Starting /dee2/code/volunteer_pipeline.sh SRR7804219 current disk space = 1526246522880 free memory = 1559754600 SRR7804219 SRAfilesize 33fa623296ca651c6a5642706951f793 SRR7804219.sra SRR7804219.sra file validated SRR7804219 is paired end SRR7804219 is conventional basespace SRR7804219 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804219_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.262 37.0 37.0 37.0 37.0 37.0 2 36.2485 37.0 37.0 37.0 37.0 37.0 3 36.3885 37.0 37.0 37.0 37.0 37.0 4 36.5855 37.0 37.0 37.0 37.0 37.0 5 36.439 37.0 37.0 37.0 37.0 37.0 6 36.3985 37.0 37.0 37.0 37.0 37.0 7 36.3075 37.0 37.0 37.0 37.0 37.0 8 36.4355 37.0 37.0 37.0 37.0 37.0 9 36.472 37.0 37.0 37.0 37.0 37.0 10-14 36.499700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.4832 37.0 37.0 37.0 37.0 37.0 20-24 36.4659 37.0 37.0 37.0 37.0 37.0 25-29 36.4056 37.0 37.0 37.0 37.0 37.0 30-34 36.4238 37.0 37.0 37.0 37.0 37.0 35-39 36.3875 37.0 37.0 37.0 37.0 37.0 40-44 36.3177 37.0 37.0 37.0 37.0 37.0 45-49 36.3051 37.0 37.0 37.0 37.0 37.0 50-54 36.220600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.1988 37.0 37.0 37.0 37.0 37.0 60-64 36.2143 37.0 37.0 37.0 37.0 37.0 65-69 36.135600000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0487 37.0 37.0 37.0 37.0 37.0 75-79 36.055099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.087500000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.9858 37.0 37.0 37.0 37.0 37.0 90-94 35.9689 37.0 37.0 37.0 37.0 37.0 95-99 35.8622 37.0 37.0 37.0 37.0 37.0 100-104 35.813100000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.798500000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.797399999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6453 37.0 37.0 37.0 37.0 37.0 120-124 35.6154 37.0 37.0 37.0 37.0 37.0 125-129 35.5751 37.0 37.0 37.0 37.0 37.0 130-134 35.4096 37.0 37.0 37.0 37.0 37.0 135-139 35.344100000000005 37.0 37.0 37.0 32.2 37.0 140-144 35.3851 37.0 37.0 37.0 34.6 37.0 145-149 35.1017 37.0 37.0 37.0 27.4 37.0 150-151 34.539 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.0 25 5.0 26 9.0 27 7.0 28 23.0 29 24.0 30 47.0 31 41.0 32 71.0 33 104.0 34 171.0 35 465.0 36 2810.0 37 218.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.40460691036555 12.418627941912868 10.390585878818227 40.78617926890335 2 24.4 18.35 34.675 22.575 3 22.900000000000002 25.775 22.525000000000002 28.799999999999997 4 27.150000000000002 30.375000000000004 18.725 23.75 5 26.3 31.674999999999997 21.775 20.25 6 20.1 32.725 24.15 23.025000000000002 7 16.5 20.175 41.425 21.9 8 22.8 19.25 25.674999999999997 32.275 9 21.725 19.15 30.075000000000003 29.049999999999997 10-14 23.61 25.615 24.195 26.58 15-19 24.4 24.685000000000002 24.445 26.47 20-24 23.275000000000002 25.924999999999997 24.375 26.424999999999997 25-29 23.815 24.43 25.03 26.724999999999998 30-34 23.919999999999998 24.745 24.709999999999997 26.625 35-39 24.63 24.66 24.03 26.68 40-44 24.135 24.795 24.315 26.755000000000003 45-49 24.47 25.16 24.0 26.369999999999997 