.0 37.0 37.0 3 36.255 37.0 37.0 37.0 37.0 37.0 4 36.395 37.0 37.0 37.0 37.0 37.0 5 36.342 37.0 37.0 37.0 37.0 37.0 6 36.49 37.0 37.0 37.0 37.0 37.0 7 36.3095 37.0 37.0 37.0 37.0 37.0 8 36.4555 37.0 37.0 37.0 37.0 37.0 9 36.3945 37.0 37.0 37.0 37.0 37.0 10-14 36.4574 37.0 37.0 37.0 37.0 37.0 15-19 36.441 37.0 37.0 37.0 37.0 37.0 20-24 36.4336 37.0 37.0 37.0 37.0 37.0 25-29 36.3553 37.0 37.0 37.0 37.0 37.0 30-34 36.311099999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2999 37.0 37.0 37.0 37.0 37.0 40-44 36.2252 37.0 37.0 37.0 37.0 37.0 45-49 36.1871 37.0 37.0 37.0 37.0 37.0 50-54 36.1583 37.0 37.0 37.0 37.0 37.0 55-59 36.158300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.105199999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.0815 37.0 37.0 37.0 37.0 37.0 70-74 35.976299999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.9987 37.0 37.0 37.0 37.0 37.0 80-84 35.9577 37.0 37.0 37.0 37.0 37.0 85-89 35.9325 37.0 37.0 37.0 37.0 37.0 90-94 35.83579999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.8175 37.0 37.0 37.0 37.0 37.0 100-104 35.750800000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.6906 37.0 37.0 37.0 37.0 37.0 110-114 35.6238 37.0 37.0 37.0 37.0 37.0 115-119 35.5205 37.0 37.0 37.0 37.0 37.0 120-124 35.5385 37.0 37.0 37.0 37.0 37.0 125-129 35.459500000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.309400000000004 37.0 37.0 37.0 32.2 37.0 135-139 35.258 37.0 37.0 37.0 32.2 37.0 140-144 35.17139999999999 37.0 37.0 37.0 29.8 37.0 145-149 35.0373 37.0 37.0 37.0 25.0 37.0 150-151 34.472 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 5.0 27 10.0 28 21.0 29 39.0 30 52.0 31 59.0 32 90.0 33 109.0 34 194.0 35 511.0 36 2699.0 37 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.05838135805563 11.5760461037334 10.223001753946379 41.14257078426459 2 26.075 17.724999999999998 35.6 20.599999999999998 3 21.9 24.125 24.875 29.099999999999998 4 28.1 30.425 19.2 22.275 5 26.05 31.55 22.025 20.375 6 21.2 30.475 24.349999999999998 23.974999999999998 7 17.175 18.975 41.325 22.525000000000002 8 21.375 18.675 27.400000000000002 32.550000000000004 9 21.775 18.8 29.825000000000003 29.599999999999998 10-14 24.310000000000002 24.775 23.515 27.400000000000002 15-19 24.39 23.64 24.595 27.375 20-24 24.695 24.47 24.275 26.56 25-29 24.795 23.78 24.715 26.71 30-34 24.635 23.71 24.735 26.919999999999998 35-39 24.355 23.815 24.64 27.189999999999998 40-44 24.16 24.295 24.34 27.205000000000002 45-49 24.425 23.785 24.365000000000002 27.425 50-54 24.154999999999998 23.89 24.625 27.33 55-59 24.79 23.755000000000003 23.745 27.71 60-64 24.975 23.369999999999997 24.34 27.315 65-69 24.845 23.335 24.455 27.365000000000002 70-74 24.965 23.715 23.91 27.41 75-79 25.455 23.98 23.705000000000002 26.86 80-84 25.145 23.815 23.674999999999997 27.365000000000002 85-89 25.430000000000003 23.705000000000002 23.875 26.99 90-94 25.285000000000004 23.580000000000002 23.565 27.57 95-99 25.21 23.685000000000002 23.875 27.229999999999997 100-104 25.430000000000003 23.28 23.52 27.77 105-109 25.295 23.225 24.035 27.445000000000004 110-114 26.05 23.195 23.69 27.065 115-119 25.485000000000003 23.02 23.77 27.725 120-124 26.57 22.62 23.25 27.560000000000002 125-129 26.090000000000003 22.93 23.71 27.27 