Starting /dee2/code/volunteer_pipeline.sh SRR7804220 current disk space = 1540755931136 free memory = 1601307328 SRR7804220 SRAfilesize 92034e6cbdae2d38cafec6e9284c1d86 SRR7804220.sra SRR7804220.sra file validated SRR7804220 is paired end SRR7804220 is conventional basespace SRR7804220 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804220_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.237 37.0 37.0 37.0 37.0 37.0 2 36.211 37.0 37.0 37.0 37.0 37.0 3 36.305 37.0 37.0 37.0 37.0 37.0 4 36.4665 37.0 37.0 37.0 37.0 37.0 5 36.496 37.0 37.0 37.0 37.0 37.0 6 36.545 37.0 37.0 37.0 37.0 37.0 7 36.3375 37.0 37.0 37.0 37.0 37.0 8 36.5005 37.0 37.0 37.0 37.0 37.0 9 36.445 37.0 37.0 37.0 37.0 37.0 10-14 36.5163 37.0 37.0 37.0 37.0 37.0 15-19 36.4884 37.0 37.0 37.0 37.0 37.0 20-24 36.4822 37.0 37.0 37.0 37.0 37.0 25-29 36.3891 37.0 37.0 37.0 37.0 37.0 30-34 36.406400000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.3643 37.0 37.0 37.0 37.0 37.0 40-44 36.287099999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.2678 37.0 37.0 37.0 37.0 37.0 50-54 36.2369 37.0 37.0 37.0 37.0 37.0 55-59 36.13439999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.1592 37.0 37.0 37.0 37.0 37.0 65-69 36.174 37.0 37.0 37.0 37.0 37.0 70-74 36.116499999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.053000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0266 37.0 37.0 37.0 37.0 37.0 85-89 36.0373 37.0 37.0 37.0 37.0 37.0 90-94 35.8955 37.0 37.0 37.0 37.0 37.0 95-99 35.7644 37.0 37.0 37.0 37.0 37.0 100-104 35.796200000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.756099999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7532 37.0 37.0 37.0 37.0 37.0 115-119 35.6795 37.0 37.0 37.0 37.0 37.0 120-124 35.574200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.5864 37.0 37.0 37.0 37.0 37.0 130-134 35.4319 37.0 37.0 37.0 37.0 37.0 135-139 35.2275 37.0 37.0 37.0 32.2 37.0 140-144 35.2217 37.0 37.0 37.0 29.8 37.0 145-149 35.0664 37.0 37.0 37.0 25.0 37.0 150-151 34.57025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 0.0 24 6.0 25 5.0 26 6.0 27 18.0 28 18.0 29 23.0 30 43.0 31 30.0 32 91.0 33 124.0 34 175.0 35 462.0 36 2711.0 37 284.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.80971457185778 11.56735102653981 11.116675012518778 37.506259389083624 2 26.75 16.55 32.475 24.224999999999998 3 24.25 22.125 23.150000000000002 30.475 4 29.075 28.249999999999996 19.2 23.474999999999998 5 27.975 29.599999999999998 22.0 20.424999999999997 6 21.875 31.15 23.974999999999998 23.0 7 18.2 20.349999999999998 40.125 21.325 8 21.2 19.525000000000002 26.224999999999998 33.050000000000004 9 20.474999999999998 19.325 32.824999999999996 27.375 10-14 24.465 25.264999999999997 24.665 25.605 15-19 24.255 23.97 24.785 26.99 20-24 24.125 24.325 24.82 26.729999999999997 25-29 24.03 24.015 25.145 26.810000000000002 30-34 24.51 23.785 24.41 27.295 35-39 24.63 24.02 24.365000000000002 26.985 40-44 24.505 23.794999999999998 24.75 26.950000000000003 45-49 25.03 23.905 24.595 26.47 50-54 24.505 24.325 23.915 27.255000000000003 55-59 24.33 23.57 24.735 27.365000000000002 60-64 25.095 23.325000000000003 24.125 27.455000000000002 65-69 