Starting /dee2/code/volunteer_pipeline.sh SRR7804216 current disk space = 1540839268352 free memory = 1489977720 SRR7804216 SRAfilesize 769735eba5ad070d70b4aafead4c2669 SRR7804216.sra SRR7804216.sra file validated SRR7804216 is paired end SRR7804216 is conventional basespace SRR7804216 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804216_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.22675 37.0 37.0 37.0 37.0 37.0 2 36.323 37.0 37.0 37.0 37.0 37.0 3 36.3885 37.0 37.0 37.0 37.0 37.0 4 36.4575 37.0 37.0 37.0 37.0 37.0 5 36.546 37.0 37.0 37.0 37.0 37.0 6 36.538 37.0 37.0 37.0 37.0 37.0 7 36.3585 37.0 37.0 37.0 37.0 37.0 8 36.5495 37.0 37.0 37.0 37.0 37.0 9 36.4275 37.0 37.0 37.0 37.0 37.0 10-14 36.442499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.508900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.47429999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.37429999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.346000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3081 37.0 37.0 37.0 37.0 37.0 40-44 36.2709 37.0 37.0 37.0 37.0 37.0 45-49 36.2488 37.0 37.0 37.0 37.0 37.0 50-54 36.224399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1683 37.0 37.0 37.0 37.0 37.0 60-64 36.1514 37.0 37.0 37.0 37.0 37.0 65-69 36.114599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0209 37.0 37.0 37.0 37.0 37.0 75-79 36.0723 37.0 37.0 37.0 37.0 37.0 80-84 36.0314 37.0 37.0 37.0 37.0 37.0 85-89 35.9373 37.0 37.0 37.0 37.0 37.0 90-94 35.89489999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.80929999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.719899999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7891 37.0 37.0 37.0 37.0 37.0 110-114 35.7582 37.0 37.0 37.0 37.0 37.0 115-119 35.6451 37.0 37.0 37.0 37.0 37.0 120-124 35.5487 37.0 37.0 37.0 37.0 37.0 125-129 35.506899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4575 37.0 37.0 37.0 37.0 37.0 135-139 35.279999999999994 37.0 37.0 37.0 29.8 37.0 140-144 35.3095 37.0 37.0 37.0 32.2 37.0 145-149 35.0986 37.0 37.0 37.0 27.4 37.0 150-151 34.545 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 0.0 24 4.0 25 8.0 26 10.0 27 15.0 28 22.0 29 37.0 30 27.0 31 45.0 32 87.0 33 91.0 34 180.0 35 468.0 36 2760.0 37 243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.413680781758956 12.603357554497618 11.12503132047106 36.85793034327236 2 23.65 18.875 35.725 21.75 3 22.05 26.424999999999997 24.025 27.500000000000004 4 27.725 31.025000000000002 18.75 22.5 5 25.75 32.550000000000004 20.625 21.075 6 21.575 32.725 22.15 23.549999999999997 7 18.3 18.875 39.5 23.325000000000003 8 21.05 20.525 26.05 32.375 9 21.175 19.400000000000002 28.299999999999997 31.125000000000004 10-14 23.43 25.665 24.099999999999998 26.805 15-19 23.59 24.990000000000002 25.074999999999996 26.345000000000002 20-24 23.57 24.645 24.975 26.810000000000002 25-29 23.200000000000003 25.455 24.490000000000002 26.855 30-34 23.380000000000003 24.925 24.745 26.950000000000003 35-39 23.7 25.035 24.765 26.5 40-44 23.474999999999998 25.44 24.195 26.889999999999997 45-49 23.555 24.995 24.58 26.87 50-54 23.655 24.495 24.605 27.245 55-59 23.695 24.72 24.215 27.37 60-64 24.310000000000002 24.529999999999998 24.37 26.790000000000003 65-69 24.48 24.560000000000002 24.535 26.424999999999997 70-74 