Starting /dee2/code/volunteer_pipeline.sh SRR7804221 current disk space = 1540638519296 free memory = 1452586396 SRR7804221 SRAfilesize 1ed635c02b683f2e74b7f7a7db1d5530 SRR7804221.sra SRR7804221.sra file validated SRR7804221 is paired end SRR7804221 is conventional basespace SRR7804221 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804221_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.11025 37.0 37.0 37.0 37.0 37.0 2 36.289 37.0 37.0 37.0 37.0 37.0 3 36.4495 37.0 37.0 37.0 37.0 37.0 4 36.446 37.0 37.0 37.0 37.0 37.0 5 36.4705 37.0 37.0 37.0 37.0 37.0 6 36.5055 37.0 37.0 37.0 37.0 37.0 7 36.4045 37.0 37.0 37.0 37.0 37.0 8 36.478 37.0 37.0 37.0 37.0 37.0 9 36.4795 37.0 37.0 37.0 37.0 37.0 10-14 36.4949 37.0 37.0 37.0 37.0 37.0 15-19 36.5069 37.0 37.0 37.0 37.0 37.0 20-24 36.444599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.407700000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.343300000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.3393 37.0 37.0 37.0 37.0 37.0 40-44 36.301300000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.274100000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2787 37.0 37.0 37.0 37.0 37.0 55-59 36.187200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1492 37.0 37.0 37.0 37.0 37.0 65-69 36.1256 37.0 37.0 37.0 37.0 37.0 70-74 36.048500000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.01809999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0366 37.0 37.0 37.0 37.0 37.0 85-89 35.9654 37.0 37.0 37.0 37.0 37.0 90-94 35.9202 37.0 37.0 37.0 37.0 37.0 95-99 35.8608 37.0 37.0 37.0 37.0 37.0 100-104 35.7608 37.0 37.0 37.0 37.0 37.0 105-109 35.7325 37.0 37.0 37.0 37.0 37.0 110-114 35.677299999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.597500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5942 37.0 37.0 37.0 37.0 37.0 125-129 35.543 37.0 37.0 37.0 37.0 37.0 130-134 35.3243 37.0 37.0 37.0 32.2 37.0 135-139 35.28779999999999 37.0 37.0 37.0 32.2 37.0 140-144 35.2451 37.0 37.0 37.0 29.8 37.0 145-149 35.0752 37.0 37.0 37.0 27.4 37.0 150-151 34.45925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 2.0 24 1.0 25 5.0 26 10.0 27 13.0 28 20.0 29 20.0 30 42.0 31 59.0 32 76.0 33 104.0 34 182.0 35 513.0 36 2727.0 37 223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.522926584815835 13.605612628413933 10.54873465296918 32.32272613380105 2 26.275 16.625 33.650000000000006 23.45 3 23.025000000000002 24.45 24.375 28.15 4 28.249999999999996 29.725 20.025000000000002 22.0 5 25.75 30.75 22.2 21.3 6 21.2 31.374999999999996 23.599999999999998 23.825 7 16.400000000000002 19.075 42.5 22.025 8 20.474999999999998 18.5 27.1 33.925 9 21.25 18.425 30.425 29.9 10-14 23.445 25.215 24.44 26.900000000000002 15-19 23.885 24.169999999999998 24.834999999999997 27.11 20-24 24.37 24.16 24.51 26.96 25-29 24.095 23.855 24.97 27.08 30-34 24.03 24.36 24.57 27.04 35-39 24.64 23.925 23.915 27.52 40-44 23.895 24.169999999999998 25.009999999999998 26.924999999999997 45-49 24.385 23.79 24.66 27.165 50-54 24.625 23.825 24.529999999999998 27.02 55-59 24.385 24.33 24.0 27.284999999999997 60-64 24.565 23.44 24.605 27.389999999999997 65-69 24.73 23.01 24.865000000000002 27.395000000000003 70-74 24.805 23.580000000000002 24.23 27.384999999999998 75-79 25.635 23.56 23.685000000000002 