130-134 26.05 22.605 23.64 27.705000000000002 135-139 26.085 23.06 23.59 27.265 140-144 26.424999999999997 22.81 23.405 27.36 145-149 26.029999999999998 23.11 23.56 27.3 150-151 25.2875 22.7375 23.175 28.799999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 3.0 28 4.5 29 4.5 30 6.5 31 7.0 32 10.5 33 17.5 34 24.5 35 38.0 36 40.5 37 49.5 38 75.5 39 85.5 40 96.0 41 113.0 42 121.0 43 140.5 44 152.0 45 152.5 46 146.5 47 134.0 48 124.0 49 122.0 50 135.0 51 136.5 52 127.0 53 131.5 54 145.0 55 148.5 56 142.5 57 126.0 58 119.0 59 123.0 60 105.5 61 91.5 62 85.0 63 71.5 64 68.0 65 69.5 66 69.0 67 72.0 68 72.0 69 60.5 70 52.0 71 42.0 72 32.5 73 26.5 74 20.5 75 16.0 76 14.0 77 11.5 78 6.0 79 3.5 80 1.5 81 1.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.36043360433605 86.125 2 5.284552845528456 9.75 3 1.1111111111111112 3.075 4 0.13550135501355012 0.5 5 0.05420054200542006 0.25 6 0.05420054200542006 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCGTCCCTCCGTACCAACAAGGGGTAGTACAGGAATATTGACCTGTTG 6 0.15 No Hit GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 6 0.15 No Hit CACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGCGAA 5 0.125 No Hit AGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTCGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1375 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.21250000000000002 0.0 0.0 0.0 0.0 116-117 0.2625 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.4375 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.5125 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.675 0.0 0.0 0.0 0.0 134-135 0.7749999999999999 0.0 0.0 0.0 0.0 136-137 0.9125 0.0 0.0 0.0 0.0 138-139 0.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCGTCT 10 0.006830828 145.0 7 TCGTCTC 10 0.006830828 145.0 8 CAGGTAT 10 0.006830828 145.0 1 TACTTAT 10 0.006830828 145.0 9 TTTCGTC 10 0.006830828 145.0 6 CGTCTCT 10 0.006830828 145.0 9 >>END_MODULE SRR7804215 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804215_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4255 37.0 37.0 37.0 37.0 37.0 2 36.0285 37.0 37.0 37.0 37.0 37.0 3 36.1525 37.0 37.0 37.0 37.0 37.0 4 36.185 37.0 37.0 37.0 37.0 37.0 5 36.28 37.0 37.0 37.0 37.0 37.0 6 36.0455 37.0 37.0 37.0 37.0 37.0 7 36.0125 37.0 37.0 37.0 37.0 37.0 8 36.2515 37.0 37.0 37.0 37.0 37.0 9 36.2125 37.0 37.0 37.0 37.0 37.0 10-14 36.107299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.0796 37.0 37.0 37.0 37.0 37.0 20-24 36.0061 37.0 37.0 37.0 37.0 37.0 25-29 36.0033 37.0 37.0 37.0 37.0 37.0 30-34 35.9711 37.0 37.0 37.0 37.0 37.0 35-39 35.8815 37.0 37.0 37.0 37.0 37.0 40-44 35.7976 37.0 37.0 37.0 37.0 37.0 45-49 35.7701 37.0 37.0 37.0 37.0 37.0 50-54 35.7568 37.0 37.0 37.0 37.0 37.0 55-59 35.7531 37.0 37.0 37.0 37.0 37.0 60-64 35.605 37.0 37.0 37.0 37.0 37.0 65-69 35.557 37.0 37.0 37.0 37.0 37.0 70-74 35.5698 37.0 37.0 37.0 37.0 37.0 75-79 35.592600000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.4841 37.0 37.0 37.0 37.0 37.0 85-89 35.4936 37.0 37.0 37.0 37.0 37.0 90-94 35.315099999999994 37.0 37.0 37.0 34.6 37.0 95-99 35.2298 37.0 37.0 37.0 29.8 37.0 100-104 35.209500000000006 37.0 37.0 37.0 32.2 37.0 105-109 35.1952 37.0 37.0 37.0 27.4 37.0 110-114 34.9607 37.0 37.0 37.0 25.0 37.0 115-119 