Starting /dee2/code/volunteer_pipeline.sh SRR7804223 current disk space = 1540689354752 free memory = 1411436580 SRR7804223 SRAfilesize a80e71d7331c5f3990e6dd4eb2df7115 SRR7804223.sra SRR7804223.sra file validated SRR7804223 is paired end SRR7804223 is conventional basespace SRR7804223 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804223_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1035 37.0 37.0 37.0 37.0 37.0 2 36.2365 37.0 37.0 37.0 37.0 37.0 3 36.3545 37.0 37.0 37.0 37.0 37.0 4 36.4645 37.0 37.0 37.0 37.0 37.0 5 36.502 37.0 37.0 37.0 37.0 37.0 6 36.5045 37.0 37.0 37.0 37.0 37.0 7 36.3245 37.0 37.0 37.0 37.0 37.0 8 36.454 37.0 37.0 37.0 37.0 37.0 9 36.484 37.0 37.0 37.0 37.0 37.0 10-14 36.470299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5141 37.0 37.0 37.0 37.0 37.0 20-24 36.4647 37.0 37.0 37.0 37.0 37.0 25-29 36.418099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3675 37.0 37.0 37.0 37.0 37.0 35-39 36.353899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.33219999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.302099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.27550000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.2333 37.0 37.0 37.0 37.0 37.0 60-64 36.148799999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.101800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0557 37.0 37.0 37.0 37.0 37.0 75-79 36.0532 37.0 37.0 37.0 37.0 37.0 80-84 36.054500000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.958 37.0 37.0 37.0 37.0 37.0 90-94 35.9326 37.0 37.0 37.0 37.0 37.0 95-99 35.826600000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.836 37.0 37.0 37.0 37.0 37.0 105-109 35.7409 37.0 37.0 37.0 37.0 37.0 110-114 35.7245 37.0 37.0 37.0 37.0 37.0 115-119 35.688599999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.526399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5116 37.0 37.0 37.0 37.0 37.0 130-134 35.4202 37.0 37.0 37.0 37.0 37.0 135-139 35.3104 37.0 37.0 37.0 34.6 37.0 140-144 35.3682 37.0 37.0 37.0 34.6 37.0 145-149 35.10000000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.4255 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 2.0 24 3.0 25 4.0 26 4.0 27 9.0 28 19.0 29 31.0 30 33.0 31 52.0 32 79.0 33 129.0 34 197.0 35 450.0 36 2751.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.66834170854271 11.85929648241206 10.703517587939698 38.768844221105525 2 25.124999999999996 18.175 34.625 22.075 3 24.2 24.45 23.549999999999997 27.800000000000004 4 27.05 31.474999999999998 19.2 22.275 5 25.324999999999996 31.75 22.625 20.3 6 22.15 30.95 23.275000000000002 23.625 7 17.75 18.075 42.1 22.075 8 21.725 19.5 26.8 31.974999999999998 9 21.15 19.45 31.45 27.950000000000003 10-14 23.74 24.9 24.735 26.625 15-19 24.26 24.515 24.625 26.6 20-24 23.875 24.85 24.455 26.82 25-29 24.05 24.404999999999998 24.705 26.840000000000003 30-34 23.98 24.945 24.905 26.169999999999998 35-39 23.435 24.834999999999997 24.785 26.945000000000004 40-44 24.27 24.154999999999998 24.58 26.995 45-49 24.335 23.98 24.495 27.189999999999998 50-54 23.765 24.725 24.39 27.12 55-59 24.335 24.64 24.5 26.525 60-64 24.585 24.715 24.310000000000002 26.39 65-69 24.785 24.610000000000003 24.22 26.384999999999998 70-74 24.474999999999998 24.48 23.915 