27.12 80-84 25.2 23.47 23.62 27.71 85-89 25.119999999999997 23.405 23.799999999999997 27.675 90-94 25.745 23.73 23.93 26.595000000000002 95-99 25.635 23.255 23.805 27.305 100-104 25.365 23.419999999999998 23.935000000000002 27.279999999999998 105-109 26.39 22.78 23.86 26.97 110-114 25.624999999999996 22.965 24.09 27.32 115-119 25.635 23.18 24.085 27.1 120-124 25.91 22.915 23.44 27.735 125-129 25.805 23.189999999999998 23.415 27.589999999999996 130-134 26.085 23.095 23.54 27.279999999999998 135-139 25.729999999999997 23.01 23.474999999999998 27.785 140-144 26.479999999999997 21.78 23.53 28.21 145-149 26.515 22.470000000000002 23.61 27.405 150-151 26.7125 22.35 23.0875 27.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.0 27 2.5 28 2.0 29 3.0 30 8.5 31 12.5 32 13.0 33 16.0 34 23.0 35 29.0 36 44.5 37 59.0 38 54.5 39 76.0 40 92.0 41 99.5 42 126.5 43 132.0 44 145.5 45 158.5 46 159.0 47 157.5 48 155.0 49 154.5 50 148.5 51 148.0 52 143.5 53 136.5 54 132.0 55 124.5 56 123.5 57 121.0 58 112.0 59 108.0 60 102.0 61 88.5 62 79.5 63 82.5 64 87.0 65 79.0 66 62.5 67 54.5 68 54.5 69 44.0 70 42.0 71 44.5 72 30.0 73 23.0 74 20.5 75 21.0 76 21.0 77 13.5 78 10.0 79 5.5 80 1.5 81 1.5 82 1.5 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 94.09574468085107 88.44999999999999 2 5.452127659574469 10.25 3 0.425531914893617 1.2 4 0.026595744680851064 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.037500000000000006 0.0 0.0 0.0 0.025 86-87 0.0625 0.0 0.0 0.0 0.025 88-89 0.075 0.0 0.0 0.0 0.025 90-91 0.075 0.0 0.0 0.0 0.025 92-93 0.075 0.0 0.0 0.0 0.025 94-95 0.075 0.0 0.0 0.0 0.025 96-97 0.0875 0.0 0.0 0.0 0.025 98-99 0.1 0.0 0.0 0.0 0.025 100-101 0.1 0.0 0.0 0.0 0.025 102-103 0.1375 0.0 0.0 0.0 0.025 104-105 0.15 0.0 0.0 0.0 0.025 106-107 0.15 0.0 0.0 0.0 0.025 108-109 0.175 0.0 0.0 0.0 0.025 110-111 0.225 0.0 0.0 0.0 0.025 112-113 0.3125 0.0 0.0 0.0 0.025 114-115 0.3375 0.0 0.0 0.0 0.025 116-117 0.4 0.0 0.0 0.0 0.025 118-119 0.44999999999999996 0.0 0.0 0.0 0.025 120-121 0.5 0.0 0.0 0.0 0.025 122-123 0.575 0.0 0.0 0.0 0.025 124-125 0.6375 0.0 0.0 0.0 0.025 126-127 0.675 0.0 0.0 0.0 0.025 128-129 0.7625 0.0 0.0 0.0 0.025 130-131 0.8125 0.0 0.0 0.0 0.025 132-133 0.9 0.0 0.0 0.0 0.025 134-135 0.975 0.0 0.0 0.0 0.025 136-137 1.1125 0.0 0.0 0.0 0.025 138-139 1.3125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAATC 10 0.006830828 145.0 1 >>END_MODULE SRR7804221 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804221_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1855 37.0 37.0 37.0 37.0 37.0 2 35.7745 37.0 37.0 37.0 37.0 37.0 3 35.912 37.0 37.0 37.0 37.0 37.0 4 36.034 37.0 37.0 37.0 37.0 37.0 5 36.0305 37.0 37.0 37.0 37.0 37.0 6 35.949 37.0 37.0 37.0 37.0 37.0 7 35.9665 37.0 37.0 37.0 37.0 37.0 8 36.0175 37.0 37.0 37.0 37.0 37.0 9 35.989 37.0 37.0 37.0 37.0 37.0 10-14 35.9742 37.0 37.0 37.0 37.0 37.0 15-19 35.8041 37.0 37.0 37.0 37.0 37.0 20-24 35.876599999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.7347 37.0 37.0 37.0 37.0 37.0 30-34 35.79350000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.6447 37.0 37.0 37.0 37.0 37.0 40-44 35.6351 37.0 37.0 37.0 37.0 37.0 45-49 35.5985 37.0 37.0 37.0 37.0 37.0 50-54 35.541900000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.501400000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.4306 