Starting /dee2/code/volunteer_pipeline.sh SRR7804222 current disk space = 1540617162752 free memory = 1412195816 SRR7804222 SRAfilesize 20f5decd9aa8d08149959215b79e0c57 SRR7804222.sra SRR7804222.sra file validated SRR7804222 is paired end SRR7804222 is conventional basespace SRR7804222 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804222_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.17475 37.0 37.0 37.0 37.0 37.0 2 36.3185 37.0 37.0 37.0 37.0 37.0 3 36.3735 37.0 37.0 37.0 37.0 37.0 4 36.5035 37.0 37.0 37.0 37.0 37.0 5 36.484 37.0 37.0 37.0 37.0 37.0 6 36.5015 37.0 37.0 37.0 37.0 37.0 7 36.383 37.0 37.0 37.0 37.0 37.0 8 36.408 37.0 37.0 37.0 37.0 37.0 9 36.469 37.0 37.0 37.0 37.0 37.0 10-14 36.4966 37.0 37.0 37.0 37.0 37.0 15-19 36.544 37.0 37.0 37.0 37.0 37.0 20-24 36.4688 37.0 37.0 37.0 37.0 37.0 25-29 36.4456 37.0 37.0 37.0 37.0 37.0 30-34 36.4141 37.0 37.0 37.0 37.0 37.0 35-39 36.4076 37.0 37.0 37.0 37.0 37.0 40-44 36.3706 37.0 37.0 37.0 37.0 37.0 45-49 36.2715 37.0 37.0 37.0 37.0 37.0 50-54 36.22580000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.19820000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.190099999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.1417 37.0 37.0 37.0 37.0 37.0 70-74 36.0783 37.0 37.0 37.0 37.0 37.0 75-79 36.0938 37.0 37.0 37.0 37.0 37.0 80-84 36.0712 37.0 37.0 37.0 37.0 37.0 85-89 36.009499999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.902100000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8502 37.0 37.0 37.0 37.0 37.0 100-104 35.797000000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.798899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.757 37.0 37.0 37.0 37.0 37.0 115-119 35.658 37.0 37.0 37.0 37.0 37.0 120-124 35.4947 37.0 37.0 37.0 37.0 37.0 125-129 35.5615 37.0 37.0 37.0 37.0 37.0 130-134 35.4093 37.0 37.0 37.0 34.6 37.0 135-139 35.295100000000005 37.0 37.0 37.0 34.6 37.0 140-144 35.265699999999995 37.0 37.0 37.0 29.8 37.0 145-149 35.151700000000005 37.0 37.0 37.0 27.4 37.0 150-151 34.58775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 5.0 25 6.0 26 4.0 27 14.0 28 21.0 29 29.0 30 38.0 31 48.0 32 69.0 33 105.0 34 176.0 35 461.0 36 2783.0 37 240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.288398897519414 12.427962916562265 10.874467551991982 37.40917063392634 2 27.950000000000003 15.1 33.975 22.975 3 24.0 21.85 22.825 31.324999999999996 4 27.825 27.975 18.9 25.3 5 26.55 32.675 20.875 19.900000000000002 6 22.400000000000002 30.775000000000002 22.400000000000002 24.425 7 17.349999999999998 19.55 39.074999999999996 24.025 8 23.025000000000002 20.25 24.8 31.924999999999997 9 21.525 18.975 30.3 29.2 10-14 24.529999999999998 24.834999999999997 23.474999999999998 27.16 15-19 24.625 23.599999999999998 24.865000000000002 26.91 20-24 24.465 24.104999999999997 24.565 26.865 25-29 24.685000000000002 23.799999999999997 24.62 26.895000000000003 30-34 24.884999999999998 24.125 24.34 26.650000000000002 35-39 25.180000000000003 23.46 23.75 27.61 40-44 25.205 23.369999999999997 24.69 26.735 45-49 25.03 23.705000000000002 24.14 27.125 50-54 24.92 23.355 24.29 27.435 55-59 24.81 23.73 24.45 27.01 60-64 24.615000000000002 23.47 24.18 27.735 65-69 25.485000000000003 23.16 23.94 27.415 70-74 24.875 23.305 