34.903999999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.9534 37.0 37.0 37.0 25.0 37.0 125-129 34.7538 37.0 37.0 37.0 25.0 37.0 130-134 34.6768 37.0 37.0 37.0 25.0 37.0 135-139 34.4439 37.0 37.0 37.0 25.0 37.0 140-144 34.2825 37.0 37.0 37.0 25.0 37.0 145-149 34.218 37.0 37.0 37.0 25.0 37.0 150-151 33.536 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 6.0 15 2.0 16 4.0 17 1.0 18 1.0 19 2.0 20 4.0 21 4.0 22 4.0 23 6.0 24 8.0 25 13.0 26 11.0 27 26.0 28 18.0 29 41.0 30 42.0 31 58.0 32 103.0 33 162.0 34 273.0 35 848.0 36 2283.0 37 77.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.15 12.625 10.6 38.625 2 29.9 18.125 30.2 21.775 3 24.925 21.5 27.275 26.3 4 27.975 30.599999999999998 16.650000000000002 24.775 5 29.625 29.849999999999998 17.75 22.775000000000002 6 23.0 32.675 19.025 25.3 7 20.724999999999998 14.95 36.95 27.375 8 22.075 20.424999999999997 22.2 35.3 9 24.2 20.549999999999997 24.349999999999998 30.9 10-14 26.669999999999998 24.14 21.945 27.245 15-19 27.339999999999996 23.805 22.32 26.534999999999997 20-24 27.115000000000002 23.724999999999998 22.57 26.590000000000003 25-29 27.615000000000002 24.175 21.73 26.479999999999997 30-34 27.215 23.474999999999998 21.595 27.715 35-39 27.725 23.82 22.400000000000002 26.055 40-44 27.810000000000002 23.49 22.295 26.405 45-49 27.675 23.7 21.68 26.945000000000004 50-54 28.299999999999997 23.044999999999998 22.235 26.419999999999998 55-59 27.445000000000004 23.724999999999998 22.015 26.815 60-64 27.77 23.7 22.0 26.529999999999998 65-69 27.355 23.53 21.84 27.275 70-74 27.345000000000002 22.650000000000002 22.475 27.529999999999998 75-79 27.71 22.96 21.92 27.41 80-84 27.58 23.055 21.935 27.43 85-89 28.110000000000003 23.005 22.08 26.805 90-94 27.97 23.35 22.365 26.314999999999998 95-99 28.384999999999998 23.28 22.295 26.040000000000003 100-104 28.08 23.905 21.560000000000002 26.455000000000002 105-109 27.875 22.925 22.48 26.72 110-114 27.229999999999997 23.825 21.834999999999997 27.11 115-119 28.675 23.745 21.645 25.935000000000002 120-124 27.834999999999997 23.945 21.78 26.44 125-129 27.705000000000002 24.435000000000002 21.445 26.415 130-134 28.515 23.62 21.51 26.355 135-139 28.075 23.830000000000002 22.155 25.94 140-144 28.494999999999997 24.195 21.795 25.515 145-149 28.4 24.665 21.47 25.465 150-151 28.9375 24.637500000000003 22.1375 24.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.5 27 3.0 28 3.0 29 3.5 30 6.0 31 9.5 32 10.5 33 12.0 34 15.5 35 28.0 36 36.5 37 35.5 38 54.0 39 66.5 40 64.0 41 80.5 42 90.5 43 97.5 44 124.0 45 129.5 46 125.0 47 122.5 48 123.5 49 135.5 50 123.0 51 118.0 52 119.0 53 119.5 54 125.5 55 124.0 56 123.0 57 115.0 58 113.5 59 112.0 60 110.5 61 109.5 62 114.5 63 107.0 64 96.0 65 95.0 66 86.0 67 91.0 68 99.0 69 92.5 70 84.0 71 74.5 72 59.0 73 48.5 74 44.5 75 34.5 76 25.5 77 16.0 78 6.5 79 3.0 80 5.0 81 6.0 82 3.0 83 1.5 84 1.0 85 1.