Starting /dee2/code/volunteer_pipeline.sh SRR7804217 current disk space = 1526175363072 free memory = 1556637900 SRR7804217 SRAfilesize ee3ad9a8c84d6a738d5058bc144bcb2d SRR7804217.sra SRR7804217.sra file validated SRR7804217 is paired end SRR7804217 is conventional basespace SRR7804217 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804217_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.143 37.0 37.0 37.0 37.0 37.0 2 36.3465 37.0 37.0 37.0 37.0 37.0 3 36.3745 37.0 37.0 37.0 37.0 37.0 4 36.526 37.0 37.0 37.0 37.0 37.0 5 36.474 37.0 37.0 37.0 37.0 37.0 6 36.449 37.0 37.0 37.0 37.0 37.0 7 36.388 37.0 37.0 37.0 37.0 37.0 8 36.514 37.0 37.0 37.0 37.0 37.0 9 36.526 37.0 37.0 37.0 37.0 37.0 10-14 36.5404 37.0 37.0 37.0 37.0 37.0 15-19 36.5069 37.0 37.0 37.0 37.0 37.0 20-24 36.495999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.387600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4021 37.0 37.0 37.0 37.0 37.0 35-39 36.3292 37.0 37.0 37.0 37.0 37.0 40-44 36.278099999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.2986 37.0 37.0 37.0 37.0 37.0 50-54 36.2479 37.0 37.0 37.0 37.0 37.0 55-59 36.2441 37.0 37.0 37.0 37.0 37.0 60-64 36.2524 37.0 37.0 37.0 37.0 37.0 65-69 36.192600000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0751 37.0 37.0 37.0 37.0 37.0 75-79 36.043099999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.065 37.0 37.0 37.0 37.0 37.0 85-89 35.9904 37.0 37.0 37.0 37.0 37.0 90-94 35.9391 37.0 37.0 37.0 37.0 37.0 95-99 35.8586 37.0 37.0 37.0 37.0 37.0 100-104 35.851 37.0 37.0 37.0 37.0 37.0 105-109 35.8113 37.0 37.0 37.0 37.0 37.0 110-114 35.8273 37.0 37.0 37.0 37.0 37.0 115-119 35.665200000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.5831 37.0 37.0 37.0 37.0 37.0 125-129 35.5778 37.0 37.0 37.0 37.0 37.0 130-134 35.541 37.0 37.0 37.0 37.0 37.0 135-139 35.325599999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.3572 37.0 37.0 37.0 32.2 37.0 145-149 35.2111 37.0 37.0 37.0 27.4 37.0 150-151 34.702 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 2.0 25 3.0 26 4.0 27 11.0 28 19.0 29 28.0 30 40.0 31 50.0 32 60.0 33 111.0 34 181.0 35 461.0 36 2783.0 37 243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.418546365914786 11.804511278195488 10.6265664160401 40.150375939849624 2 25.424999999999997 17.299999999999997 34.1 23.175 3 24.15 24.65 21.975 29.225 4 27.975 31.65 17.525 22.85 5 26.775 31.525 21.45 20.25 6 20.724999999999998 32.1 22.725 24.45 7 16.725 19.825 40.8 22.650000000000002 8 22.775000000000002 19.325 26.200000000000003 31.7 9 20.375 20.0 30.475 29.15 10-14 23.549999999999997 26.035000000000004 23.990000000000002 26.424999999999997 15-19 24.25 24.855 24.01 26.884999999999998 20-24 24.125 23.78 25.155 26.939999999999998 25-29 24.395 24.740000000000002 24.745 26.119999999999997 30-34 24.18 25.155 24.23 26.435 35-39 24.060000000000002 25.025 24.26 26.655 40-44 23.98 25.130000000000003 24.115000000000002 26.775 45-49 24.060000000000002 25.490000000000002 24.165 26.284999999999997 50-54 24.93 24.635 24.77 25.665 55-59 24.43 24.615000000000002 24.2 26.755000000000003 