23.875 27.944999999999997 75-79 24.990000000000002 23.544999999999998 23.419999999999998 28.044999999999998 80-84 25.685000000000002 23.515 23.674999999999997 27.125 85-89 25.45 23.25 23.474999999999998 27.825 90-94 25.319999999999997 23.365 23.945 27.37 95-99 25.535000000000004 23.27 24.22 26.974999999999998 100-104 26.02 23.01 23.84 27.13 105-109 26.32 22.225 23.365 28.09 110-114 25.4 23.16 23.945 27.495000000000005 115-119 25.240000000000002 23.41 23.73 27.62 120-124 26.119999999999997 22.755 23.23 27.894999999999996 125-129 26.025 23.03 23.73 27.215 130-134 26.865 22.325 23.455000000000002 27.355 135-139 26.38 22.105 23.535 27.98 140-144 26.41 22.52 23.21 27.860000000000003 145-149 26.105 22.8 23.1 27.994999999999997 150-151 26.487500000000004 22.3625 23.7625 27.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 3.0 26 1.5 27 0.5 28 0.5 29 2.5 30 5.5 31 11.0 32 12.5 33 11.0 34 16.0 35 28.5 36 46.0 37 59.0 38 61.0 39 63.0 40 88.0 41 109.5 42 127.5 43 138.0 44 135.5 45 139.5 46 139.5 47 143.5 48 142.5 49 132.0 50 133.5 51 147.0 52 147.0 53 128.0 54 120.5 55 138.5 56 140.5 57 131.5 58 125.5 59 114.0 60 117.0 61 110.0 62 93.5 63 85.5 64 71.5 65 66.5 66 66.0 67 67.5 68 68.0 69 52.0 70 46.5 71 45.0 72 35.0 73 27.5 74 21.5 75 20.0 76 17.5 77 13.0 78 12.0 79 8.5 80 3.0 81 2.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.3817594834544 86.775 2 5.83804143126177 10.85 3 0.5918751681463547 1.6500000000000001 4 0.16142050040355124 0.6 5 0.026903416733925208 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.6125 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.7749999999999999 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9624999999999999 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138-139 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCGG 20 0.00593511 29.0 140-144 >>END_MODULE SRR7804222 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804222_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.921 37.0 37.0 37.0 37.0 37.0 2 35.5235 37.0 37.0 37.0 37.0 37.0 3 35.7055 37.0 37.0 37.0 37.0 37.0 4 35.9135 37.0 37.0 37.0 37.0 37.0 5 36.091 37.0 37.0 37.0 37.0 37.0 6 35.688 37.0 37.0 37.0 37.0 37.0 7 35.746 37.0 37.0 37.0 37.0 37.0 8 35.955 37.0 37.0 37.0 37.0 37.0 9 35.904 37.0 37.0 37.0 37.0 37.0 10-14 35.9154 37.0 37.0 37.0 37.0 37.0 15-19 35.857299999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.8084 37.0 37.0 37.0 37.0 37.0 25-29 35.764300000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.7267 37.0 37.0 37.0 37.0 37.0 35-39 35.6631 37.0 37.0 37.0 37.0 37.0 40-44 35.5612 37.0 37.0 37.0 37.0 37.0 45-49 35.5196 37.0 37.0 37.0 37.0 37.0 50-54 35.503499999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.4309 37.0 37.0 37.0 37.0 37.0 60-64 35.243100000000005 37.0 37.0 37.0 29.8 37.0 65-69 35.222699999999996 37.0 37.0 37.0 27.4 37.0 70-74 35.1952 37.0 37.0 37.0 32.2 37.0 75-79 35.21340000000001 37.0 37.0 37.0 27.4 37.0 80-84 35.084700000000005 37.0 37.0 37.0 25.0 37.0 85-89 34.9702 37.0 37.0 37.0 25.0 37.0 90-94 34.8912 37.0 37.0 37.0 25.0 37.0 95-99 34.834500000000006 37.0 37.0 37.0 25.0 37.0 100-104 34.6614 37.0 37.0 37.0 25.0 37.0 105-109 34.680899999999994 37.0 37.0 37.0 25.0 37.0 110-114 34.583999999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.496 