24.709999999999997 23.115 24.855 27.32 70-74 25.040000000000003 23.695 23.52 27.744999999999997 75-79 25.424999999999997 23.695 24.044999999999998 26.834999999999997 80-84 25.7 23.369999999999997 23.95 26.979999999999997 85-89 24.98 23.505000000000003 23.785 27.73 90-94 25.52 22.71 24.41 27.36 95-99 25.405 23.13 23.745 27.72 100-104 25.655 23.49 23.035 27.82 105-109 26.174999999999997 23.06 23.330000000000002 27.435 110-114 25.915 23.705000000000002 23.45 26.93 115-119 25.805 22.705000000000002 23.185 28.305000000000003 120-124 26.424999999999997 22.535 23.115 27.925 125-129 26.39 22.825 23.669999999999998 27.115000000000002 130-134 26.22 22.43 23.79 27.560000000000002 135-139 26.08 22.66 23.79 27.47 140-144 26.445 22.6 23.265 27.689999999999998 145-149 27.02 22.685 23.31 26.985 150-151 26.8625 21.55 23.875 27.712500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 4.5 29 6.5 30 9.0 31 10.5 32 12.5 33 17.5 34 30.5 35 41.5 36 46.0 37 51.0 38 64.5 39 75.0 40 91.5 41 113.5 42 125.0 43 127.0 44 135.5 45 141.0 46 142.0 47 142.0 48 146.0 49 147.5 50 132.5 51 133.5 52 132.0 53 134.5 54 138.5 55 130.0 56 121.5 57 123.5 58 128.5 59 123.0 60 106.0 61 95.0 62 85.5 63 72.0 64 73.5 65 73.0 66 64.0 67 59.5 68 65.0 69 68.0 70 56.5 71 40.5 72 30.5 73 28.0 74 26.5 75 20.0 76 11.5 77 8.0 78 7.0 79 7.0 80 5.5 81 2.0 82 1.5 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.25 #Duplication Level Percentage of deduplicated Percentage of total 1 93.67292225201072 87.35000000000001 2 5.495978552278821 10.25 3 0.7774798927613941 2.175 4 0.026809651474530835 0.1 5 0.026809651474530835 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.38749999999999996 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.5499999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTCTC 10 0.006830828 145.0 2 AGACTTC 10 0.006830828 145.0 3 TAGACTT 10 0.006830828 145.0 2 >>END_MODULE SRR7804220 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804220_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1895 37.0 37.0 37.0 37.0 37.0 2 35.857 37.0 37.0 37.0 37.0 37.0 3 35.9465 37.0 37.0 37.0 37.0 37.0 4 36.049 37.0 37.0 37.0 37.0 37.0 5 35.969 37.0 37.0 37.0 37.0 37.0 6 35.8005 37.0 37.0 37.0 37.0 37.0 7 35.746 37.0 37.0 37.0 37.0 37.0 8 36.0365 37.0 37.0 37.0 37.0 37.0 9 36.098 37.0 37.0 37.0 37.0 37.0 10-14 35.9667 37.0 37.0 37.0 37.0 37.0 15-19 35.84060000000001 37.0 37.0 37.0 37.0 37.0 20-24 35.8486 37.0 37.0 37.0 37.0 37.0 25-29 35.7582 37.0 37.0 37.0 37.0 37.0 30-34 35.792500000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.6272 37.0 37.0 37.0 37.0 37.0 40-44 35.61619999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.5707 37.0 37.0 37.0 37.0 37.0 50-54 35.5334 37.0 37.0 37.0 37.0 37.0 55-59 35.5406 37.0 37.0 37.0 37.0 37.0 60-64 35.369499999999995 37.0 37.0 37.0 34.6 37.0 65-69 35.3968 37.0 37.0 37.0 37.0 37.0 70-74 35.4107 37.0 37.0 37.0 37.0 37.0 75-79 35.30669999999999 37.0 37.0 37.0 34.6 37.0 80-84 35.247299999999996 37.0 37.0 37.0 32.2 37.0 85-89 35.0846 37.0 37.0 37.0 25.0 37.0 90-94 35.104 37.0 37.0 37.0 25.0 37.0 95-99 35.0387 37.0 37.0 37.0 25.0 37.0 100-104 34.9042 37.0 37.0 37.0 25.0 37.0 105-109 34.87330000000001 37.0 37.0 37.0 