37.0 37.0 37.0 37.0 37.0 65-69 35.355399999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.3664 37.0 37.0 37.0 37.0 37.0 75-79 35.3553 37.0 37.0 37.0 37.0 37.0 80-84 35.200100000000006 37.0 37.0 37.0 27.4 37.0 85-89 35.103699999999996 37.0 37.0 37.0 29.8 37.0 90-94 35.1195 37.0 37.0 37.0 25.0 37.0 95-99 34.938900000000004 37.0 37.0 37.0 25.0 37.0 100-104 34.900999999999996 37.0 37.0 37.0 25.0 37.0 105-109 34.7764 37.0 37.0 37.0 25.0 37.0 110-114 34.6814 37.0 37.0 37.0 25.0 37.0 115-119 34.6571 37.0 37.0 37.0 25.0 37.0 120-124 34.5396 37.0 37.0 37.0 25.0 37.0 125-129 34.469199999999994 37.0 37.0 37.0 25.0 37.0 130-134 34.375299999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.112300000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.09310000000001 37.0 37.0 37.0 25.0 37.0 145-149 33.8989 37.0 37.0 37.0 25.0 37.0 150-151 33.391000000000005 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 5.0 14 6.0 15 8.0 16 1.0 17 0.0 18 5.0 19 3.0 20 5.0 21 9.0 22 16.0 23 7.0 24 10.0 25 12.0 26 20.0 27 20.0 28 18.0 29 32.0 30 45.0 31 69.0 32 108.0 33 195.0 34 345.0 35 978.0 36 2024.0 37 55.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.175 12.35 11.625 30.85 2 30.8 17.95 27.750000000000004 23.5 3 27.3 21.675 26.0 25.025 4 29.375 30.049999999999997 15.325 25.25 5 28.299999999999997 32.074999999999996 16.375 23.25 6 23.825 32.375 19.025 24.775 7 23.275000000000002 16.075 34.325 26.325 8 23.3 19.25 20.599999999999998 36.85 9 25.124999999999996 20.8 23.150000000000002 30.925000000000004 10-14 27.515 23.86 21.145 27.48 15-19 27.47 22.884999999999998 22.475 27.169999999999998 20-24 27.185 23.765 21.335 27.715 25-29 27.61 23.95 21.310000000000002 27.13 30-34 27.339999999999996 23.515 22.21 26.935 35-39 27.515 24.115000000000002 21.335 27.034999999999997 40-44 27.384999999999998 23.419999999999998 21.959999999999997 27.235 45-49 27.700000000000003 23.54 21.485000000000003 27.275 50-54 27.76 23.935000000000002 21.385 26.919999999999998 55-59 28.235 23.165 21.93 26.669999999999998 60-64 28.189999999999998 23.35 21.695 26.765 65-69 28.310000000000002 23.16 21.765 26.765 70-74 28.000000000000004 23.5 21.785 26.715 75-79 27.189999999999998 23.28 22.005 27.525 80-84 27.88 23.549999999999997 21.62 26.950000000000003 85-89 27.694999999999997 23.39 21.81 27.105 90-94 27.55 23.875 21.865000000000002 26.71 95-99 28.095 23.325000000000003 21.915000000000003 26.665 100-104 27.755000000000003 23.875 22.05 26.32 105-109 28.49 23.345 21.495 26.669999999999998 110-114 27.965 24.195 21.490000000000002 26.35 115-119 27.33 23.57 21.57 27.529999999999998 120-124 28.4 23.71 21.060000000000002 26.83 125-129 28.12 23.825 21.525 26.529999999999998 130-134 28.835 23.805 21.22 26.14 135-139 28.03 24.015 21.709999999999997 26.245 140-144 28.005000000000003 23.89 21.955 26.150000000000002 145-149 28.084999999999997 24.52 21.634999999999998 25.759999999999998 150-151 28.975 24.099999999999998 21.175 25.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 1.5 17 1.