37.0 37.0 37.0 25.0 37.0 120-124 34.3327 37.0 37.0 37.0 25.0 37.0 125-129 34.301300000000005 37.0 37.0 37.0 25.0 37.0 130-134 34.24679999999999 37.0 37.0 37.0 25.0 37.0 135-139 34.018299999999996 37.0 37.0 37.0 25.0 37.0 140-144 33.8629 37.0 37.0 37.0 25.0 37.0 145-149 33.6459 37.0 37.0 37.0 25.0 37.0 150-151 32.951750000000004 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 2.0 14 4.0 15 2.0 16 1.0 17 1.0 18 0.0 19 1.0 20 6.0 21 7.0 22 6.0 23 7.0 24 9.0 25 11.0 26 14.0 27 41.0 28 26.0 29 50.0 30 56.0 31 87.0 32 123.0 33 229.0 34 444.0 35 1090.0 36 1743.0 37 37.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.7 13.525 12.5 36.275 2 30.349999999999998 18.825 28.599999999999998 22.225 3 26.55 22.275 26.424999999999997 24.75 4 28.475 29.125 16.900000000000002 25.5 5 28.549999999999997 31.6 17.125 22.725 6 24.05 32.550000000000004 18.224999999999998 25.174999999999997 7 23.549999999999997 15.875 33.6 26.974999999999998 8 23.45 20.5 21.45 34.599999999999994 9 26.075 21.099999999999998 23.075000000000003 29.75 10-14 27.305 24.085 21.055 27.555000000000003 15-19 26.939999999999998 23.990000000000002 21.78 27.29 20-24 27.26 24.26 21.095 27.384999999999998 25-29 27.49 23.3 21.85 27.36 30-34 27.534999999999997 23.400000000000002 21.75 27.315 35-39 27.584999999999997 23.549999999999997 21.32 27.544999999999998 40-44 27.134999999999998 24.015 21.19 27.66 45-49 27.98 23.375 21.654999999999998 26.99 50-54 28.065 23.380000000000003 21.265 27.29 55-59 27.315 23.200000000000003 21.475 28.01 60-64 27.83 22.99 21.785 27.395000000000003 65-69 27.66 22.884999999999998 21.965 27.49 70-74 27.22 23.13 22.040000000000003 27.61 75-79 27.334999999999997 22.755 22.040000000000003 27.87 80-84 27.834999999999997 23.26 21.665 27.24 85-89 27.99 22.985 21.52 27.505000000000003 90-94 27.700000000000003 23.075000000000003 22.325 26.900000000000002 95-99 28.17 22.685 21.740000000000002 27.405 100-104 28.09 23.18 21.895 26.834999999999997 105-109 28.265 22.400000000000002 21.740000000000002 27.595 110-114 27.944999999999997 23.09 21.465 27.500000000000004 115-119 28.035 23.724999999999998 22.16 26.08 120-124 27.744999999999997 23.07 22.345000000000002 26.840000000000003 125-129 28.13 23.265 21.445 27.16 130-134 28.660000000000004 23.155 21.27 26.915 135-139 28.76 23.685000000000002 21.555 26.0 140-144 28.87 23.65 21.22 26.26 145-149 28.685 23.765 21.42 26.13 150-151 29.062500000000004 23.974999999999998 21.6125 25.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 0.5 28 1.5 29 2.0 30 3.5 31 6.5 32 7.5 33 6.5 34 11.5 35 20.5 36 20.5 37 30.0 38 44.5 39 58.5 40 74.5 41 79.5 42 102.0 43 110.0 44 102.5 45 113.5 46 128.5 47 127.5 48 129.0 49 130.0 50 111.5 51 114.0 52 113.5 53 103.0 54 132.0 55 150.0 56 129.0 57 129.5 58 137.0 59 121.0 60 115.5 61 117.5 62 108.5 63 104.0 64 87.5 65 80.0 66 89.0 67 95.5 68 98.0 69 86.0 70 75.5 71 63.5 72 56.5 73 54.0 74 46.0 75 40.5 76 36.0 77 26.5 78 17.5 79 11.5 80 7.0 81 6.5 82 4.0 83 2.0 84 0.5 85 1.0 86 1.5 87 1.0 88 0.5 89 0.5 90 1.0 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.34955393349554 86.325 2 5.785347391186807 10.7 3 0.5136523384698567 1.425 4 0.1892403352257367 0.7000000000000001 5 0.10813733441470669 0.5 6 0.027034333603676672 0.15 7 0.0 0.0 8 0.027034333603676672 