25.0 37.0 110-114 34.732000000000006 37.0 37.0 37.0 25.0 37.0 115-119 34.642 37.0 37.0 37.0 25.0 37.0 120-124 34.6467 37.0 37.0 37.0 25.0 37.0 125-129 34.4649 37.0 37.0 37.0 25.0 37.0 130-134 34.3996 37.0 37.0 37.0 25.0 37.0 135-139 34.1596 37.0 37.0 37.0 25.0 37.0 140-144 33.9892 37.0 37.0 37.0 25.0 37.0 145-149 33.8632 37.0 37.0 37.0 25.0 37.0 150-151 33.09425 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 6.0 15 3.0 16 3.0 17 4.0 18 5.0 19 8.0 20 3.0 21 8.0 22 9.0 23 6.0 24 9.0 25 10.0 26 18.0 27 21.0 28 23.0 29 37.0 30 58.0 31 73.0 32 118.0 33 175.0 34 365.0 35 929.0 36 2048.0 37 56.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.449999999999996 13.750000000000002 12.925 36.875 2 31.225 18.125 28.475 22.175 3 26.674999999999997 21.75 26.275 25.3 4 28.325 29.875 16.55 25.25 5 30.3 31.7 16.475 21.525 6 23.599999999999998 34.2 16.650000000000002 25.55 7 23.25 14.75 35.35 26.650000000000002 8 24.95 19.2 20.025000000000002 35.825 9 26.0 20.8 23.425 29.775000000000002 10-14 27.57 23.93 21.310000000000002 27.189999999999998 15-19 26.82 24.075 22.165000000000003 26.939999999999998 20-24 27.29 23.375 21.59 27.744999999999997 25-29 27.21 24.245 21.815 26.729999999999997 30-34 27.305 23.89 21.475 27.33 35-39 27.43 24.175 21.5 26.895000000000003 40-44 28.060000000000002 23.06 21.855 27.025 45-49 27.275 23.665 22.189999999999998 26.87 50-54 27.744999999999997 23.674999999999997 21.26 27.32 55-59 27.400000000000002 23.07 22.15 27.38 60-64 28.095 22.82 21.735 27.35 65-69 29.330000000000002 23.565 20.875 26.229999999999997 70-74 27.939999999999998 23.135 22.095000000000002 26.83 75-79 27.305 22.455 22.375 27.865000000000002 80-84 28.125 23.84 21.57 26.465 85-89 28.02 23.735 21.62 26.625 90-94 27.834999999999997 23.3 22.215 26.650000000000002 95-99 28.044999999999998 23.169999999999998 22.24 26.545 100-104 28.155 23.685000000000002 21.465 26.695 105-109 28.325 23.515 21.529999999999998 26.63 110-114 27.955000000000002 23.395 21.654999999999998 26.995 115-119 27.55 23.599999999999998 21.959999999999997 26.889999999999997 120-124 27.544999999999998 23.685000000000002 21.675 27.095000000000002 125-129 27.985 23.34 21.560000000000002 27.115000000000002 130-134 28.015 23.765 21.745 26.474999999999998 135-139 28.32 24.255 21.425 26.0 140-144 28.405 23.59 22.0 26.005 145-149 28.375 23.61 21.865000000000002 26.150000000000002 150-151 28.325 25.4625 20.674999999999997 25.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 2.0 22 1.0 23 0.0 24 1.0 25 1.5 26 3.0 27 3.5 28 1.5 29 3.0 30 5.0 31 6.0 32 7.0 33 5.0 34 11.5 35 22.5 36 27.0 37 36.5 38 45.5 39 52.0 40 60.0 41 81.5 42 91.5 43 94.0 44 108.5 45 118.5 46 131.0 47 140.5 48 138.0 49 132.0 50 123.0 51 125.5 52 134.0 53 126.5 54 120.5 55 124.0 56 127.5 57 118.5 58 120.5 59 125.5 60 118.0 61 106.0 62 100.5 63 110.5 64 109.0 65 96.0 66 89.0 67 84.0 68 84.0 69 82.5 70 67.0 71 61.0 72 66.0 73 54.5 74 40.5 75 31.5 76 27.0 77 27.0 78 16.0 79 6.5 80 6.5 81 7.5 82 5.5 83 2.0 84 1.0 85 0.5 86 1.5 87 2.5 88 2.0 89 1.0 90 0.0 91 0.5 92 1.0 93 1.0 94 1.5 95 1.