Starting /dee2/code/volunteer_pipeline.sh SRR7804218 current disk space = 1526194483200 free memory = 1467999208 SRR7804218 SRAfilesize 6acd50ef328819a1ffa7a06d2226e92c SRR7804218.sra SRR7804218.sra file validated SRR7804218 is paired end SRR7804218 is conventional basespace SRR7804218 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804218_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.08775 37.0 37.0 37.0 37.0 37.0 2 36.222 37.0 37.0 37.0 37.0 37.0 3 36.3985 37.0 37.0 37.0 37.0 37.0 4 36.491 37.0 37.0 37.0 37.0 37.0 5 36.485 37.0 37.0 37.0 37.0 37.0 6 36.474 37.0 37.0 37.0 37.0 37.0 7 36.3605 37.0 37.0 37.0 37.0 37.0 8 36.4435 37.0 37.0 37.0 37.0 37.0 9 36.4105 37.0 37.0 37.0 37.0 37.0 10-14 36.4994 37.0 37.0 37.0 37.0 37.0 15-19 36.4531 37.0 37.0 37.0 37.0 37.0 20-24 36.4778 37.0 37.0 37.0 37.0 37.0 25-29 36.39659999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3452 37.0 37.0 37.0 37.0 37.0 35-39 36.359899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.2969 37.0 37.0 37.0 37.0 37.0 45-49 36.2254 37.0 37.0 37.0 37.0 37.0 50-54 36.2091 37.0 37.0 37.0 37.0 37.0 55-59 36.1323 37.0 37.0 37.0 37.0 37.0 60-64 36.1725 37.0 37.0 37.0 37.0 37.0 65-69 36.134299999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.9891 37.0 37.0 37.0 37.0 37.0 75-79 36.0629 37.0 37.0 37.0 37.0 37.0 80-84 36.0269 37.0 37.0 37.0 37.0 37.0 85-89 35.9615 37.0 37.0 37.0 37.0 37.0 90-94 35.8528 37.0 37.0 37.0 37.0 37.0 95-99 35.7925 37.0 37.0 37.0 37.0 37.0 100-104 35.7901 37.0 37.0 37.0 37.0 37.0 105-109 35.761700000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6515 37.0 37.0 37.0 37.0 37.0 115-119 35.6207 37.0 37.0 37.0 37.0 37.0 120-124 35.5526 37.0 37.0 37.0 37.0 37.0 125-129 35.5588 37.0 37.0 37.0 37.0 37.0 130-134 35.347 37.0 37.0 37.0 37.0 37.0 135-139 35.3835 37.0 37.0 37.0 37.0 37.0 140-144 35.273399999999995 37.0 37.0 37.0 29.8 37.0 145-149 35.0296 37.0 37.0 37.0 25.0 37.0 150-151 34.461 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 4.0 26 5.0 27 15.0 28 11.0 29 31.0 30 51.0 31 49.0 32 76.0 33 141.0 34 196.0 35 466.0 36 2715.0 37 236.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.01984426023612 13.087164029138407 9.645817633760362 36.24717407686511 2 25.35 18.625 34.4 21.625 3 22.125 24.725 24.675 28.475 4 28.125 30.275000000000002 19.85 21.75 5 26.650000000000002 32.9 19.950000000000003 20.5 6 21.575 32.025 22.575 23.825 7 17.0 20.549999999999997 38.4 24.05 8 21.875 18.6 27.275 32.25 9 21.85 18.275 30.925000000000004 28.95 10-14 23.995 24.14 24.099999999999998 27.765 15-19 24.555 24.04 24.875 26.529999999999998 20-24 24.36 24.285 24.58 26.775 25-29 24.585 24.25 24.51 26.655 30-34 24.154999999999998 24.495 24.67 26.68 35-39 24.355 24.02 24.779999999999998 26.845000000000002 40-44 24.884999999999998 24.0 23.93 27.185 45-49 24.57 24.279999999999998 24.11 27.04 50-54 24.474999999999998 23.775 24.46 27.29 55-59 25.295 24.59 23.225 26.889999999999997 60-64 25.19 24.005000000000003 24.19 26.615 65-69 24.895 22.869999999999997 24.529999999999998 27.705000000000002 70-74 25.53 23.419999999999998 24.295 26.755000000000003 75-79 25.115 24.165 23.27 27.450000000000003 80-84 25.35 24.235 23.630000000000003 