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 8 0.2 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit CTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGTGATG 5 0.125 No Hit CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.2875 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.325 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.5875 0.0 0.0 0.0 0.025 126-127 0.6625000000000001 0.0 0.0 0.0 0.025 128-129 0.75 0.0 0.0 0.0 0.025 130-131 0.85 0.0 0.05 0.0 0.025 132-133 0.9375 0.0 0.05 0.0 0.025 134-135 1.0375 0.0 0.05 0.0 0.025 136-137 1.1375000000000002 0.0 0.05 0.0 0.025 138-139 1.275 0.0 0.05 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474403 spots for SRR7804222.sra Written 1474403 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra Read 1474401 spots for SRR7804222.sra Written 1474401 spots for SRR7804222.sra SRR ids: ['SRR7804222.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vzr3vt72 SRR7804222.sra spots: 29488022 blocks: [[1, 1474401], [1474402, 2948802], [2948803, 4423203], [4423204, 5897604], [5897605, 7372005], [7372006, 8846406], [8846407, 10320807], [10320808, 11795208], [11795209, 13269609], [13269610, 14744010], [14744011, 16218411], [16218412, 17692812], [17692813, 19167213], [19167214, 20641614], [20641615, 22116015], [22116016, 23590416], [23590417, 25064817], [25064818, 26539218], [26539219, 28013619], [28013620, 29488022]] SRR7804222 file size 9970822 SRR7804222 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804222 SRR7804222_1.fastq SRR7804222_2.fastq Input file: SRR7804222_1.fastq Paired file: SRR7804222_2.fastq trimmed: SRR7804222-trimmed-pair1.fastq, SRR7804222-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:24:40 2024 >> started Sat Dec 7 18:25:14 2024 >> done (34.178s) 29488022 read pairs processed; of these: 100 ( 0.00%) short read pairs filtered out after trimming by size control 833 ( 0.00%) empty read pairs filtered out after trimming by size control 29487089 (100.00%) read pairs available; of these: 711493 ( 2.41%) trimmed read pairs available after processing 28775596 (97.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 15 0.00% 20 13 0.00% 21 18 0.00% 22 22 0.00% 23 23 0.00% 24 27 0.00% 25 22 0.00% 26 26 0.00% 27 28 0.00% 28 26 0.00% 29 36 0.00% 30 30 0.00% 31 41 0.00% 32 50 0.00% 33 43 0.00% 34 34 0.00% 35 49 0.00% 36 66 0.00% 37 47 0.00% 38 58 0.00% 39 53 0.00% 40 48 0.00% 41 43 0.00% 42 54 0.00% 43 54 0.00% 44 49 0.00% 45 50 0.00% 46 68 0.00% 47 68 0.00% 48 56 0.00% 49 61 0.00% 50 69 0.00% 51 85 0.00% 52 68 0.00% 53 62 0.00% 54 85 0.00% 55 75 0.00% 56 84 0.00% 57 71 0.00% 58 91 0.00% 59 90 0.00% 60 81 0.00% 61 90 0.00% 62 89 0.00% 63 103 0.00% 64 110 0.00% 65 105 0.00% 66 107 0.00% 67 128 0.00% 68 115 0.00% 69 124 0.00% 70 121 0.00% 71 125 0.00% 72 168 0.00% 73 158 0.00% 74 158 0.00% 75 189 0.00% 76 208 0.00% 77 196 0.00% 78 224 0.00% 79 254 0.00% 80 271 0.00% 81 305 0.00% 82 397 0.00% 83 393 0.00% 84 432 0.00% 85 537 0.00% 86 494 0.00% 87 631 0.00% 88 628 0.00% 89 725 0.00% 90 760 0.00% 91 909 0.00% 92 967 0.00% 93 1194 0.00% 94 1324 0.00% 95 1433 0.00% 96 1538 0.01% 97 1588 0.01% 98 1822 0.01% 99 1994 0.01% 100 2093 0.01% 101 2302 0.01% 102 2576 0.01% 103 2890 0.01% 104 3233 0.01% 105 3481 