60-64 24.52 24.29 23.810000000000002 27.38 65-69 24.54 24.365000000000002 24.135 26.96 70-74 24.685000000000002 24.335 23.9 27.08 75-79 24.69 24.38 23.990000000000002 26.939999999999998 80-84 25.095 24.349999999999998 23.62 26.935 85-89 24.695 24.42 24.11 26.775 90-94 25.624999999999996 23.895 23.724999999999998 26.755000000000003 95-99 25.14 23.865 24.165 26.83 100-104 24.955 23.97 23.785 27.29 105-109 25.324999999999996 23.605 24.075 26.995 110-114 25.4 23.94 23.835 26.825 115-119 25.480000000000004 23.849999999999998 23.35 27.32 120-124 25.929999999999996 24.51 22.85 26.71 125-129 25.4 23.685000000000002 23.715 27.200000000000003 130-134 26.08 23.3 23.474999999999998 27.145000000000003 135-139 25.840000000000003 23.355 23.544999999999998 27.26 140-144 26.57 23.400000000000002 23.669999999999998 26.36 145-149 26.015 23.82 23.705000000000002 26.46 150-151 26.275 23.125 22.7625 27.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 2.5 28 3.5 29 6.0 30 9.0 31 8.5 32 11.0 33 21.5 34 32.0 35 37.0 36 37.5 37 52.0 38 78.0 39 95.0 40 101.5 41 129.0 42 151.0 43 141.5 44 157.0 45 179.0 46 179.5 47 179.5 48 171.5 49 157.5 50 127.0 51 114.0 52 124.0 53 117.0 54 107.0 55 96.5 56 93.5 57 101.0 58 97.0 59 88.0 60 84.5 61 82.0 62 84.0 63 86.0 64 81.0 65 81.5 66 71.5 67 64.0 68 67.0 69 57.0 70 48.5 71 40.0 72 36.5 73 32.0 74 19.5 75 13.0 76 13.5 77 11.5 78 8.0 79 4.0 80 2.0 81 2.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.07077803799116 92.30000000000001 2 3.8511579495186057 7.3999999999999995 3 0.052042674993494666 0.15 4 0.0 0.0 5 0.0 0.0 6 0.026021337496747333 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1375000000000002 0.0 0.0 0.0 0.0 134-135 1.2625000000000002 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138-139 1.5750000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804217 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804217_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.174 37.0 37.0 37.0 37.0 37.0 2 35.7335 37.0 37.0 37.0 37.0 37.0 3 35.889 37.0 37.0 37.0 37.0 37.0 4 36.069 37.0 37.0 37.0 37.0 37.0 5 36.1425 37.0 37.0 37.0 37.0 37.0 6 35.967 37.0 37.0 37.0 37.0 37.0 7 35.794 37.0 37.0 37.0 37.0 37.0 8 36.1565 37.0 37.0 37.0 37.0 37.0 9 36.1275 37.0 37.0 37.0 37.0 37.0 10-14 36.0345 37.0 37.0 37.0 37.0 37.0 15-19 36.0158 37.0 37.0 37.0 37.0 37.0 20-24 35.967 37.0 37.0 37.0 37.0 37.0 25-29 35.952799999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.9149 37.0 37.0 37.0 37.0 37.0 35-39 35.761199999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.7588 37.0 37.0 37.0 37.0 37.0 45-49 35.7008 37.0 37.0 37.0 37.0 37.0 50-54 35.6836 37.0 37.0 37.0 37.0 37.0 55-59 35.6551 37.0 37.0 37.0 37.0 37.0 60-64 35.5641 37.0 37.0 37.0 37.0 37.0 65-69 35.4278 37.0 37.0 37.0 37.0 37.0 70-74 35.4534 37.0 37.0 37.0 37.0 37.0 75-79 35.4074 37.0 37.0 37.0 37.0 37.0 80-84 35.2974 37.0 37.0 37.0 37.0 37.0 85-89 35.2701 37.0 37.0 37.0 32.2 37.0 90-94 35.2053 37.0 37.0 37.0 27.4 37.0 95-99 35.1096 37.0 37.0 37.0 25.0 37.0 100-104 35.0005 37.0 37.0 37.0 25.0 37.0 105-109 34.9692 37.0 37.0 37.0 25.0 37.0 