26.784999999999997 85-89 25.974999999999998 23.95 23.305 26.77 90-94 25.4 23.330000000000002 24.099999999999998 27.169999999999998 95-99 25.985000000000003 23.990000000000002 23.395 26.63 100-104 25.435000000000002 23.395 23.46 27.71 105-109 26.015 23.43 23.735 26.82 110-114 25.990000000000002 23.82 23.75 26.44 115-119 26.26 23.105 23.455000000000002 27.18 120-124 25.900000000000002 23.294999999999998 23.505000000000003 27.3 125-129 26.3 23.57 23.22 26.91 130-134 26.595000000000002 22.495 23.445 27.465 135-139 25.66 23.445 23.215 27.68 140-144 26.215 23.155 23.25 27.38 145-149 27.224999999999998 22.12 24.005000000000003 26.650000000000002 150-151 26.625 22.85 23.2375 27.287499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 0.5 25 0.0 26 1.0 27 1.5 28 2.5 29 4.5 30 7.0 31 10.5 32 15.0 33 20.5 34 25.0 35 32.0 36 42.0 37 59.0 38 77.5 39 89.0 40 100.5 41 119.5 42 136.0 43 149.5 44 151.0 45 153.5 46 152.5 47 154.0 48 171.0 49 164.0 50 149.5 51 125.0 52 112.0 53 109.5 54 95.5 55 99.5 56 112.0 57 96.0 58 84.5 59 94.0 60 94.5 61 85.5 62 79.5 63 79.0 64 82.0 65 98.0 66 89.0 67 68.0 68 61.0 69 60.0 70 60.0 71 47.0 72 35.0 73 28.5 74 24.0 75 21.5 76 17.0 77 14.0 78 10.5 79 10.0 80 8.5 81 4.0 82 2.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.375 #Duplication Level Percentage of deduplicated Percentage of total 1 95.59633027522936 91.175 2 3.984272608125819 7.6 3 0.39318479685452157 1.125 4 0.02621231979030144 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.21250000000000002 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.2625 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 0.9125000000000001 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138-139 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804218 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804218_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.385 37.0 37.0 37.0 37.0 37.0 2 35.993 37.0 37.0 37.0 37.0 37.0 3 36.139 37.0 37.0 37.0 37.0 37.0 4 36.21 37.0 37.0 37.0 37.0 37.0 5 36.25 37.0 37.0 37.0 37.0 37.0 6 36.1295 37.0 37.0 37.0 37.0 37.0 7 36.053 37.0 37.0 37.0 37.0 37.0 8 36.1435 37.0 37.0 37.0 37.0 37.0 9 36.198 37.0 37.0 37.0 37.0 37.0 10-14 36.132799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.0391 37.0 37.0 37.0 37.0 37.0 20-24 36.009 37.0 37.0 37.0 37.0 37.0 25-29 35.988 37.0 37.0 37.0 37.0 37.0 30-34 35.9119 37.0 37.0 37.0 37.0 37.0 35-39 35.8963 37.0 37.0 37.0 37.0 37.0 40-44 35.859 37.0 37.0 37.0 37.0 37.0 45-49 35.8024 37.0 37.0 37.0 37.0 37.0 50-54 35.7615 37.0 37.0 37.0 37.0 37.0 55-59 35.758500000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.654399999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.6168 37.0 37.0 37.0 37.0 37.0 70-74 35.546499999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.5637 37.0 37.0 37.0 37.0 37.0 80-84 35.4342 37.0 37.0 37.0 37.0 37.0 85-89 35.3968 37.0 37.0 37.0 37.0 37.0 90-94 35.3326 37.0 37.0 37.0 37.0 37.0 95-99 35.2174 37.0 37.0 37.0 29.8 37.0 100-104 35.080799999999996 37.0 37.0 37.0 27.4 37.0 105-109 35.1377 37.0 37.0 37.0 25.0 37.0 110-114 34.958299999999994 37.0 37.0 37.0 25.0 37.0 115-119 34.8938 37.0 37.0 37.0 25.0 37.0 120-124 34.8174 37.0 