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.4835731740429 86.075 2 5.240293239207168 9.65 3 0.8145533532446375 2.25 4 0.2986695628563671 1.0999999999999999 5 0.054303556882975834 0.25 6 0.027151778441487917 0.15 7 0.08145533532446375 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit GCCCGGATCACCAGCTAAGGCCCCTAAATGACCGCTCAGTGATAAAGGAG 7 0.17500000000000002 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 7 0.17500000000000002 No Hit CGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.225 0.0 0.0 0.0 0.0 114-115 0.2375 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.3125 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.5 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.575 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.9375 0.0 0.0 0.0 0.0 138-139 1.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097950 spots for SRR7804215.sra Written 1097950 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra Read 1097935 spots for SRR7804215.sra Written 1097935 spots for SRR7804215.sra SRR ids: ['SRR7804215.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9gw1vdjd SRR7804215.sra spots: 21958715 blocks: [[1, 1097935], [1097936, 2195870], [2195871, 3293805], [3293806, 4391740], [4391741, 5489675], [5489676, 6587610], [6587611, 7685545], [7685546, 8783480], [8783481, 9881415], [9881416, 10979350], [10979351, 12077285], [12077286, 13175220], [13175221, 14273155], [14273156, 15371090], [15371091, 16469025], [16469026, 17566960], [17566961, 18664895], [18664896, 19762830], [19762831, 20860765], [20860766, 21958715]] SRR7804215 file size 7419387 SRR7804215 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804215 SRR7804215_1.fastq SRR7804215_2.fastq Input file: SRR7804215_1.fastq Paired file: SRR7804215_2.fastq trimmed: SRR7804215-trimmed-pair1.fastq, SRR7804215-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:13:07 2024 >> started Tue Dec 10 04:13:31 2024 >> done (23.973s) 21958715 read pairs processed; of these: 48 ( 0.00%) short read pairs filtered out after trimming by size control 432 ( 0.00%) empty read pairs filtered out after trimming by size control 21958235 (100.00%) read pairs available; of these: 459496 ( 2.09%) trimmed read pairs available after processing 21498739 (97.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 14 0.00% 21 17 0.00% 22 9 0.00% 23 20 0.00% 24 19 0.00% 25 21 0.00% 26 14 0.00% 27 19 0.00% 28 23 0.00% 29 23 0.00% 30 15 0.00% 31 32 0.00% 32 27 0.00% 33 31 0.00% 34 28 0.00% 35 34 0.00% 36 26 0.00% 37 28 0.00% 38 43 0.00% 39 40 0.00% 40 40 0.00% 41 39 0.00% 42 39 0.00% 43 41 0.00% 44 33 0.00% 45 38 0.00% 46 33 0.00% 47 45 0.00% 48 51 0.00% 49 52 0.00% 50 41 0.00% 51 45 0.00% 52 40 0.00% 53 50 0.00% 54 42 0.00% 55 64 0.00% 56 56 0.00% 57 64 0.00% 58 65 0.00% 59 67 0.00% 60 78 0.00% 61 62 0.00% 62 78 0.00% 63 68 0.00% 64 61 0.00% 65 67 0.00% 66 85 0.00% 67 73 0.00% 68 97 0.00% 69 112 0.00% 70 79 0.00% 71 140 0.00% 72 138 0.00% 73 150 0.00% 74 124 0.00% 75 148 0.00% 76 165 0.00% 77 160 0.00% 78 164 0.00% 79 198 0.00% 80 195 0.00% 81 243 0.00% 82 279 0.00% 83 313 0.00% 84 329 0.00% 85 415 0.00% 86 395 0.00% 87 470 0.00% 88 494 0.00% 89 520 0.00% 90 602 0.00% 91 661 0.00% 92 752 0.00% 93 833 0.00% 94 887 0.00% 95 999 0.00% 96 1097 0.00% 97 1206 0.01% 98 1218 0.01% 99 1409 0.01% 100 1499 0.01% 101 1619 0.01% 102 1822 0.01% 103 1962 0.01% 104 2161 0.01% 105 2404 0.01% 106 2482 0.01% 107 2726 0.01% 108 2827 0.01% 109 3016 0.01% 110 3050 0.01% 111 3394 0.02% 112 3778 0.02% 113 3879 0.02% 114 4213 0.02% 115 4448 0.02% 116 4760 0.02% 117 4934 0.02% 118 5221 0.02% 119 5389 0.02% 120 5731 0.03% 121 5981 0.03% 122 6370 