110-114 34.7789 37.0 37.0 37.0 25.0 37.0 115-119 34.7476 37.0 37.0 37.0 25.0 37.0 120-124 34.642900000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.537400000000005 37.0 37.0 37.0 25.0 37.0 130-134 34.5232 37.0 37.0 37.0 25.0 37.0 135-139 34.320800000000006 37.0 37.0 37.0 25.0 37.0 140-144 34.0569 37.0 37.0 37.0 25.0 37.0 145-149 34.007600000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.292249999999996 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 1.0 17 2.0 18 0.0 19 0.0 20 3.0 21 2.0 22 4.0 23 1.0 24 15.0 25 13.0 26 10.0 27 26.0 28 23.0 29 42.0 30 64.0 31 72.0 32 113.0 33 207.0 34 384.0 35 1037.0 36 1939.0 37 39.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.699999999999996 11.899999999999999 12.2 40.2 2 27.900000000000002 17.275 32.35 22.475 3 24.3 22.025 27.625 26.05 4 28.000000000000004 29.775000000000002 16.950000000000003 25.275 5 29.349999999999998 30.625000000000004 17.4 22.625 6 21.775 34.2 18.0 26.025 7 21.875 14.825 36.625 26.674999999999997 8 22.925 18.925 21.825 36.325 9 24.65 20.825 25.174999999999997 29.349999999999998 10-14 26.479999999999997 23.825 22.245 27.450000000000003 15-19 26.525 23.875 22.835 26.765 20-24 25.669999999999998 23.880000000000003 22.845 27.605 25-29 26.540000000000003 23.655 22.15 27.655 30-34 26.495 23.880000000000003 22.735 26.889999999999997 35-39 26.900000000000002 23.45 21.905 27.744999999999997 40-44 27.005000000000003 23.885 22.38 26.729999999999997 45-49 27.125 23.215 22.615 27.045 50-54 27.474999999999998 22.770000000000003 22.675 27.08 55-59 27.22 23.625 22.37 26.784999999999997 60-64 27.29 23.35 22.314999999999998 27.045 65-69 26.974999999999998 23.255 22.95 26.82 70-74 26.834999999999997 23.29 22.455 27.42 75-79 26.55 23.45 23.06 26.939999999999998 80-84 27.639999999999997 23.57 22.08 26.71 85-89 27.465 22.685 22.63 27.22 90-94 26.619999999999997 23.685000000000002 23.06 26.634999999999998 95-99 27.155 23.44 22.795 26.61 100-104 26.740000000000002 23.275000000000002 22.84 27.145000000000003 105-109 26.515 23.474999999999998 22.7 27.310000000000002 110-114 27.32 23.044999999999998 23.31 26.325 115-119 26.91 23.51 22.625 26.955000000000002 120-124 27.07 23.990000000000002 22.96 25.979999999999997 125-129 27.82 23.835 22.29 26.055 130-134 28.060000000000002 23.335 22.54 26.064999999999998 135-139 28.22 23.93 22.685 25.165 140-144 28.18 24.215 22.16 25.445 145-149 27.595 24.310000000000002 22.46 25.635 150-151 27.6 23.599999999999998 22.7375 26.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 0.5 23 1.0 24 2.5 25 1.5 26 1.5 27 1.5 28 0.0 29 2.0 30 5.0 31 10.5 32 11.0 33 8.5 34 15.0 35 21.0 36 28.5 37 38.5 38 50.5 39 65.5 40 78.0 41 96.5 42 123.0 43 122.5 44 114.5 45 134.5 46 143.5 47 139.5 48 143.5 49 136.5 50 131.0 51 124.0 52 114.0 53 111.5 54 108.0 55 103.0 56 100.0 57 96.0 58 104.5 59 115.5 60 99.5 61 101.0 62 123.0 63 115.0 64 98.5 65 100.0 66 97.5 67 99.5 68 99.0 69 88.0 70 71.5 71 52.5 72 48.0 73 50.0 74 39.0 75 31.5 76 24.5 77 14.5 78 10.5 79 6.0 80 5.5 81 4.0 82 5.0 83 4.0 84 0.0 85 1.0 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.6544502617801 