27.13 75-79 24.89 24.4 24.15 26.56 80-84 24.605 24.240000000000002 24.375 26.779999999999998 85-89 25.25 24.115000000000002 24.099999999999998 26.534999999999997 90-94 24.98 24.2 23.535 27.284999999999997 95-99 25.564999999999998 23.955000000000002 23.549999999999997 26.93 100-104 25.324999999999996 23.565 24.345 26.765 105-109 25.455 23.98 23.82 26.745 110-114 25.715 23.995 24.355 25.935000000000002 115-119 26.155 23.330000000000002 23.885 26.63 120-124 25.56 23.565 23.885 26.99 125-129 25.77 23.595 23.880000000000003 26.755000000000003 130-134 26.939999999999998 23.23 23.57 26.26 135-139 25.724999999999998 23.875 23.68 26.72 140-144 26.05 23.189999999999998 23.974999999999998 26.784999999999997 145-149 26.150000000000002 23.34 24.404999999999998 26.105 150-151 27.450000000000003 23.125 22.85 26.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 3.0 27 5.5 28 4.5 29 5.0 30 7.0 31 12.5 32 20.0 33 25.0 34 31.0 35 36.0 36 43.0 37 64.5 38 79.0 39 90.0 40 106.5 41 125.5 42 136.0 43 145.0 44 166.5 45 183.5 46 181.5 47 162.0 48 160.5 49 151.0 50 138.5 51 134.5 52 127.0 53 116.0 54 103.5 55 96.0 56 84.0 57 87.0 58 87.0 59 79.5 60 82.0 61 91.0 62 86.0 63 78.5 64 76.0 65 75.0 66 75.0 67 62.0 68 57.0 69 55.0 70 46.0 71 40.5 72 37.5 73 32.0 74 33.0 75 27.5 76 14.5 77 10.0 78 7.0 79 5.0 80 3.0 81 2.0 82 2.5 83 1.0 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.82986019519916 89.875 2 4.90635716169876 9.3 3 0.21102611448166714 0.6 4 0.026378264310208392 0.1 5 0.026378264310208392 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.9125000000000001 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.3624999999999998 0.0 0.0 0.0 0.0 134-135 1.525 0.0 0.0 0.0 0.0 136-137 1.6749999999999998 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATCG 10 0.006830828 145.0 3 GATGCGG 10 0.006830828 145.0 145 AAAAGGT 10 0.006830828 145.0 3 AGGTACA 10 0.006830828 145.0 6 AAAAAGG 10 0.006830828 145.0 2 GGTACAT 10 0.006830828 145.0 7 >>END_MODULE SRR7804223 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804223_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0275 37.0 37.0 37.0 37.0 37.0 2 35.6885 37.0 37.0 37.0 37.0 37.0 3 35.7455 37.0 37.0 37.0 37.0 37.0 4 35.856 37.0 37.0 37.0 37.0 37.0 5 36.0905 37.0 37.0 37.0 37.0 37.0 6 35.7465 37.0 37.0 37.0 37.0 37.0 7 35.7765 37.0 37.0 37.0 37.0 37.0 8 35.969 37.0 37.0 37.0 37.0 37.0 9 35.939 37.0 37.0 37.0 37.0 37.0 10-14 35.8606 37.0 37.0 37.0 37.0 37.0 15-19 35.807100000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.778800000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.704699999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.6931 37.0 37.0 37.0 37.0 37.0 35-39 35.5715 37.0 37.0 37.0 37.0 37.0 40-44 35.5743 37.0 37.0 37.0 37.0 37.0 45-49 35.497299999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.468399999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.4625 37.0 37.0 37.0 37.0 37.0 60-64 35.2901 37.0 37.0 37.0 32.2 37.0 65-69 35.2663 37.0 37.0 37.0 34.6 37.0 70-74 35.2034 37.0 37.0 37.0 27.4 37.0 75-79 35.1909 37.0 37.0 37.0 27.4 37.0 80-84 35.13289999999999 37.0 37.0 37.0 25.0 37.0 85-89 35.025400000000005 37.0 37.0 37.0 25.0 37.0 90-94 34.97709999999999 37.0 37.0 37.0 25.0 37.0 95-99 34.779399999999995 37.0 37.0 37.0 