23.990000000000002 24.305 24.68 27.025 75-79 24.610000000000003 24.474999999999998 24.310000000000002 26.605 80-84 24.165 24.025 24.69 27.12 85-89 24.224999999999998 24.595 24.065 27.115000000000002 90-94 24.745 24.57 24.115000000000002 26.57 95-99 24.695 24.275 24.51 26.52 100-104 25.055 24.18 24.205 26.56 105-109 25.385 24.04 24.245 26.33 110-114 25.25 24.435000000000002 23.849999999999998 26.465 115-119 25.135 23.39 24.104999999999997 27.37 120-124 25.09 23.935000000000002 24.279999999999998 26.695 125-129 24.915000000000003 23.7 24.575 26.810000000000002 130-134 25.485000000000003 23.385 24.154999999999998 26.974999999999998 135-139 25.05 24.205 23.805 26.939999999999998 140-144 25.509999999999998 23.205000000000002 24.03 27.255000000000003 145-149 25.845000000000002 23.76 23.445 26.950000000000003 150-151 25.074999999999996 24.3875 23.45 27.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 2.5 27 3.5 28 2.5 29 5.0 30 8.0 31 9.0 32 12.0 33 15.0 34 19.0 35 27.5 36 42.0 37 66.0 38 80.5 39 89.0 40 110.0 41 122.0 42 145.0 43 167.0 44 175.5 45 185.0 46 186.0 47 180.0 48 186.0 49 183.0 50 157.5 51 139.5 52 124.5 53 110.0 54 99.0 55 90.5 56 92.0 57 92.0 58 82.0 59 76.0 60 77.0 61 83.5 62 87.5 63 68.0 64 57.0 65 71.5 66 72.5 67 73.0 68 63.0 69 48.0 70 43.5 71 36.0 72 29.0 73 26.5 74 24.5 75 17.5 76 9.0 77 4.5 78 7.0 79 5.5 80 0.5 81 2.0 82 3.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.52356020942409 91.225 2 4.293193717277487 8.200000000000001 3 0.15706806282722513 0.44999999999999996 4 0.0 0.0 5 0.026178010471204192 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGCGTCGGTGCACCCGAACATGGGAAGCTTCCACATTGTCCAGTACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.1375 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.5125000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTCGG 10 0.006830828 145.0 2 GGAAAGG 10 0.006830828 145.0 4 >>END_MODULE SRR7804216 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804216_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3865 37.0 37.0 37.0 37.0 37.0 2 36.0475 37.0 37.0 37.0 37.0 37.0 3 36.1025 37.0 37.0 37.0 37.0 37.0 4 36.2735 37.0 37.0 37.0 37.0 37.0 5 36.2965 37.0 37.0 37.0 37.0 37.0 6 36.1545 37.0 37.0 37.0 37.0 37.0 7 36.146 37.0 37.0 37.0 37.0 37.0 8 36.2895 37.0 37.0 37.0 37.0 37.0 9 36.2405 37.0 37.0 37.0 37.0 37.0 10-14 36.137600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.0808 37.0 37.0 37.0 37.0 37.0 20-24 36.0673 37.0 37.0 37.0 37.0 37.0 25-29 36.007 37.0 37.0 37.0 37.0 37.0 30-34 35.985 37.0 37.0 37.0 37.0 37.0 35-39 35.9225 37.0 37.0 37.0 37.0 37.0 40-44 35.876999999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.815999999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.7825 37.0 37.0 37.0 37.0 37.0 55-59 35.7883 37.0 37.0 37.0 37.0 37.0 60-64 35.6956 37.0 37.0 37.0 37.0 37.0 65-69 35.638799999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.6222 37.0 37.0 37.0 37.0 37.0 75-79 35.6045 37.0 37.0 37.0 37.0 37.0 80-84 35.50939999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.4226 37.0 37.0 37.0 37.0 37.0 90-94 35.288599999999995 37.0 37.0 37.0 32.2 37.0 95-99 35.2496 37.0 37.0 37.0 32.2 37.0 100-104 35.2278 37.0 37.0 37.0 29.8 37.0 105-109 35.2294 37.0 37.0 37.0 29.8 37.0 110-114 35.0714 37.0 37.0 37.0 25.0 37.0 115-119 34.9998 37.0 37.0 37.0 