0.03% 123 6851 0.03% 124 7335 0.03% 125 7742 0.04% 126 8222 0.04% 127 8341 0.04% 128 8409 0.04% 129 8918 0.04% 130 9061 0.04% 131 9667 0.04% 132 10410 0.05% 133 10730 0.05% 134 11266 0.05% 135 11981 0.05% 136 12421 0.06% 137 13062 0.06% 138 13324 0.06% 139 13718 0.06% 140 13897 0.06% 141 14571 0.07% 142 15159 0.07% 143 15450 0.07% 144 16307 0.07% 145 16837 0.08% 146 17655 0.08% 147 18806 0.09% 148 19302 0.09% 149 19421 0.09% 150 19960 0.09% 151 21498739 97.91% 21958235 reads passed initial QC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=15 prefix-density=1.12 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=8.84 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.1 sequence=AGAACCCGTCGCTGTCTCGGCTGTGATACCGGAGGCTCTAGGGAAGTCGGAGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGA criterion=sequence-density sequence-density=1.39 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=19 prefix-density=1.48 prefix-fanout=2.3 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=14.29 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.9 sequence=AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC SRR7804215 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:14:21 Started mapping on | Dec 10 04:14:21 Finished on | Dec 10 04:17:14 Mapping speed, Million of reads per hour | 456.93 Number of input reads | 21958235 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 18495736 Uniquely mapped reads % | 84.23% Average mapped length | 300.23 Number of splices: Total | 16686803 Number of splices: Annotated (sjdb) | 15773855 Number of splices: GT/AG | 16463190 Number of splices: GC/AG | 191800 Number of splices: AT/AC | 5138 Number of splices: Non-canonical | 26675 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1042217 % of reads mapped to multiple loci | 4.75% Number of reads mapped to too many loci | 184256 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 6.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2420282 2420282 2420282 N_multimapping 1042217 1042217 1042217 N_noFeature 1683942 17933556 1819003 N_ambiguous 534009 3054 108085 UnstrandedReadsAssigned:16277785 PositiveStrandReadsAssigned:559126 NegativeStrandReadsAssigned:16568648 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804215 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804215-trimmed-pair1.fastq SRR7804215-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,958,235 reads, 16,984,101 reads pseudoaligned [quant] estimated average fragment length: 340.332 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52973 SRR7804215.ke.tsv 35125 SRR7804215.se.tsv 88098 total ==> SRR7804215.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 597.82 0 0 PNS24247 1044 704.668 42.8801 3.87309 PNS24249 1928 1588.67 118.605 4.75179 PNS24246 1044 704.668 42.8801 3.87309 PNS24248 1044 704.668 42.8801 3.87309 PNS24244 1471 1131.67 70.7544 3.97943 PNS24243 293 69.7181 0 0 KQK14069 1603 1263.67 7730.23 389.355 KQK14071 474 183.872 94.5859 32.7414 ==> SRR7804215.se.tsv <== BRADI_1g14170v3 8200 BRADI_1g53295v3 89 BRADI_1g59795v3 631 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 82 BRADI_1g74790v3 236 BRADI_1g09890v3 0 BRADI_1g77505v3 249 BRADI_1g48960v3 0 SRR7804215 completed mapping pipeline successfully