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.68591473286563 86.8 2 5.234754452239612 9.700000000000001 3 0.7555315704263357 2.1 4 0.18888289260658392 0.7000000000000001 5 0.053966540744738264 0.25 6 0.08094981111710739 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 6 0.15 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit CTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGTGATG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGAGA 20 0.00593511 29.0 85-89 >>END_MODULE Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581798 spots for SRR7804220.sra Written 1581798 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra Read 1581791 spots for SRR7804220.sra Written 1581791 spots for SRR7804220.sra SRR ids: ['SRR7804220.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yjr85a9f SRR7804220.sra spots: 31635827 blocks: [[1, 1581791], [1581792, 3163582], [3163583, 4745373], [4745374, 6327164], [6327165, 7908955], [7908956, 9490746], [9490747, 11072537], [11072538, 12654328], [12654329, 14236119], [14236120, 15817910], [15817911, 17399701], [17399702, 18981492], [18981493, 20563283], [20563284, 22145074], [22145075, 23726865], [23726866, 25308656], [25308657, 26890447], [26890448, 28472238], [28472239, 30054029], [30054030, 31635827]] SRR7804220 file size 10698643 SRR7804220 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804220 SRR7804220_1.fastq SRR7804220_2.fastq Input file: SRR7804220_1.fastq Paired file: SRR7804220_2.fastq trimmed: SRR7804220-trimmed-pair1.fastq, SRR7804220-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:18:59 2024 >> started Sat Dec 7 18:19:35 2024 >> done (36.466s) 31635827 read pairs processed; of these: 71 ( 0.00%) short read pairs filtered out after trimming by size control 1182 ( 0.00%) empty read pairs filtered out after trimming by size control 31634574 (100.00%) read pairs available; of these: 888023 ( 2.81%) trimmed read pairs available after processing 30746551 (97.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 17 0.00% 20 20 0.00% 21 23 0.00% 22 23 0.00% 23 19 0.00% 24 33 0.00% 25 19 0.00% 26 21 0.00% 27 36 0.00% 28 47 0.00% 29 41 0.00% 30 42 0.00% 31 39 0.00% 32 37 0.00% 33 37 0.00% 34 43 0.00% 35 48 0.00% 36 46 0.00% 37 46 0.00% 38 58 0.00% 39 53 0.00% 40 49 0.00% 41 46 0.00% 42 63 0.00% 43 45 0.00% 44 44 0.00% 45 59 0.00% 46 59 0.00% 47 67 0.00% 48 65 0.00% 49 73 0.00% 50 74 0.00% 51 88 0.00% 52 66 0.00% 53 92 0.00% 54 70 0.00% 55 67 0.00% 56 69 0.00% 57 85 0.00% 58 80 0.00% 59 99 0.00% 60 96 0.00% 61 119 0.00% 62 74 0.00% 63 109 0.00% 64 121 0.00% 65 104 0.00% 66 127 0.00% 67 151 0.00% 68 148 0.00% 69 134 0.00% 70 177 0.00% 71 158 0.00% 72 186 0.00% 73 208 0.00% 74 197 0.00% 75 232 0.00% 76 252 0.00% 77 292 0.00% 78 313 0.00% 79 353 0.00% 80 366 0.00% 81 437 0.00% 82 481 0.00% 83 521 0.00% 84 631 0.00% 85 660 0.00% 86 730 0.00% 87 785 0.00% 88 926 0.00% 89 997 0.00% 90 1069 0.00% 91 1299 0.00% 92 1473 0.00% 93 1548 0.00% 94 1738 0.01% 95 1914 0.01% 96 2087 0.01% 97 2286 0.01% 98 2493 0.01% 99 2731 0.01% 100 2867 0.01% 101 3043 0.01% 102 3511 0.01% 103 3814 0.01% 104 4140 0.01% 105 4667 0.01% 106 4875 0.02% 107 5281 0.02% 108 5414 0.02% 109 5728 0.02% 110 6114 0.02% 111 6407 0.02% 112 7361 0.02% 113 7685 0.02% 114 8163 0.03% 115 8719 0.03% 116 9158 0.03% 117 9583 0.03% 