91.35 2 4.057591623036649 7.75 3 0.20942408376963353 0.6 4 0.07853403141361257 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.5375 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1375000000000002 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.3875 0.0 0.0 0.0 0.0 138-139 1.5499999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra Read 1607851 spots for SRR7804217.sra Written 1607851 spots for SRR7804217.sra Read 1607847 spots for SRR7804217.sra Written 1607847 spots for SRR7804217.sra SRR ids: ['SRR7804217.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9cxxaoc_ SRR7804217.sra spots: 32156944 blocks: [[1, 1607847], [1607848, 3215694], [3215695, 4823541], [4823542, 6431388], [6431389, 8039235], [8039236, 9647082], [9647083, 11254929], [11254930, 12862776], [12862777, 14470623], [14470624, 16078470], [16078471, 17686317], [17686318, 19294164], [19294165, 20902011], [20902012, 22509858], [22509859, 24117705], [24117706, 25725552], [25725553, 27333399], [27333400, 28941246], [28941247, 30549093], [30549094, 32156944]] SRR7804217 file size 10875232 SRR7804217 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804217 SRR7804217_1.fastq SRR7804217_2.fastq Input file: SRR7804217_1.fastq Paired file: SRR7804217_2.fastq trimmed: SRR7804217-trimmed-pair1.fastq, SRR7804217-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:13:42 2024 >> started Tue Dec 10 04:14:22 2024 >> done (40.761s) 32156944 read pairs processed; of these: 89 ( 0.00%) short read pairs filtered out after trimming by size control 770 ( 0.00%) empty read pairs filtered out after trimming by size control 32156085 (100.00%) read pairs available; of these: 950448 ( 2.96%) trimmed read pairs available after processing 31205637 (97.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 17 0.00% 20 14 0.00% 21 17 0.00% 22 18 0.00% 23 22 0.00% 24 18 0.00% 25 23 0.00% 26 23 0.00% 27 18 0.00% 28 38 0.00% 29 35 0.00% 30 32 0.00% 31 32 0.00% 32 40 0.00% 33 33 0.00% 34 28 0.00% 35 44 0.00% 36 35 0.00% 37 44 0.00% 38 67 0.00% 39 49 0.00% 40 57 0.00% 41 48 0.00% 42 49 0.00% 43 50 0.00% 44 48 0.00% 45 59 0.00% 46 60 0.00% 47 65 0.00% 48 68 0.00% 49 62 0.00% 50 56 0.00% 51 75 0.00% 52 67 0.00% 53 81 0.00% 54 82 0.00% 55 80 0.00% 56 82 0.00% 57 89 0.00% 58 90 0.00% 59 100 0.00% 60 100 0.00% 61 125 0.00% 62 117 0.00% 63 98 0.00% 64 112 0.00% 65 109 0.00% 66 143 0.00% 67 122 0.00% 68 144 0.00% 69 153 0.00% 70 162 0.00% 71 145 0.00% 72 205 0.00% 73 215 0.00% 74 221 0.00% 75 238 0.00% 76 257 0.00% 77 274 0.00% 78 322 0.00% 79 344 0.00% 80 428 0.00% 81 415 0.00% 82 498 0.00% 83 563 0.00% 84 681 0.00% 85 728 0.00% 86 803 0.00% 87 868 0.00% 88 1000 0.00% 89 1076 0.00% 90 1130 0.00% 91 1366 0.00% 92 1471 0.00% 93 1677 0.01% 94 1818 0.01% 95 2057 0.01% 96 2197 0.01% 97 2460 0.01% 98 2668 0.01% 99 2895 0.01% 100 3227 0.01% 101 3398 0.01% 102 3765 0.01% 103 4081 0.01% 104 4560 0.01% 105 4774 0.01% 106 5189 0.02% 107 5534 0.02% 108 6041 0.02% 109 6296 0.02% 110 6654 0.02% 111 6997 0.02% 112 7698 0.02% 113 8102 0.03% 114 8568 0.03% 115 9429 0.03% 116 