25.0 37.0 100-104 34.7315 37.0 37.0 37.0 25.0 37.0 105-109 34.729299999999995 37.0 37.0 37.0 25.0 37.0 110-114 34.583999999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.443400000000004 37.0 37.0 37.0 25.0 37.0 120-124 34.4289 37.0 37.0 37.0 25.0 37.0 125-129 34.3164 37.0 37.0 37.0 25.0 37.0 130-134 34.2524 37.0 37.0 37.0 25.0 37.0 135-139 33.936099999999996 37.0 37.0 37.0 25.0 37.0 140-144 33.7994 37.0 37.0 37.0 25.0 37.0 145-149 33.6951 37.0 37.0 37.0 25.0 37.0 150-151 32.9815 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 4.0 15 4.0 16 1.0 17 3.0 18 3.0 19 3.0 20 4.0 21 4.0 22 8.0 23 9.0 24 14.0 25 11.0 26 11.0 27 24.0 28 38.0 29 46.0 30 65.0 31 92.0 32 134.0 33 201.0 34 424.0 35 1010.0 36 1829.0 37 53.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.475 12.825000000000001 11.575000000000001 38.125 2 28.799999999999997 18.85 30.45 21.9 3 24.375 21.825 25.900000000000002 27.900000000000002 4 27.875 29.5 17.65 24.975 5 27.55 31.8 18.525 22.125 6 22.675 33.125 18.075 26.125 7 21.7 13.350000000000001 37.625 27.325 8 22.7 19.375 22.2 35.725 9 24.175 20.424999999999997 25.074999999999996 30.325000000000003 10-14 26.565 23.93 21.765 27.74 15-19 26.14 23.555 22.835 27.47 20-24 26.875 23.165 23.1 26.86 25-29 26.534999999999997 23.615 23.025000000000002 26.825 30-34 26.505000000000003 23.705000000000002 22.830000000000002 26.96 35-39 26.375 23.73 22.585 27.310000000000002 40-44 26.685 23.580000000000002 22.275 27.46 45-49 26.825 23.485 22.795 26.895000000000003 50-54 26.815 24.48 22.134999999999998 26.57 55-59 26.58 23.565 22.665 27.189999999999998 60-64 26.845000000000002 23.200000000000003 22.3 27.655 65-69 27.33 23.669999999999998 22.045 26.955000000000002 70-74 26.32 23.935000000000002 22.470000000000002 27.275 75-79 27.029999999999998 24.505 22.175 26.290000000000003 80-84 27.11 23.87 22.115000000000002 26.905 85-89 27.465 22.830000000000002 22.805 26.900000000000002 90-94 26.875 23.215 22.54 27.37 95-99 26.724999999999998 23.48 23.0 26.795 100-104 27.605 23.335 22.305 26.755000000000003 105-109 27.405 23.54 21.665 27.389999999999997 110-114 27.555000000000003 23.47 22.355 26.619999999999997 115-119 27.16 23.419999999999998 22.575 26.845000000000002 120-124 27.150000000000002 23.285 22.585 26.979999999999997 125-129 27.445000000000004 23.885 22.085 26.584999999999997 130-134 28.249999999999996 23.435 22.165000000000003 26.150000000000002 135-139 27.63 23.200000000000003 22.71 26.46 140-144 28.544999999999998 23.775 21.785 25.895000000000003 145-149 28.075 23.46 22.48 25.985000000000003 150-151 27.800000000000004 24.337500000000002 22.0625 25.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 0.5 27 2.0 28 4.0 29 4.5 30 5.5 31 7.5 32 9.0 33 13.5 34 21.0 35 27.0 36 34.5 37 42.0 38 48.5 39 59.0 40 73.5 41 98.0 42 112.0 43 117.0 44 134.5 45 143.5 46 141.0 47 140.5 48 142.5 49 148.5 50 136.0 51 118.5 52 117.0 53 109.0 54 100.5 55 98.0 56 98.5 57 101.5 58 108.0 59 116.5 60 110.0 61 100.5 62 101.0 63 100.0 64 94.5 65 89.0 66 85.5 67 86.0 68 89.0 69 82.5 70 74.5 71 72.0 72 63.0 73 53.0 74 49.5 75 34.0 76 19.5 77 16.5 78 11.5 79 9.0 80 6.5 81 1.5 82 0.5 83 1.5 84 2.