Starting /dee2/code/volunteer_pipeline.sh SRR7804224 current disk space = 1540711530496 free memory = 1414869776 SRR7804224 SRAfilesize f008d277d6b294c7fff1bc1e12245871 SRR7804224.sra SRR7804224.sra file validated SRR7804224 is paired end SRR7804224 is conventional basespace SRR7804224 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804224_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1575 37.0 37.0 37.0 37.0 37.0 2 36.2385 37.0 37.0 37.0 37.0 37.0 3 36.3755 37.0 37.0 37.0 37.0 37.0 4 36.4915 37.0 37.0 37.0 37.0 37.0 5 36.4965 37.0 37.0 37.0 37.0 37.0 6 36.5795 37.0 37.0 37.0 37.0 37.0 7 36.319 37.0 37.0 37.0 37.0 37.0 8 36.444 37.0 37.0 37.0 37.0 37.0 9 36.4015 37.0 37.0 37.0 37.0 37.0 10-14 36.5576 37.0 37.0 37.0 37.0 37.0 15-19 36.502599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.459700000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.426199999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3489 37.0 37.0 37.0 37.0 37.0 35-39 36.345 37.0 37.0 37.0 37.0 37.0 40-44 36.3119 37.0 37.0 37.0 37.0 37.0 45-49 36.2068 37.0 37.0 37.0 37.0 37.0 50-54 36.2081 37.0 37.0 37.0 37.0 37.0 55-59 36.1738 37.0 37.0 37.0 37.0 37.0 60-64 36.108999999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0925 37.0 37.0 37.0 37.0 37.0 70-74 36.0596 37.0 37.0 37.0 37.0 37.0 75-79 35.981899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0368 37.0 37.0 37.0 37.0 37.0 85-89 35.933800000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.888099999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8046 37.0 37.0 37.0 37.0 37.0 100-104 35.7705 37.0 37.0 37.0 37.0 37.0 105-109 35.7456 37.0 37.0 37.0 37.0 37.0 110-114 35.752300000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5314 37.0 37.0 37.0 37.0 37.0 120-124 35.4676 37.0 37.0 37.0 37.0 37.0 125-129 35.5473 37.0 37.0 37.0 37.0 37.0 130-134 35.4009 37.0 37.0 37.0 37.0 37.0 135-139 35.3192 37.0 37.0 37.0 34.6 37.0 140-144 35.3339 37.0 37.0 37.0 34.6 37.0 145-149 35.0741 37.0 37.0 37.0 27.4 37.0 150-151 34.4125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 5.0 25 9.0 26 7.0 27 15.0 28 23.0 29 33.0 30 26.0 31 56.0 32 70.0 33 118.0 34 192.0 35 461.0 36 2752.0 37 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.55182774161242 12.093139709564346 10.165247871807711 43.189784677015524 2 23.799999999999997 17.724999999999998 36.675000000000004 21.8 3 23.325000000000003 22.825 23.474999999999998 30.375000000000004 4 27.400000000000002 30.0 18.175 24.425 5 26.3 33.35 21.224999999999998 19.125 6 20.724999999999998 33.375 22.0 23.9 7 16.925 19.2 39.975 23.9 8 20.75 20.575 26.174999999999997 32.5 9 21.625 18.875 30.575000000000003 28.925 10-14 23.369999999999997 25.180000000000003 24.41 27.04 15-19 24.035 24.08 25.074999999999996 26.810000000000002 20-24 24.16 24.18 25.21 26.450000000000003 25-29 24.395 24.945 24.245 26.415 30-34 24.104999999999997 24.285 24.404999999999998 27.205000000000002 35-39 23.465 24.845 24.41 27.279999999999998 40-44 24.085 24.605 24.535 26.775 45-49 23.955000000000002 24.45 24.68 26.915 50-54 24.044999999999998 