50-54 24.125 24.7 24.585 26.590000000000003 55-59 24.185000000000002 24.834999999999997 23.79 27.189999999999998 60-64 25.03 24.175 24.404999999999998 26.39 65-69 24.83 24.735 23.849999999999998 26.584999999999997 70-74 25.05 24.395 23.98 26.575 75-79 24.435000000000002 24.709999999999997 23.935000000000002 26.919999999999998 80-84 25.27 24.529999999999998 23.235 26.965 85-89 24.785 24.404999999999998 23.66 27.150000000000002 90-94 25.779999999999998 24.025 23.87 26.325 95-99 25.655 24.075 23.575 26.695 100-104 25.1 23.75 24.115000000000002 27.034999999999997 105-109 24.87 24.385 23.715 27.029999999999998 110-114 24.515 23.965 24.099999999999998 27.42 115-119 25.169999999999998 23.669999999999998 24.325 26.834999999999997 120-124 25.174999999999997 23.77 24.03 27.025 125-129 25.705 23.74 23.724999999999998 26.83 130-134 25.840000000000003 23.41 24.26 26.490000000000002 135-139 25.290000000000003 22.73 24.169999999999998 27.810000000000002 140-144 26.229999999999997 23.325000000000003 23.705000000000002 26.740000000000002 145-149 25.94 23.735 23.494999999999997 26.83 150-151 26.575 24.075 23.175 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 2.5 29 3.0 30 3.5 31 5.5 32 8.0 33 16.5 34 23.0 35 27.5 36 41.0 37 68.0 38 84.5 39 89.5 40 111.0 41 124.0 42 130.0 43 149.0 44 163.0 45 173.0 46 173.5 47 168.0 48 168.5 49 161.0 50 157.0 51 161.5 52 138.5 53 115.5 54 105.5 55 103.0 56 112.5 57 93.0 58 84.0 59 93.5 60 86.5 61 78.5 62 77.5 63 80.0 64 77.0 65 72.0 66 74.5 67 62.0 68 55.5 69 56.0 70 47.0 71 40.0 72 28.0 73 24.5 74 22.5 75 16.0 76 11.5 77 6.5 78 6.5 79 8.0 80 3.5 81 1.5 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.95300261096605 91.875 2 3.681462140992167 7.049999999999999 3 0.3394255874673629 0.975 4 0.02610966057441253 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0125 60-61 0.05 0.0 0.0 0.0 0.025 62-63 0.05 0.0 0.0 0.0 0.025 64-65 0.05 0.0 0.0 0.0 0.025 66-67 0.05 0.0 0.0 0.0 0.025 68-69 0.05 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.075 0.0 0.0 0.0 0.025 74-75 0.1 0.0 0.0 0.0 0.025 76-77 0.1 0.0 0.0 0.0 0.025 78-79 0.1 0.0 0.0 0.0 0.025 80-81 0.1 0.0 0.0 0.0 0.025 82-83 0.1 0.0 0.0 0.0 0.025 84-85 0.1 0.0 0.0 0.0 0.025 86-87 0.1 0.0 0.0 0.0 0.025 88-89 0.1 0.0 0.0 0.0 0.025 90-91 0.1 0.0 0.0 0.0 0.025 92-93 0.1 0.0 0.0 0.0 0.025 94-95 0.1 0.0 0.0 0.0 0.025 96-97 0.1125 0.0 0.0 0.0 0.025 98-99 0.1375 0.0 0.0 0.0 0.025 100-101 0.15 0.0 0.0 0.0 0.025 102-103 0.175 0.0 0.0 0.0 0.025 104-105 0.225 0.0 0.0 0.0 0.025 106-107 0.225 0.0 0.0 0.0 0.025 108-109 0.25 0.0 0.0 0.0 0.025 110-111 0.2625 0.0 0.0 0.0 0.025 112-113 0.3 0.0 0.0 0.0 0.025 114-115 0.3375 0.0 0.0 0.0 0.025 116-117 0.4375 0.0 0.0 0.0 0.025 118-119 0.525 0.0 0.0 0.0 0.025 120-121 0.5375000000000001 0.0 0.0 0.0 0.025 122-123 0.5625 0.0 0.0 0.0 0.025 124-125 0.675 0.0 0.0 0.0 0.025 126-127 0.775 0.0 0.0 0.0 0.025 128-129 0.8125 0.0 0.0 0.0 0.025 130-131 0.9375 0.0 0.0 0.0 0.025 132-133 1.0375 0.0 0.0 0.0 0.025 134-135 1.0625 0.0 0.0 0.0 0.025 136-137 1.1 0.0 0.0 0.0 