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 1.5 28 1.0 29 1.0 30 0.5 31 2.0 32 5.5 33 10.0 34 10.0 35 14.0 36 25.5 37 37.0 38 42.0 39 53.0 40 75.0 41 87.0 42 102.0 43 114.5 44 119.5 45 117.5 46 117.5 47 131.0 48 130.0 49 128.5 50 140.0 51 140.5 52 127.5 53 116.5 54 117.5 55 130.0 56 125.0 57 115.5 58 122.0 59 125.5 60 118.5 61 104.0 62 93.0 63 89.0 64 95.0 65 84.5 66 84.5 67 93.0 68 86.5 69 81.0 70 77.0 71 78.5 72 70.5 73 54.5 74 41.0 75 33.5 76 26.0 77 18.5 78 17.0 79 15.0 80 8.0 81 5.5 82 6.0 83 4.0 84 1.5 85 1.0 86 1.0 87 1.0 88 1.0 89 0.5 90 0.5 91 1.0 92 1.0 93 0.0 94 0.0 95 1.0 96 1.0 97 1.0 98 1.5 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.18201227648785 88.225 2 5.15078729650387 9.65 3 0.5070723245262877 1.425 4 0.08006405124099279 0.3 5 0.05337603416066186 0.25 6 0.02668801708033093 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 0.975 0.0 0.0 0.0 0.0 136-137 1.1125 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTAAGG 10 0.006830828 145.0 2 >>END_MODULE Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra Read 1323188 spots for SRR7804221.sra Written 1323188 spots for SRR7804221.sra Read 1323177 spots for SRR7804221.sra Written 1323177 spots for SRR7804221.sra SRR ids: ['SRR7804221.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sh1iuo0n SRR7804221.sra spots: 26463551 blocks: [[1, 1323177], [1323178, 2646354], [2646355, 3969531], [3969532, 5292708], [5292709, 6615885], [6615886, 7939062], [7939063, 9262239], [9262240, 10585416], [10585417, 11908593], [11908594, 13231770], [13231771, 14554947], [14554948, 15878124], [15878125, 17201301], [17201302, 18524478], [18524479, 19847655], [19847656, 21170832], [21170833, 22494009], [22494010, 23817186], [23817187, 25140363], [25140364, 26463551]] SRR7804221 file size 8945928 SRR7804221 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804221 SRR7804221_1.fastq SRR7804221_2.fastq Input file: SRR7804221_1.fastq Paired file: SRR7804221_2.fastq trimmed: SRR7804221-trimmed-pair1.fastq, SRR7804221-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:19:20 2024 >> started Sat Dec 7 18:19:53 2024 >> done (33.453s) 26463551 read pairs processed; of these: 74 ( 0.00%) short read pairs filtered out after trimming by size control 527 ( 0.00%) empty read pairs filtered out after trimming by size control 26462950 (100.00%) read pairs available; of these: 620307 ( 2.34%) trimmed read pairs available after processing 25842643 (97.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 14 0.00% 20 12 0.00% 21 16 0.00% 22 25 0.00% 23 22 0.00% 24 24 0.00% 25 25 0.00% 26 34 0.00% 27 30 0.00% 28 35 0.00% 29 31 0.00% 30 42 0.00% 31 37 0.00% 32 44 0.00% 33 37 0.00% 34 43 0.00% 35 44 0.00% 36 35 0.00% 37 50 0.00% 38 61 0.00% 39 44 0.00% 40 40 0.00% 41 33 0.00% 42 59 0.00% 43 38 0.00% 44 44 0.00% 45 53 0.00% 46 57 0.00% 47 54 0.00% 48 68 0.00% 49 63 0.00% 50 65 0.00% 51 56 0.00% 52 55 0.00% 53 75 0.00% 54 59 0.00% 55 77 0.00% 56 83 0.00% 57 80 0.00% 58 77 0.00% 59 83 0.00% 60 96 0.00% 61 107 0.00% 62 97 0.00% 63 97 0.00% 64 99 0.00% 65 86 0.00% 66 103 0.00% 67 92 0.00% 68 107 0.00% 69 127 0.00% 70 133 0.00% 71 128 0.00% 72 142 0.00% 73 153 0.00% 74 151 0.00% 75 155 0.00% 76 187 0.00% 77 194 0.00% 78 220 0.00% 79 209 0.00% 80 224 0.00% 81 269 0.00% 82 320 0.00% 83 324 0.00% 84 374 0.00% 85 380 0.00% 86 454 0.00% 87 443 0.00% 88 524 0.00% 89 596 0.00% 90 625 0.00% 91 814 0.00% 92 832 0.00% 93 917 0.00% 94 1112 0.00% 95 1225 0.00% 96 1297 0.00% 97 1355 0.01% 98 1480 0.01% 99 1700 0.01% 100 1759 0.01% 101 1996 0.01% 102 2169 0.01% 103 2333 