24.759999999999998 24.01 27.185 55-59 24.065 24.535 24.21 27.189999999999998 60-64 24.635 24.485 24.104999999999997 26.775 65-69 24.485 24.27 24.79 26.455000000000002 70-74 24.695 24.224999999999998 24.545 26.534999999999997 75-79 24.855 23.599999999999998 24.474999999999998 27.07 80-84 25.03 24.365000000000002 23.835 26.77 85-89 24.64 24.005000000000003 24.4 26.955000000000002 90-94 24.66 23.990000000000002 23.93 27.42 95-99 24.95 23.835 24.154999999999998 27.060000000000002 100-104 25.66 24.05 24.2 26.090000000000003 105-109 25.115 24.154999999999998 23.775 26.955000000000002 110-114 24.985 23.919999999999998 23.84 27.255000000000003 115-119 25.155 23.915 24.04 26.889999999999997 120-124 25.195 23.985 23.535 27.284999999999997 125-129 25.155 23.45 24.165 27.229999999999997 130-134 25.66 23.755000000000003 23.474999999999998 27.11 135-139 25.14 23.580000000000002 24.255 27.025 140-144 25.88 23.064999999999998 23.669999999999998 27.384999999999998 145-149 26.029999999999998 23.075000000000003 23.825 27.07 150-151 26.487500000000004 23.075000000000003 22.55 27.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 0.5 25 0.5 26 1.0 27 1.5 28 2.0 29 3.5 30 5.0 31 8.5 32 14.0 33 16.5 34 21.5 35 32.5 36 47.0 37 61.0 38 91.0 39 102.0 40 99.0 41 124.5 42 133.0 43 141.0 44 167.5 45 173.0 46 161.0 47 173.0 48 192.0 49 182.0 50 148.0 51 117.5 52 120.0 53 120.0 54 109.5 55 105.0 56 100.0 57 95.0 58 88.0 59 88.0 60 88.5 61 79.0 62 67.0 63 66.0 64 70.0 65 69.0 66 65.0 67 61.0 68 56.0 69 53.0 70 55.0 71 45.5 72 35.0 73 32.0 74 27.5 75 26.0 76 18.5 77 11.0 78 10.0 79 7.5 80 5.0 81 2.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 95.66013071895425 91.475 2 4.104575163398693 7.85 3 0.2352941176470588 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.8374999999999999 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 1.0 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.3624999999999998 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804224 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804224_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.11 37.0 37.0 37.0 37.0 37.0 2 35.9435 37.0 37.0 37.0 37.0 37.0 3 36.119 37.0 37.0 37.0 37.0 37.0 4 36.2385 37.0 37.0 37.0 37.0 37.0 5 36.204 37.0 37.0 37.0 37.0 37.0 6 36.1335 37.0 37.0 37.0 37.0 37.0 7 36.105 37.0 37.0 37.0 37.0 37.0 8 36.1645 37.0 37.0 37.0 37.0 37.0 9 36.2095 37.0 37.0 37.0 37.0 37.0 10-14 36.151599999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.001900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.0122 37.0 37.0 37.0 37.0 37.0 25-29 36.0028 37.0 37.0 37.0 37.0 37.0 30-34 35.8979 37.0 37.0 37.0 37.0 37.0 35-39 35.8343 37.0 37.0 37.0 37.0 37.0 40-44 35.8339 37.0 37.0 37.0 37.0 37.0 45-49 35.7477 37.0 37.0 37.0 37.0 37.0 50-54 35.7386 37.0 37.0 37.0 37.0 37.0 55-59 35.7641 37.0 37.0 37.0 37.0 37.0 60-64 35.55839999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.4469 37.0 37.0 37.0 37.0 37.0 70-74 35.5084 37.0 37.0 37.0 37.0 37.0 75-79 35.494299999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.3937 37.0 37.0 