0.025 138-139 1.225 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATTA 10 0.006830828 145.0 9 CATCTCC 10 0.006830828 145.0 9 TTTTTTT 45 0.008957279 48.333332 1 >>END_MODULE SRR7804219 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804219_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2055 37.0 37.0 37.0 37.0 37.0 2 35.9675 37.0 37.0 37.0 37.0 37.0 3 36.1525 37.0 37.0 37.0 37.0 37.0 4 36.202 37.0 37.0 37.0 37.0 37.0 5 36.143 37.0 37.0 37.0 37.0 37.0 6 36.1545 37.0 37.0 37.0 37.0 37.0 7 36.069 37.0 37.0 37.0 37.0 37.0 8 36.2485 37.0 37.0 37.0 37.0 37.0 9 36.1765 37.0 37.0 37.0 37.0 37.0 10-14 36.1755 37.0 37.0 37.0 37.0 37.0 15-19 36.0267 37.0 37.0 37.0 37.0 37.0 20-24 35.9972 37.0 37.0 37.0 37.0 37.0 25-29 35.9876 37.0 37.0 37.0 37.0 37.0 30-34 35.932399999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.786500000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.811 37.0 37.0 37.0 37.0 37.0 45-49 35.738099999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.7549 37.0 37.0 37.0 37.0 37.0 55-59 35.6914 37.0 37.0 37.0 37.0 37.0 60-64 35.5398 37.0 37.0 37.0 37.0 37.0 65-69 35.5743 37.0 37.0 37.0 37.0 37.0 70-74 35.5535 37.0 37.0 37.0 37.0 37.0 75-79 35.4842 37.0 37.0 37.0 37.0 37.0 80-84 35.427800000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.263200000000005 37.0 37.0 37.0 32.2 37.0 90-94 35.250800000000005 37.0 37.0 37.0 34.6 37.0 95-99 35.166 37.0 37.0 37.0 27.4 37.0 100-104 35.107600000000005 37.0 37.0 37.0 27.4 37.0 105-109 35.0432 37.0 37.0 37.0 25.0 37.0 110-114 34.909800000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.815 37.0 37.0 37.0 25.0 37.0 120-124 34.791000000000004 37.0 37.0 37.0 25.0 37.0 125-129 34.6448 37.0 37.0 37.0 25.0 37.0 130-134 34.653 37.0 37.0 37.0 25.0 37.0 135-139 34.344899999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.1283 37.0 37.0 37.0 25.0 37.0 145-149 34.1286 37.0 37.0 37.0 25.0 37.0 150-151 33.3515 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 0.0 16 2.0 17 1.0 18 4.0 19 1.0 20 4.0 21 5.0 22 10.0 23 10.0 24 12.0 25 15.0 26 17.0 27 17.0 28 28.0 29 35.0 30 26.0 31 52.0 32 97.0 33 178.0 34 379.0 35 860.0 36 2172.0 37 68.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.475 11.05 12.075 41.4 2 29.4 16.2 31.674999999999997 22.725 3 25.474999999999998 20.65 26.700000000000003 27.175 4 28.999999999999996 27.975 17.1 25.924999999999997 5 29.549999999999997 30.075000000000003 18.825 21.55 6 21.075 32.95 18.8 27.175 7 23.225 14.924999999999999 34.300000000000004 27.55 8 24.099999999999998 19.15 21.025 35.725 9 22.875 21.125 23.825 32.175 10-14 26.775 23.405 21.955 27.865000000000002 15-19 26.669999999999998 23.45 22.375 27.505000000000003 20-24 26.035000000000004 23.82 22.11 28.035 25-29 27.375 23.494999999999997 22.31 26.82 30-34 26.82 23.435 22.45 27.295 35-39 26.765 23.095 22.37 27.77 40-44 27.555000000000003 23.455000000000002 21.595 27.395000000000003 45-49 27.22 23.22 22.075 27.485 50-54 27.389999999999997 23.799999999999997 22.220000000000002 26.590000000000003 