25.0 37.0 120-124 34.9345 37.0 37.0 37.0 25.0 37.0 125-129 34.829 37.0 37.0 37.0 25.0 37.0 130-134 34.7564 37.0 37.0 37.0 25.0 37.0 135-139 34.5759 37.0 37.0 37.0 25.0 37.0 140-144 34.38 37.0 37.0 37.0 25.0 37.0 145-149 34.2727 37.0 37.0 37.0 25.0 37.0 150-151 33.6305 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 5.0 16 0.0 17 2.0 18 3.0 19 2.0 20 2.0 21 5.0 22 10.0 23 7.0 24 12.0 25 12.0 26 10.0 27 14.0 28 22.0 29 24.0 30 34.0 31 67.0 32 93.0 33 162.0 34 306.0 35 830.0 36 2296.0 37 75.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.175 13.075000000000001 11.025 36.725 2 28.7 20.125 28.325 22.85 3 25.124999999999996 23.375 25.025 26.474999999999998 4 28.775000000000002 30.525000000000002 15.975 24.725 5 27.175 31.724999999999998 18.175 22.925 6 22.45 33.050000000000004 18.25 26.25 7 22.075 14.825 35.3 27.800000000000004 8 23.7 19.650000000000002 21.525 35.125 9 24.825 20.05 23.599999999999998 31.525 10-14 26.355 24.715 21.625 27.305 15-19 27.22 23.06 22.720000000000002 27.0 20-24 26.534999999999997 24.235 22.54 26.69 25-29 26.39 23.915 22.345000000000002 27.35 30-34 26.705000000000002 24.415 22.235 26.645000000000003 35-39 27.015 24.065 21.98 26.939999999999998 40-44 27.139999999999997 23.755000000000003 22.07 27.034999999999997 45-49 27.339999999999996 23.715 22.17 26.775 50-54 27.13 23.355 22.89 26.625 55-59 27.185 23.635 22.785 26.395000000000003 60-64 26.945000000000004 23.765 22.675 26.615 65-69 27.32 23.73 22.33 26.619999999999997 70-74 27.905 23.3 22.075 26.72 75-79 27.224999999999998 24.19 22.564999999999998 26.02 80-84 27.985 23.79 22.58 25.645 85-89 27.98 23.65 22.205 26.165 90-94 27.295 23.985 22.439999999999998 26.279999999999998 95-99 27.36 23.65 22.86 26.13 100-104 27.644999999999996 23.835 22.755 25.765 105-109 27.67 24.425 22.13 25.775 110-114 26.884999999999998 24.33 22.535 26.25 115-119 28.000000000000004 24.435000000000002 22.035 25.53 120-124 27.57 24.345 22.650000000000002 25.435000000000002 125-129 26.935 24.169999999999998 22.705000000000002 26.19 130-134 27.639999999999997 24.224999999999998 22.235 25.900000000000002 135-139 27.42 24.67 22.49 25.419999999999998 140-144 28.050000000000004 24.04 22.919999999999998 24.990000000000002 145-149 27.67 24.585 22.45 25.295 150-151 27.950000000000003 24.325 22.8625 24.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.5 26 1.5 27 1.5 28 3.0 29 3.0 30 7.0 31 7.5 32 7.0 33 13.5 34 14.5 35 20.5 36 30.5 37 35.0 38 45.0 39 57.5 40 79.0 41 94.5 42 111.5 43 136.5 44 141.0 45 144.5 46 142.5 47 145.0 48 151.0 49 132.5 50 123.0 51 121.5 52 119.5 53 114.5 54 107.5 55 107.0 56 98.0 57 99.5 58 112.5 59 111.5 60 104.5 61 108.5 62 111.0 63 106.5 64 103.5 65 97.5 66 82.5 67 77.5 68 80.0 69 81.0 70 76.5 71 67.0 72 58.0 73 46.5 74 37.5 75 25.5 76 22.0 77 20.0 78 13.5 79 8.5 80 3.0 81 3.5 82 5.0 83 2.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 1.5 94 1.