37.0 37.0 25.0 37.0 125-129 34.6588 37.0 37.0 37.0 25.0 37.0 130-134 34.5998 37.0 37.0 37.0 25.0 37.0 135-139 34.404999999999994 37.0 37.0 37.0 25.0 37.0 140-144 34.18670000000001 37.0 37.0 37.0 25.0 37.0 145-149 34.101200000000006 37.0 37.0 37.0 25.0 37.0 150-151 33.585 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 7.0 16 4.0 17 3.0 18 4.0 19 1.0 20 4.0 21 8.0 22 9.0 23 4.0 24 8.0 25 9.0 26 13.0 27 20.0 28 14.0 29 27.0 30 45.0 31 67.0 32 70.0 33 156.0 34 347.0 35 901.0 36 2189.0 37 84.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.075 12.65 10.8 36.475 2 29.849999999999998 18.7 27.474999999999998 23.974999999999998 3 25.45 22.025 26.450000000000003 26.075 4 28.799999999999997 29.275000000000002 16.35 25.575 5 28.549999999999997 31.125000000000004 17.575 22.75 6 22.475 33.925 17.974999999999998 25.624999999999996 7 22.7 14.825 33.6 28.875 8 22.775000000000002 18.7 21.349999999999998 37.175000000000004 9 23.375 20.150000000000002 24.224999999999998 32.25 10-14 26.135 24.115000000000002 21.65 28.1 15-19 26.490000000000002 23.585 22.195 27.73 20-24 26.705000000000002 23.61 22.43 27.255000000000003 25-29 27.310000000000002 23.724999999999998 21.945 27.02 30-34 26.924999999999997 24.055 21.67 27.35 35-39 26.8 24.085 21.975 27.139999999999997 40-44 27.650000000000002 23.65 21.73 26.97 45-49 27.115000000000002 23.56 22.215 27.11 50-54 27.365000000000002 23.86 21.565 27.21 55-59 27.72 23.43 21.834999999999997 27.015 60-64 26.995 23.605 21.735 27.665 65-69 27.139999999999997 23.794999999999998 22.21 26.855 70-74 27.0 23.075000000000003 22.27 27.655 75-79 26.88 23.43 21.795 27.894999999999996 80-84 26.834999999999997 23.305 22.54 27.32 85-89 27.584999999999997 22.74 22.12 27.555000000000003 90-94 27.93 23.65 21.705 26.715 95-99 27.534999999999997 23.799999999999997 21.990000000000002 26.674999999999997 100-104 27.715 23.16 22.07 27.055 105-109 27.279999999999998 23.06 22.085 27.575 110-114 27.694999999999997 23.355 22.075 26.875 115-119 27.445000000000004 22.915 22.470000000000002 27.169999999999998 120-124 27.815 23.325000000000003 21.595 27.265 125-129 27.994999999999997 23.31 21.995 26.700000000000003 130-134 28.060000000000002 22.955000000000002 22.720000000000002 26.265 135-139 27.644999999999996 23.915 22.165000000000003 26.275 140-144 27.794999999999998 23.605 22.205 26.395000000000003 145-149 28.455000000000002 23.685000000000002 22.165000000000003 25.695 150-151 28.012500000000003 24.25 22.125 25.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 1.0 22 1.0 23 1.0 24 0.5 25 2.0 26 2.0 27 0.0 28 1.5 29 1.5 30 2.0 31 3.5 32 6.0 33 7.5 34 12.5 35 27.0 36 34.5 37 40.5 38 49.0 39 63.5 40 81.0 41 86.0 42 99.0 43 121.5 44 135.0 45 137.0 46 124.0 47 123.0 48 124.5 49 132.0 50 141.0 51 124.0 52 115.0 53 113.0 54 102.0 55 91.5 56 95.0 57 97.5 58 93.5 59 103.5 60 110.5 61 116.0 62 123.5 63 108.0 64 113.5 65 114.5 66 97.0 67 97.0 68 85.5 69 80.5 70 85.0 71 81.5 72 68.0 73 58.5 74 50.5 75 35.5 76 24.5 77 16.5 78 11.0 79 5.5 80 4.0 81 3.5 82 2.