55-59 27.334999999999997 23.31 21.985 27.37 60-64 27.055 23.77 22.32 26.855 65-69 27.115000000000002 23.965 22.075 26.845000000000002 70-74 27.83 23.105 22.040000000000003 27.025 75-79 27.279999999999998 22.925 22.535 27.26 80-84 27.76 23.525 22.05 26.665 85-89 27.405 23.375 21.905 27.315 90-94 27.315 23.465 22.06 27.16 95-99 28.175 22.7 22.55 26.575 100-104 27.474999999999998 23.169999999999998 22.48 26.875 105-109 27.57 23.005 22.884999999999998 26.540000000000003 110-114 27.584999999999997 23.915 22.220000000000002 26.279999999999998 115-119 27.27 23.23 22.55 26.950000000000003 120-124 27.24 23.415 22.79 26.555 125-129 27.465 24.13 22.12 26.284999999999997 130-134 28.000000000000004 23.875 22.675 25.45 135-139 27.66 24.295 22.25 25.795 140-144 28.08 23.47 22.845 25.605 145-149 27.76 24.075 22.23 25.935000000000002 150-151 27.625 24.099999999999998 22.7125 25.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 0.5 26 1.5 27 1.5 28 0.0 29 1.0 30 3.5 31 6.5 32 8.5 33 12.0 34 15.5 35 17.5 36 24.0 37 33.5 38 44.0 39 65.0 40 94.5 41 105.5 42 103.5 43 108.0 44 115.0 45 132.0 46 137.0 47 137.0 48 144.5 49 141.0 50 134.0 51 130.5 52 124.0 53 108.0 54 96.5 55 99.0 56 94.0 57 85.0 58 97.0 59 110.0 60 104.5 61 98.5 62 110.5 63 110.5 64 104.5 65 105.5 66 102.0 67 92.0 68 86.0 69 80.0 70 72.0 71 73.5 72 70.0 73 58.0 74 50.0 75 42.5 76 30.5 77 22.0 78 14.5 79 7.0 80 4.5 81 5.0 82 3.0 83 1.5 84 0.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 1.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.7251507998951 91.25 2 3.8027799632835038 7.249999999999999 3 0.3933910306845004 1.125 4 0.026226068712300026 0.1 5 0.026226068712300026 0.125 6 0.026226068712300026 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.025 0.0 0.0 0.0 0.025 34-35 0.025 0.0 0.0 0.0 0.025 36-37 0.025 0.0 0.0 0.0 0.025 38-39 0.025 0.0 0.0 0.0 0.025 40-41 0.025 0.0 0.0 0.0 0.025 42-43 0.025 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.037500000000000006 0.0 0.0 0.0 0.025 58-59 0.05 0.0 0.0 0.0 0.025 60-61 0.05 0.0 0.0 0.0 0.025 62-63 0.05 0.0 0.0 0.0 0.025 64-65 0.05 0.0 0.0 0.0 0.025 66-67 0.05 0.0 0.0 0.0 0.025 68-69 0.05 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.075 0.0 0.0 0.0 0.025 76-77 0.075 0.0 0.0 0.0 0.025 78-79 0.075 0.0 0.0 0.0 0.025 80-81 0.075 0.0 0.0 0.0 0.05 82-83 0.075 0.0 0.0 0.0 0.05 84-85 0.075 0.0 0.0 0.0 0.05 86-87 0.075 0.0 0.0 0.0 0.05 88-89 0.075 0.0 0.0 0.0 0.05 90-91 0.075 0.0 0.0 0.0 0.05 92-93 0.075 0.0 0.0 0.0 0.05 94-95 0.1 0.0 0.0 0.0 0.05 96-97 0.1125 0.0 0.0 0.0 0.05 98-99 0.1375 0.0 0.0 0.0 0.05 100-101 0.15 0.0 0.0 0.0 0.05 102-103 0.175 0.0 0.0 0.0 0.05 104-105 0.225 0.0 0.0 0.0 0.05 106-107 0.225 0.0 0.0 0.0 0.05 108-109 0.25 0.0 0.0 0.0 0.05 110-111 0.2625 0.0 0.0 0.0 0.05 112-113 0.3 0.0 0.0 0.0 0.05 114-115 0.3375 0.0 0.0 0.0 0.05 116-117 0.425 0.0 0.0 0.0 0.05 118-119 0.5 0.0 0.0 0.0 0.05 120-121 0.5125 0.0 0.0 0.0 0.05 122-123 0.5375000000000001 0.0 0.0 0.0 0.05 124-125 0.65 0.0 0.0 0.0 0.05 126-127 0.75 0.0 0.0 0.0 0.05 128-129 0.7875 0.0 0.0 0.0 0.05 130-131 0.9375 0.0 0.0 0.0 0.05 132-133 1.0375 0.0 0.0 0.0 0.05 134-135 1.0625 0.0 0.0 0.0 0.05 136-137 1.1 0.0 0.0 0.0 0.05 138-139 1.225 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392564 spots for SRR7804219.sra Written 1392564 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra Read 1392546 spots for SRR7804219.sra Written 1392546 spots for SRR7804219.sra SRR ids: ['SRR7804219.