9994 0.03% 117 10340 0.03% 118 10778 0.03% 119 11446 0.04% 120 11999 0.04% 121 12830 0.04% 122 13485 0.04% 123 14066 0.04% 124 14948 0.05% 125 15548 0.05% 126 16620 0.05% 127 17216 0.05% 128 17505 0.05% 129 18498 0.06% 130 19302 0.06% 131 20149 0.06% 132 21367 0.07% 133 22323 0.07% 134 23432 0.07% 135 24678 0.08% 136 26000 0.08% 137 25940 0.08% 138 27404 0.09% 139 28335 0.09% 140 29335 0.09% 141 30216 0.09% 142 31670 0.10% 143 32491 0.10% 144 34202 0.11% 145 35634 0.11% 146 36343 0.11% 147 38048 0.12% 148 39782 0.12% 149 40195 0.12% 150 41581 0.13% 151 31205637 97.04% 32156085 reads passed initial QC criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=17 prefix-density=1.14 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=153.84 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=9.5 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=11 prefix-density=0.87 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=12.88 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.0 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804217 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:15:15 Started mapping on | Dec 10 04:15:15 Finished on | Dec 10 04:19:56 Mapping speed, Million of reads per hour | 411.96 Number of input reads | 32156085 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30618263 Uniquely mapped reads % | 95.22% Average mapped length | 299.87 Number of splices: Total | 31340595 Number of splices: Annotated (sjdb) | 29527532 Number of splices: GT/AG | 30930824 Number of splices: GC/AG | 354171 Number of splices: AT/AC | 11995 Number of splices: Non-canonical | 43605 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329602 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 18844 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1208220 1208220 1208220 N_multimapping 329602 329602 329602 N_noFeature 875250 29746757 1127511 N_ambiguous 764896 4813 147008 UnstrandedReadsAssigned:28978117 PositiveStrandReadsAssigned:866693 NegativeStrandReadsAssigned:29343744 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804217 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804217-trimmed-pair1.fastq SRR7804217-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,156,085 reads, 29,557,625 reads pseudoaligned [quant] estimated average fragment length: 320.788 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR7804217.ke.tsv 35125 SRR7804217.se.tsv 88098 total ==> SRR7804217.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 617.203 0 0 PNS24247 1044 724.212 78.9239 4.54524 PNS24249 1928 1608.21 159.884 4.14644 PNS24246 1044 724.212 78.9239 4.54524 PNS24248 1044 724.212 78.9239 4.54524 PNS24244 1471 1151.21 72.3442 2.62097 PNS24243 293 74.4297 0 0 KQK14069 1603 1283.21 21689.8 704.969 KQK14071 474 195.513 374.646 79.9205 ==> SRR7804217.se.tsv <== BRADI_1g14170v3 23825 BRADI_1g53295v3 907 BRADI_1g59795v3 913 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 2377 BRADI_1g74790v3 1227 BRADI_1g09890v3 12 BRADI_1g77505v3 347 BRADI_1g48960v3 0 SRR7804217 completed mapping pipeline successfully