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.32563025210085 90.75 2 4.359243697478991 8.3 3 0.2888655462184874 0.8250000000000001 4 0.0 0.0 5 0.026260504201680673 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCTATCTCCGCATCCGAAACACCAACCAAATCGCCGTTCCCTTCGACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.025 0.0 0.0 0.0 0.025 94-95 0.025 0.0 0.0 0.0 0.025 96-97 0.05 0.0 0.0 0.0 0.025 98-99 0.05 0.0 0.0 0.0 0.025 100-101 0.0875 0.0 0.0 0.0 0.025 102-103 0.125 0.0 0.0 0.0 0.025 104-105 0.125 0.0 0.0 0.0 0.025 106-107 0.1375 0.0 0.0 0.0 0.025 108-109 0.16249999999999998 0.0 0.0 0.0 0.025 110-111 0.2625 0.0 0.0 0.0 0.025 112-113 0.275 0.0 0.0 0.0 0.025 114-115 0.3 0.0 0.0 0.0 0.025 116-117 0.3125 0.0 0.0 0.0 0.025 118-119 0.4625 0.0 0.0 0.0 0.025 120-121 0.5625 0.0 0.0 0.0 0.025 122-123 0.6 0.0 0.0 0.0 0.025 124-125 0.625 0.0 0.0 0.0 0.025 126-127 0.6875 0.0 0.0 0.0 0.025 128-129 0.825 0.0 0.0 0.0 0.025 130-131 0.925 0.0 0.0 0.0 0.025 132-133 1.0499999999999998 0.0 0.0 0.0 0.037500000000000006 134-135 1.25 0.0 0.0 0.0 0.05 136-137 1.375 0.0 0.0 0.0 0.05 138-139 1.4874999999999998 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGAAGT 10 0.006830828 145.0 2 >>END_MODULE Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472215 spots for SRR7804216.sra Written 1472215 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra Read 1472197 spots for SRR7804216.sra Written 1472197 spots for SRR7804216.sra SRR ids: ['SRR7804216.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n9jg73s7 SRR7804216.sra spots: 29443958 blocks: [[1, 1472197], [1472198, 2944394], [2944395, 4416591], [4416592, 5888788], [5888789, 7360985], [7360986, 8833182], [8833183, 10305379], [10305380, 11777576], [11777577, 13249773], [13249774, 14721970], [14721971, 16194167], [16194168, 17666364], [17666365, 19138561], [19138562, 20610758], [20610759, 22082955], [22082956, 23555152], [23555153, 25027349], [25027350, 26499546], [26499547, 27971743], [27971744, 29443958]] SRR7804216 file size 9955890 SRR7804216 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804216 SRR7804216_1.fastq SRR7804216_2.fastq Input file: SRR7804216_1.fastq Paired file: SRR7804216_2.fastq trimmed: SRR7804216-trimmed-pair1.fastq, SRR7804216-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:16:02 2024 >> started Sat Dec 7 18:16:36 2024 >> done (33.825s) 29443958 read pairs processed; of these: 85 ( 0.00%) short read pairs filtered out after trimming by size control 888 ( 0.00%) empty read pairs filtered out after trimming by size control 29442985 (100.00%) read pairs available; of these: 740410 ( 2.51%) trimmed read pairs available after processing 28702575 (97.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 14 0.00% 20 19 0.00% 21 15 0.00% 22 30 0.00% 23 18 0.00% 24 24 0.00% 25 40 0.00% 26 28 0.00% 27 32 0.00% 28 39 0.00% 29 42 0.00% 30 44 0.00% 31 38 0.00% 32 40 0.00% 33 41 0.00% 34 31 0.00% 35 62 0.00% 36 49 0.00% 37 49 0.00% 38 68 0.00% 39 60 0.00% 40 61 0.00% 41 61 0.00% 42 62 0.00% 43 63 0.00% 44 62 0.00% 45 79 0.00% 46 87 0.00% 47 60 0.00% 48 80 0.00% 49 84 0.00% 50 80 0.00% 51 82 0.00% 52 95 0.00% 53 87 0.00% 54 111 0.00% 55 105 0.00% 56 99 0.00% 57 104 0.00% 58 86 0.00% 59 100 0.00% 60 119 0.00% 61 129 0.00% 62 135 0.00% 63 156 0.00% 64 130 0.00% 65 134 0.00% 66 155 0.00% 67 149 0.00% 68 156 0.00% 69 171 0.00% 70 180 0.00% 71 187 0.00% 72 230 0.00% 73 258 0.00% 74 227 0.00% 75 229 0.00% 76 275 0.00% 77 333 0.00% 78 307 0.00% 79 426 0.00% 80 391 0.00% 81 453 0.00% 82 523 0.00% 83 580 0.00% 84 596 0.00% 85 679 0.00% 86 722 0.00% 87 783 0.00% 88 831 0.00% 89 977 0.00% 90 1010 0.00% 91 1129 0.00% 92 1340 0.00% 93 1457 0.00% 94 1711 0.01% 95 1800 0.01% 96 1982 0.01% 97 2100 0.01% 98 2192 0.01% 