118 10197 0.03% 119 10640 0.03% 120 11002 0.03% 121 11823 0.04% 122 12483 0.04% 123 12996 0.04% 124 14180 0.04% 125 15114 0.05% 126 15684 0.05% 127 16063 0.05% 128 16460 0.05% 129 17493 0.06% 130 17463 0.06% 131 18501 0.06% 132 19665 0.06% 133 20633 0.07% 134 21779 0.07% 135 23081 0.07% 136 24334 0.08% 137 24769 0.08% 138 25936 0.08% 139 26344 0.08% 140 27140 0.09% 141 28124 0.09% 142 28917 0.09% 143 30226 0.10% 144 31564 0.10% 145 33545 0.11% 146 34334 0.11% 147 36096 0.11% 148 37669 0.12% 149 37538 0.12% 150 38860 0.12% 151 30746551 97.19% 31634574 reads passed initial QC criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=30 prefix-density=1.11 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=15.06 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.9 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=12 prefix-density=1.21 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=79.63 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.2 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTC SRR7804220 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:20:18 Started mapping on | Dec 07 18:20:18 Finished on | Dec 07 18:26:41 Mapping speed, Million of reads per hour | 297.35 Number of input reads | 31634574 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 27087805 Uniquely mapped reads % | 85.63% Average mapped length | 299.87 Number of splices: Total | 25971364 Number of splices: Annotated (sjdb) | 24601492 Number of splices: GT/AG | 25618353 Number of splices: GC/AG | 310764 Number of splices: AT/AC | 8099 Number of splices: Non-canonical | 34148 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1172872 % of reads mapped to multiple loci | 3.71% Number of reads mapped to too many loci | 140346 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.30% % of reads unmapped: other | 3.93% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3373897 3373897 3373897 N_multimapping 1172872 1172872 1172872 N_noFeature 1778234 26297586 1957117 N_ambiguous 780490 4071 170775 UnstrandedReadsAssigned:24529081 PositiveStrandReadsAssigned:786148 NegativeStrandReadsAssigned:24959913 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804220 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804220-trimmed-pair1.fastq SRR7804220-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,634,574 reads, 25,647,849 reads pseudoaligned [quant] estimated average fragment length: 319.194 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR7804220.ke.tsv 35125 SRR7804220.se.tsv 88098 total ==> SRR7804220.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 618.51 0 0 PNS24247 1044 725.806 40.5203 2.39413 PNS24249 1928 1609.81 147.511 3.9296 PNS24246 1044 725.806 40.5203 2.39413 PNS24248 1044 725.806 40.5203 2.39413 PNS24244 1471 1152.81 117.928 4.38689 PNS24243 293 72.948 0 0 KQK14069 1603 1284.81 4605.87 153.734 KQK14071 474 194.889 29.0064 6.38267 ==> SRR7804220.se.tsv <== BRADI_1g14170v3 4679 BRADI_1g53295v3 95 BRADI_1g59795v3 228 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 236 BRADI_1g74790v3 456 BRADI_1g09890v3 0 BRADI_1g77505v3 446 BRADI_1g48960v3 0 SRR7804220 completed mapping pipeline successfully