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.9260042283298 89.8 2 4.677589852008457 8.85 3 0.29069767441860467 0.8250000000000001 4 0.026427061310782242 0.1 5 0.052854122621564484 0.25 6 0.0 0.0 7 0.026427061310782242 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 7 0.17500000000000002 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.21250000000000002 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.75 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.2125 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.4625 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCTG 10 0.006830828 145.0 4 >>END_MODULE Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655893 spots for SRR7804223.sra Written 1655893 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra Read 1655874 spots for SRR7804223.sra Written 1655874 spots for SRR7804223.sra SRR ids: ['SRR7804223.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_51dy0kbf SRR7804223.sra spots: 33117499 blocks: [[1, 1655874], [1655875, 3311748], [3311749, 4967622], [4967623, 6623496], [6623497, 8279370], [8279371, 9935244], [9935245, 11591118], [11591119, 13246992], [13246993, 14902866], [14902867, 16558740], [16558741, 18214614], [18214615, 19870488], [19870489, 21526362], [21526363, 23182236], [23182237, 24838110], [24838111, 26493984], [26493985, 28149858], [28149859, 29805732], [29805733, 31461606], [31461607, 33117499]] SRR7804223 file size 11200733 SRR7804223 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804223 SRR7804223_1.fastq SRR7804223_2.fastq Input file: SRR7804223_1.fastq Paired file: SRR7804223_2.fastq trimmed: SRR7804223-trimmed-pair1.fastq, SRR7804223-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:27:33 2024 >> started Sat Dec 7 18:28:30 2024 >> done (57.564s) 33117499 read pairs processed; of these: 97 ( 0.00%) short read pairs filtered out after trimming by size control 712 ( 0.00%) empty read pairs filtered out after trimming by size control 33116690 (100.00%) read pairs available; of these: 1054842 ( 3.19%) trimmed read pairs available after processing 32061848 (96.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 14 0.00% 20 25 0.00% 21 22 0.00% 22 27 0.00% 23 39 0.00% 24 32 0.00% 25 42 0.00% 26 40 0.00% 27 50 0.00% 28 41 0.00% 29 44 0.00% 30 53 0.00% 31 50 0.00% 32 52 0.00% 33 56 0.00% 34 50 0.00% 35 75 0.00% 36 59 0.00% 37 63 0.00% 38 64 0.00% 39 61 0.00% 40 58 0.00% 41 60 0.00% 42 57 0.00% 43 67 0.00% 44 73 0.00% 45 68 0.00% 46 65 0.00% 47 76 0.00% 48 76 0.00% 49 84 0.00% 50 89 0.00% 51 78 0.00% 52 115 0.00% 53 116 0.00% 54 107 0.00% 55 112 0.00% 56 109 0.00% 57 123 0.00% 58 119 0.00% 59 119 0.00% 60 143 0.00% 61 156 0.00% 62 158 0.00% 63 163 0.00% 64 160 0.00% 65 175 0.00% 66 192 0.00% 67 198 0.00% 68 210 0.00% 69 228 0.00% 70 242 0.00% 71 270 0.00% 72 314 0.00% 73 312 0.00% 74 328 0.00% 75 402 0.00% 76 487 0.00% 77 468 0.00% 78 500 0.00% 79 639 0.00% 80 652 0.00% 81 763 0.00% 82 892 0.00% 83 1033 0.00% 84 1069 0.00% 85 1215 0.00% 86 1231 0.00% 87 1378 0.00% 88 1558 0.00% 89 1678 0.01% 90 1785 0.01% 91 2022 0.01% 92 2280 0.01% 93 2510 0.01% 94 2981 0.01% 95 3163 0.01% 96 3162 0.01% 97 3495 0.01% 98 3698 0.01% 99 4063 0.01% 100 4317 0.01% 101 4750 0.01% 102 5133 0.02% 103 5534 0.02% 104 5926 0.02% 105 6383 0.02% 106 6848 0.02% 107 7045 0.02% 108 7255 0.02% 109 7785 0.02% 110 7997 0.02% 111 8462 0.03% 