99 2406 0.01% 100 2605 0.01% 101 2885 0.01% 102 3301 0.01% 103 3489 0.01% 104 3907 0.01% 105 4053 0.01% 106 4516 0.02% 107 4561 0.02% 108 4683 0.02% 109 5143 0.02% 110 5366 0.02% 111 5637 0.02% 112 6167 0.02% 113 6720 0.02% 114 6921 0.02% 115 7768 0.03% 116 8039 0.03% 117 8410 0.03% 118 8615 0.03% 119 9035 0.03% 120 9317 0.03% 121 9786 0.03% 122 10341 0.04% 123 11365 0.04% 124 11793 0.04% 125 12705 0.04% 126 13244 0.04% 127 13544 0.05% 128 13641 0.05% 129 14623 0.05% 130 14847 0.05% 131 15334 0.05% 132 16357 0.06% 133 16975 0.06% 134 18147 0.06% 135 19240 0.07% 136 19865 0.07% 137 20336 0.07% 138 20689 0.07% 139 21607 0.07% 140 22006 0.07% 141 22331 0.08% 142 23614 0.08% 143 24267 0.08% 144 26159 0.09% 145 26936 0.09% 146 28140 0.10% 147 29413 0.10% 148 29843 0.10% 149 30530 0.10% 150 31402 0.11% 151 28702575 97.49% 29442985 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=19 prefix-density=0.78 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.30 sequence-density-rank=16 fanout-score=9.58 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=2.5 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=22 prefix-density=0.58 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=19.35 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804216 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:17:37 Started mapping on | Dec 07 18:17:37 Finished on | Dec 07 18:21:23 Mapping speed, Million of reads per hour | 469.00 Number of input reads | 29442985 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 27787956 Uniquely mapped reads % | 94.38% Average mapped length | 300.04 Number of splices: Total | 27105494 Number of splices: Annotated (sjdb) | 25584185 Number of splices: GT/AG | 26768429 Number of splices: GC/AG | 284507 Number of splices: AT/AC | 15469 Number of splices: Non-canonical | 37089 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317797 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 22452 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1337232 1337232 1337232 N_multimapping 317797 317797 317797 N_noFeature 716567 27032880 959843 N_ambiguous 619246 3778 108239 UnstrandedReadsAssigned:26452143 PositiveStrandReadsAssigned:751298 NegativeStrandReadsAssigned:26719874 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804216 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804216-trimmed-pair1.fastq SRR7804216-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,442,985 reads, 26,985,852 reads pseudoaligned [quant] estimated average fragment length: 325.23 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,305 rounds 52973 SRR7804216.ke.tsv 35125 SRR7804216.se.tsv 88098 total ==> SRR7804216.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 612.875 0 0 PNS24247 1044 719.77 58.8768 3.81301 PNS24249 1928 1603.77 211.237 6.13968 PNS24246 1044 719.77 58.8768 3.81301 PNS24248 1044 719.77 58.8768 3.81301 PNS24244 1471 1146.77 76.1331 3.09468 PNS24243 293 71.278 0 0 KQK14069 1603 1278.77 6228.41 227.04 KQK14071 474 192.071 89.6176 21.7496 ==> SRR7804216.se.tsv <== BRADI_1g14170v3 6685 BRADI_1g53295v3 1277 BRADI_1g59795v3 511 BRADI_1g07683v3 0 BRADI_1g00485v3 67 BRADI_1g20270v3 2755 BRADI_1g74790v3 590 BRADI_1g09890v3 12 BRADI_1g77505v3 281 BRADI_1g48960v3 1 SRR7804216 completed mapping pipeline successfully