0.01% 104 2644 0.01% 105 2752 0.01% 106 3172 0.01% 107 3403 0.01% 108 3497 0.01% 109 3712 0.01% 110 3923 0.01% 111 4230 0.02% 112 4787 0.02% 113 4869 0.02% 114 5293 0.02% 115 5872 0.02% 116 6185 0.02% 117 6275 0.02% 118 6627 0.03% 119 6991 0.03% 120 7423 0.03% 121 7937 0.03% 122 8398 0.03% 123 9166 0.03% 124 9558 0.04% 125 10117 0.04% 126 10766 0.04% 127 11096 0.04% 128 11436 0.04% 129 12074 0.05% 130 12402 0.05% 131 13134 0.05% 132 13924 0.05% 133 14781 0.06% 134 15654 0.06% 135 16276 0.06% 136 17054 0.06% 137 17512 0.07% 138 18348 0.07% 139 18617 0.07% 140 19568 0.07% 141 20258 0.08% 142 20759 0.08% 143 21695 0.08% 144 22761 0.09% 145 24262 0.09% 146 24790 0.09% 147 25890 0.10% 148 26780 0.10% 149 27021 0.10% 150 28477 0.11% 151 25842643 97.66% 26462950 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=28 prefix-density=1.02 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=15.17 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=9 prefix-density=1.11 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=19.91 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.9 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804221 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:20:59 Started mapping on | Dec 07 18:21:00 Finished on | Dec 07 18:25:35 Mapping speed, Million of reads per hour | 346.42 Number of input reads | 26462950 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 22255735 Uniquely mapped reads % | 84.10% Average mapped length | 300.00 Number of splices: Total | 21449576 Number of splices: Annotated (sjdb) | 20335626 Number of splices: GT/AG | 21151357 Number of splices: GC/AG | 261226 Number of splices: AT/AC | 6937 Number of splices: Non-canonical | 30056 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 969882 % of reads mapped to multiple loci | 3.67% Number of reads mapped to too many loci | 135626 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.04% % of reads unmapped: other | 4.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3237333 3237333 3237333 N_multimapping 969882 969882 969882 N_noFeature 1510758 21621244 1647250 N_ambiguous 640394 3265 143949 UnstrandedReadsAssigned:20104583 PositiveStrandReadsAssigned:631226 NegativeStrandReadsAssigned:20464536 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804221 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804221-trimmed-pair1.fastq SRR7804221-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,462,950 reads, 21,185,398 reads pseudoaligned [quant] estimated average fragment length: 327.394 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR7804221.ke.tsv 35125 SRR7804221.se.tsv 88098 total ==> SRR7804221.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 610.367 0 0 PNS24247 1044 717.606 44.9494 3.27238 PNS24249 1928 1601.61 94.9075 3.09579 PNS24246 1044 717.606 44.9494 3.27238 PNS24248 1044 717.606 44.9494 3.27238 PNS24244 1471 1144.61 116.244 5.3057 PNS24243 293 71.353 0 0 KQK14069 1603 1276.61 4343.85 177.764 KQK14071 474 189.912 29.8118 8.20092 ==> SRR7804221.se.tsv <== BRADI_1g14170v3 4411 BRADI_1g53295v3 88 BRADI_1g59795v3 218 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 235 BRADI_1g74790v3 394 BRADI_1g09890v3 0 BRADI_1g77505v3 359 BRADI_1g48960v3 0 SRR7804221 completed mapping pipeline successfully