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g_7t629z SRR7804219.sra spots: 27850938 blocks: [[1, 1392546], [1392547, 2785092], [2785093, 4177638], [4177639, 5570184], [5570185, 6962730], [6962731, 8355276], [8355277, 9747822], [9747823, 11140368], [11140369, 12532914], [12532915, 13925460], [13925461, 15318006], [15318007, 16710552], [16710553, 18103098], [18103099, 19495644], [19495645, 20888190], [20888191, 22280736], [22280737, 23673282], [23673283, 25065828], [25065829, 26458374], [26458375, 27850938]] SRR7804219 file size 9416068 SRR7804219 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804219 SRR7804219_1.fastq SRR7804219_2.fastq Input file: SRR7804219_1.fastq Paired file: SRR7804219_2.fastq trimmed: SRR7804219-trimmed-pair1.fastq, SRR7804219-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 04:18:27 2024 >> started Tue Dec 10 04:18:55 2024 >> done (28.685s) 27850938 read pairs processed; of these: 68 ( 0.00%) short read pairs filtered out after trimming by size control 503 ( 0.00%) empty read pairs filtered out after trimming by size control 27850367 (100.00%) read pairs available; of these: 670892 ( 2.41%) trimmed read pairs available after processing 27179475 (97.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 14 0.00% 20 11 0.00% 21 13 0.00% 22 22 0.00% 23 25 0.00% 24 19 0.00% 25 21 0.00% 26 22 0.00% 27 35 0.00% 28 45 0.00% 29 32 0.00% 30 28 0.00% 31 45 0.00% 32 75 0.00% 33 47 0.00% 34 55 0.00% 35 67 0.00% 36 66 0.00% 37 70 0.00% 38 58 0.00% 39 71 0.00% 40 52 0.00% 41 53 0.00% 42 55 0.00% 43 64 0.00% 44 68 0.00% 45 77 0.00% 46 77 0.00% 47 70 0.00% 48 77 0.00% 49 82 0.00% 50 73 0.00% 51 67 0.00% 52 87 0.00% 53 92 0.00% 54 105 0.00% 55 95 0.00% 56 98 0.00% 57 92 0.00% 58 93 0.00% 59 102 0.00% 60 107 0.00% 61 140 0.00% 62 110 0.00% 63 120 0.00% 64 122 0.00% 65 141 0.00% 66 147 0.00% 67 162 0.00% 68 150 0.00% 69 169 0.00% 70 167 0.00% 71 189 0.00% 72 224 0.00% 73 237 0.00% 74 246 0.00% 75 219 0.00% 76 275 0.00% 77 325 0.00% 78 353 0.00% 79 351 0.00% 80 354 0.00% 81 376 0.00% 82 482 0.00% 83 548 0.00% 84 588 0.00% 85 639 0.00% 86 679 0.00% 87 805 0.00% 88 833 0.00% 89 982 0.00% 90 986 0.00% 91 1204 0.00% 92 1334 0.00% 93 1424 0.01% 94 1564 0.01% 95 1709 0.01% 96 1931 0.01% 97 2041 0.01% 98 2192 0.01% 99 2293 0.01% 100 2566 0.01% 101 2788 0.01% 102 3031 0.01% 103 3249 0.01% 104 3426 0.01% 105 4007 0.01% 106 4161 0.01% 107 4277 0.02% 108 4468 0.02% 109 4997 0.02% 110 5107 0.02% 111 5544 0.02% 112 5792 0.02% 113 6130 0.02% 114 6758 0.02% 115 6966 0.03% 116 7460 0.03% 117 7651 0.03% 118 7965 0.03% 119 8463 0.03% 120 