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.21922873745378 90.125 2 4.226096143687269 8.0 3 0.369783412572636 1.05 4 0.07923930269413629 0.3 5 0.07923930269413629 0.375 6 0.02641310089804543 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGC 6 0.15 No Hit CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 5 0.125 No Hit CTGGTGCTACGCAACCGTCGCGCCCCGCGCTAAGAGCGTCGTCGTCGCCA 5 0.125 No Hit CTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.42500000000000004 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.75 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 0.9375 0.0 0.0 0.0 0.0 136-137 1.0875 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756938 spots for SRR7804218.sra Written 1756938 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra Read 1756934 spots for SRR7804218.sra Written 1756934 spots for SRR7804218.sra SRR ids: ['SRR7804218.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4dwkuqs6 SRR7804218.sra spots: 35138684 blocks: [[1, 1756934], [1756935, 3513868], [3513869, 5270802], [5270803, 7027736], [7027737, 8784670], [8784671, 10541604], [10541605, 12298538], [12298539, 14055472], [14055473, 15812406], [15812407, 17569340], [17569341, 19326274], [19326275, 21083208], [21083209, 22840142], [22840143, 24597076], [24597077, 26354010], [26354011, 28110944], [28110945, 29867878], [29867879, 31624812], [31624813, 33381746], [33381747, 35138684]] SRR7804218 file size 11885646 SRR7804218 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804218 SRR7804218_1.fastq SRR7804218_2.fastq Input file: SRR7804218_1.fastq Paired file: SRR7804218_2.fastq trimmed: SRR7804218-trimmed-pair1.fastq, SRR7804218-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:21:44 2024 >> started Tue Dec 10 04:22:32 2024 >> done (47.910s) 35138684 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 587 ( 0.00%) empty read pairs filtered out after trimming by size control 35137999 (100.00%) read pairs available; of these: 925510 ( 2.63%) trimmed read pairs available after processing 34212489 (97.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 20 0.00% 20 13 0.00% 21 20 0.00% 22 27 0.00% 23 25 0.00% 24 27 0.00% 25 29 0.00% 26 30 0.00% 27 45 0.00% 28 50 0.00% 29 48 0.00% 30 54 0.00% 31 53 0.00% 32 46 0.00% 33 64 0.00% 34 44 0.00% 35 74 0.00% 36 59 0.00% 37 65 0.00% 38 75 0.00% 39 64 0.00% 40 73 0.00% 41 79 0.00% 42 57 0.00% 43 85 0.00% 44 73 0.00% 45 79 0.00% 46 73 0.00% 47 72 0.00% 48 85 0.00% 49 86 0.00% 50 110 0.00% 51 89 0.00% 52 87 0.00% 53 108 0.00% 54 103 0.00% 55 133 0.00% 56 105 0.00% 57 147 0.00% 58 123 0.00% 59 119 0.00% 60 134 0.00% 61 133 0.00% 62 119 0.00% 63 152 0.00% 64 122 0.00% 65 141 0.00% 66 143 0.00% 67 157 0.00% 68 167 0.00% 69 165 0.00% 70 205 0.00% 71 195 0.00% 72 238 0.00% 73 274 0.00% 74 243 0.00% 75 293 0.00% 76 304 0.00% 77 307 0.00% 78 361 0.00% 79 371 0.00% 80 407 0.00% 81 458 0.00% 82 514 0.00% 83 639 0.00% 84 664 0.00% 85 778 0.00% 86 753 0.00% 87 828 0.00% 88 861 0.00% 89 1027 0.00% 90 1103 0.00% 91 1268 0.00% 92 1400 0.00% 93 1599 0.00% 94 1842 0.01% 95 2054 0.01% 96 2142 0.01% 97 2402 0.01% 98 2480 0.01% 99 2684 0.01% 100 2995 0.01% 101 3196 0.01% 102 3671 0.01% 103 4033 0.01% 104 4270 0.01% 105 4694 0.01% 106 5051 0.01% 107 5397 0.02% 108 5519 0.02% 109 6047 0.02% 110 6317 0.02% 111 6796 0.02% 112 7484 0.02% 113 7882 0.02% 114 8594 