112 9397 0.03% 113 9815 0.03% 114 10530 0.03% 115 11375 0.03% 116 11821 0.04% 117 12177 0.04% 118 12351 0.04% 119 13006 0.04% 120 13340 0.04% 121 14359 0.04% 122 14794 0.04% 123 16119 0.05% 124 17262 0.05% 125 18175 0.05% 126 18685 0.06% 127 19232 0.06% 128 19709 0.06% 129 20244 0.06% 130 20629 0.06% 131 21517 0.06% 132 22989 0.07% 133 24172 0.07% 134 25708 0.08% 135 26724 0.08% 136 27847 0.08% 137 28512 0.09% 138 29597 0.09% 139 30265 0.09% 140 30807 0.09% 141 31914 0.10% 142 33200 0.10% 143 33744 0.10% 144 35799 0.11% 145 37703 0.11% 146 38379 0.12% 147 40259 0.12% 148 41402 0.13% 149 41440 0.13% 150 43296 0.13% 151 32061848 96.81% 33116690 reads passed initial QC criterion=sequence-density sequence-density=1.25 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=23 prefix-density=1.29 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=164.89 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=9.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=9 prefix-density=0.93 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=190.33 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=10.8 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7804223 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:29:36 Started mapping on | Dec 07 18:29:36 Finished on | Dec 07 18:35:09 Mapping speed, Million of reads per hour | 358.02 Number of input reads | 33116690 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 31085875 Uniquely mapped reads % | 93.87% Average mapped length | 299.53 Number of splices: Total | 31184863 Number of splices: Annotated (sjdb) | 29384556 Number of splices: GT/AG | 30767750 Number of splices: GC/AG | 359479 Number of splices: AT/AC | 10587 Number of splices: Non-canonical | 47047 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352420 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 24958 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.38% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1678395 1678395 1678395 N_multimapping 352420 352420 352420 N_noFeature 903643 30197946 1123536 N_ambiguous 829278 5173 162472 UnstrandedReadsAssigned:29352954 PositiveStrandReadsAssigned:882756 NegativeStrandReadsAssigned:29799867 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804223 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804223-trimmed-pair1.fastq SRR7804223-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,116,690 reads, 30,171,690 reads pseudoaligned [quant] estimated average fragment length: 324.931 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52973 SRR7804223.ke.tsv 35125 SRR7804223.se.tsv 88098 total ==> SRR7804223.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 613.156 0 0 PNS24247 1044 720.069 48.92 2.77611 PNS24249 1928 1604.07 163.428 4.16321 PNS24246 1044 720.069 48.92 2.77611 PNS24248 1044 720.069 48.92 2.77611 PNS24244 1471 1147.07 132.812 4.73121 PNS24243 293 75.3882 0 0 KQK14069 1603 1279.07 24951.6 797.131 KQK14071 474 195.214 299.684 62.7302 ==> SRR7804223.se.tsv <== BRADI_1g14170v3 26803 BRADI_1g53295v3 40 BRADI_1g59795v3 771 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 3209 BRADI_1g74790v3 757 BRADI_1g09890v3 29 BRADI_1g77505v3 313 BRADI_1g48960v3 0 SRR7804223 completed mapping pipeline successfully