0.01% 106 3775 0.01% 107 3913 0.01% 108 4148 0.01% 109 4471 0.02% 110 4663 0.02% 111 5062 0.02% 112 5447 0.02% 113 5884 0.02% 114 6452 0.02% 115 6976 0.02% 116 7405 0.03% 117 7733 0.03% 118 7913 0.03% 119 8249 0.03% 120 8458 0.03% 121 8939 0.03% 122 9736 0.03% 123 10391 0.04% 124 11213 0.04% 125 12040 0.04% 126 12626 0.04% 127 13206 0.04% 128 13243 0.04% 129 13879 0.05% 130 13903 0.05% 131 14670 0.05% 132 15532 0.05% 133 16731 0.06% 134 17570 0.06% 135 18993 0.06% 136 19909 0.07% 137 20424 0.07% 138 21015 0.07% 139 21372 0.07% 140 21765 0.07% 141 22252 0.08% 142 22974 0.08% 143 24087 0.08% 144 25815 0.09% 145 27210 0.09% 146 28591 0.10% 147 29502 0.10% 148 31299 0.11% 149 30540 0.10% 150 31676 0.11% 151 28775596 97.59% 29487089 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=1.03 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=14.63 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=10 prefix-density=1.08 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=17.06 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.0 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7804222 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:27:16 Started mapping on | Dec 07 18:27:16 Finished on | Dec 07 18:32:35 Mapping speed, Million of reads per hour | 332.77 Number of input reads | 29487089 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 25251922 Uniquely mapped reads % | 85.64% Average mapped length | 299.94 Number of splices: Total | 24630155 Number of splices: Annotated (sjdb) | 23361198 Number of splices: GT/AG | 24292741 Number of splices: GC/AG | 297845 Number of splices: AT/AC | 7918 Number of splices: Non-canonical | 31651 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1170658 % of reads mapped to multiple loci | 3.97% Number of reads mapped to too many loci | 155020 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.05% % of reads unmapped: other | 4.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3064509 3064509 3064509 N_multimapping 1170658 1170658 1170658 N_noFeature 1718342 24552760 1871979 N_ambiguous 705127 3549 161144 UnstrandedReadsAssigned:22828453 PositiveStrandReadsAssigned:695613 NegativeStrandReadsAssigned:23218799 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804222 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804222-trimmed-pair1.fastq SRR7804222-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,487,089 reads, 23,885,169 reads pseudoaligned [quant] estimated average fragment length: 325.108 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52973 SRR7804222.ke.tsv 35125 SRR7804222.se.tsv 88098 total ==> SRR7804222.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 612.67 0 0 PNS24247 1044 719.892 34.1526 2.19742 PNS24249 1928 1603.89 149.204 4.30886 PNS24246 1044 719.892 34.1526 2.19742 PNS24248 1044 719.892 34.1526 2.19742 PNS24244 1471 1146.89 92.3382 3.7292 PNS24243 293 71.2312 0 0 KQK14069 1603 1278.89 5120.16 185.441 KQK14071 474 191.664 43.3125 10.4672 ==> SRR7804222.se.tsv <== BRADI_1g14170v3 5434 BRADI_1g53295v3 63 BRADI_1g59795v3 206 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 276 BRADI_1g74790v3 392 BRADI_1g09890v3 0 BRADI_1g77505v3 403 BRADI_1g48960v3 0 SRR7804222 completed mapping pipeline successfully