0.02% 115 9357 0.03% 116 9884 0.03% 117 10110 0.03% 118 10436 0.03% 119 11090 0.03% 120 11558 0.03% 121 12329 0.04% 122 12799 0.04% 123 14045 0.04% 124 14874 0.04% 125 15687 0.04% 126 16450 0.05% 127 17057 0.05% 128 17142 0.05% 129 18244 0.05% 130 18796 0.05% 131 19304 0.05% 132 20482 0.06% 133 21467 0.06% 134 23003 0.07% 135 24272 0.07% 136 25118 0.07% 137 25861 0.07% 138 26624 0.08% 139 27766 0.08% 140 27675 0.08% 141 29257 0.08% 142 30300 0.09% 143 31399 0.09% 144 32862 0.09% 145 35037 0.10% 146 35899 0.10% 147 37279 0.11% 148 38456 0.11% 149 38687 0.11% 150 39993 0.11% 151 34212489 97.37% 35137999 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=24 prefix-density=1.05 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=32 fanout-score=14.59 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=4.4 sequence=ACTTGCCGGGGACGAAGTTGGTGGC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=19 prefix-density=0.83 prefix-fanout=2.8 sequence=CCGCATCACCATGCGCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=31.88 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=AGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACC SRR7804218 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:24:05 Started mapping on | Dec 10 04:24:05 Finished on | Dec 10 04:30:09 Mapping speed, Million of reads per hour | 347.52 Number of input reads | 35137999 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 33267107 Uniquely mapped reads % | 94.68% Average mapped length | 299.97 Number of splices: Total | 31251285 Number of splices: Annotated (sjdb) | 29527375 Number of splices: GT/AG | 30856542 Number of splices: GC/AG | 335095 Number of splices: AT/AC | 13428 Number of splices: Non-canonical | 46220 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355528 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 30578 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1515364 1515364 1515364 N_multimapping 355528 355528 355528 N_noFeature 945923 32336464 1233011 N_ambiguous 808762 4724 166160 UnstrandedReadsAssigned:31512422 PositiveStrandReadsAssigned:925919 NegativeStrandReadsAssigned:31867936 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804218 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804218-trimmed-pair1.fastq SRR7804218-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,137,999 reads, 32,138,893 reads pseudoaligned [quant] estimated average fragment length: 326.298 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR7804218.ke.tsv 35125 SRR7804218.se.tsv 88098 total ==> SRR7804218.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 611.639 0 0 PNS24247 1044 718.702 74.6586 4.10744 PNS24249 1928 1602.7 218.784 5.39761 PNS24246 1044 718.702 74.6586 4.10744 PNS24248 1044 718.702 74.6586 4.10744 PNS24244 1471 1145.7 62.2405 2.14804 PNS24243 293 72.4255 0 0 KQK14069 1603 1277.7 9438.72 292.095 KQK14071 474 192.187 84.0676 17.2959 ==> SRR7804218.se.tsv <== BRADI_1g14170v3 9883 BRADI_1g53295v3 1354 BRADI_1g59795v3 752 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 1793 BRADI_1g74790v3 920 BRADI_1g09890v3 8 BRADI_1g77505v3 334 BRADI_1g48960v3 0 SRR7804218 completed mapping pipeline successfully