8791 0.03% 121 9000 0.03% 122 9703 0.03% 123 10175 0.04% 124 10907 0.04% 125 11319 0.04% 126 11726 0.04% 127 12250 0.04% 128 12654 0.05% 129 13185 0.05% 130 13518 0.05% 131 14323 0.05% 132 14996 0.05% 133 15386 0.06% 134 16244 0.06% 135 17255 0.06% 136 17635 0.06% 137 18122 0.07% 138 18772 0.07% 139 19432 0.07% 140 19834 0.07% 141 20472 0.07% 142 21379 0.08% 143 21803 0.08% 144 22943 0.08% 145 24101 0.09% 146 24379 0.09% 147 25239 0.09% 148 26451 0.09% 149 26758 0.10% 150 27994 0.10% 151 27179475 97.59% 27850367 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=19 prefix-density=0.89 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=143.15 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=9.9 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=14 prefix-density=0.75 prefix-fanout=2.8 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=21.76 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804219 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 04:19:59 Started mapping on | Dec 10 04:20:00 Finished on | Dec 10 04:24:09 Mapping speed, Million of reads per hour | 402.66 Number of input reads | 27850367 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 26158722 Uniquely mapped reads % | 93.93% Average mapped length | 300.04 Number of splices: Total | 26796149 Number of splices: Annotated (sjdb) | 25256764 Number of splices: GT/AG | 26441064 Number of splices: GC/AG | 304336 Number of splices: AT/AC | 12602 Number of splices: Non-canonical | 38147 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351784 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 30428 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.78% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1339861 1339861 1339861 N_multimapping 351784 351784 351784 N_noFeature 747721 25449973 938153 N_ambiguous 643677 4398 125856 UnstrandedReadsAssigned:24767324 PositiveStrandReadsAssigned:704351 NegativeStrandReadsAssigned:25094713 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804219 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804219-trimmed-pair1.fastq SRR7804219-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,850,367 reads, 25,346,308 reads pseudoaligned [quant] estimated average fragment length: 332.153 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52973 SRR7804219.ke.tsv 35125 SRR7804219.se.tsv 88098 total ==> SRR7804219.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 605.779 0 0 PNS24247 1044 712.847 60.5883 4.08167 PNS24249 1928 1596.85 195.315 5.87376 PNS24246 1044 712.847 60.5883 4.08167 PNS24248 1044 712.847 60.5883 4.08167 PNS24244 1471 1139.85 77.9204 3.28284 PNS24243 293 69.6164 0 0 KQK14069 1603 1271.85 15662.2 591.374 KQK14071 474 186.223 221.678 57.1656 ==> SRR7804219.se.tsv <== BRADI_1g14170v3 17275 BRADI_1g53295v3 33 BRADI_1g59795v3 848 BRADI_1g07683v3 0 BRADI_1g00485v3 55 BRADI_1g20270v3 2219 BRADI_1g74790v3 644 BRADI_1g09890v3 4 BRADI_1g77505v3 323 BRADI_1g48960v3 0 SRR7804219 completed mapping pipeline successfully