37.0 37.0 37.0 85-89 35.3288 37.0 37.0 37.0 34.6 37.0 90-94 35.19019999999999 37.0 37.0 37.0 27.4 37.0 95-99 35.13119999999999 37.0 37.0 37.0 25.0 37.0 100-104 35.0876 37.0 37.0 37.0 25.0 37.0 105-109 35.0175 37.0 37.0 37.0 25.0 37.0 110-114 34.9191 37.0 37.0 37.0 25.0 37.0 115-119 34.8634 37.0 37.0 37.0 25.0 37.0 120-124 34.7778 37.0 37.0 37.0 25.0 37.0 125-129 34.6177 37.0 37.0 37.0 25.0 37.0 130-134 34.5974 37.0 37.0 37.0 25.0 37.0 135-139 34.345600000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.2122 37.0 37.0 37.0 25.0 37.0 145-149 34.1457 37.0 37.0 37.0 25.0 37.0 150-151 33.386 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 6.0 15 2.0 16 3.0 17 1.0 18 3.0 19 0.0 20 6.0 21 2.0 22 6.0 23 6.0 24 8.0 25 8.0 26 18.0 27 23.0 28 19.0 29 44.0 30 44.0 31 76.0 32 107.0 33 156.0 34 342.0 35 888.0 36 2154.0 37 77.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.725 11.924999999999999 12.575 41.775 2 29.25 18.375 30.875000000000004 21.5 3 24.675 21.75 25.874999999999996 27.700000000000003 4 28.425 29.525000000000002 17.875 24.175 5 29.625 30.65 18.175 21.55 6 21.15 34.4 18.75 25.7 7 21.9 14.099999999999998 36.95 27.05 8 22.975 18.65 23.5 34.875 9 23.974999999999998 20.025000000000002 24.75 31.25 10-14 26.529999999999998 24.044999999999998 21.709999999999997 27.715 15-19 26.534999999999997 23.615 22.52 27.33 20-24 26.38 24.26 22.275 27.084999999999997 25-29 26.705000000000002 23.9 22.355 27.04 30-34 26.325 23.599999999999998 22.705000000000002 27.37 35-39 26.595000000000002 24.154999999999998 22.27 26.979999999999997 40-44 27.345000000000002 23.74 22.455 26.46 45-49 27.025 23.080000000000002 23.169999999999998 26.724999999999998 50-54 27.77 23.47 22.785 25.974999999999998 55-59 26.875 23.965 22.24 26.919999999999998 60-64 27.35 23.474999999999998 22.865 26.31 65-69 26.919999999999998 23.724999999999998 23.085 26.27 70-74 27.575 23.635 22.56 26.229999999999997 75-79 26.99 23.919999999999998 22.475 26.615 80-84 27.725 23.3 22.53 26.445 85-89 27.634999999999998 23.555 22.625 26.185000000000002 90-94 27.615000000000002 23.189999999999998 22.505 26.69 95-99 27.96 23.965 22.34 25.735000000000003 100-104 27.794999999999998 22.93 23.14 26.135 105-109 27.915 23.65 22.46 25.974999999999998 110-114 27.055 23.369999999999997 22.770000000000003 26.805 115-119 27.395000000000003 23.825 22.365 26.415 120-124 27.400000000000002 23.799999999999997 22.720000000000002 26.08 125-129 27.955000000000002 23.880000000000003 22.220000000000002 25.945 130-134 27.860000000000003 23.94 22.735 25.465 135-139 27.889999999999997 23.855 22.445 25.81 140-144 27.37 23.815 23.025000000000002 25.790000000000003 145-149 28.035 24.18 22.625 25.16 150-151 28.3875 24.625 21.75 25.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.5 28 1.5 29 2.0 30 3.0 31 5.0 32 11.0 33 12.5 34 15.5 35 17.5 36 20.5 37 35.5 38 50.0 39 65.0 40 89.0 41 114.0 42 122.5 43 135.5 44 141.5 45 136.5 46 146.0 47 147.5 48 151.5 49 149.0 50 123.5 51 113.5 52 116.0 53 104.5 54 98.0 55 94.0 56 94.0 57 104.5 58 113.5 59 108.0 60 97.0 61 93.5 62 91.5 63 102.0 64 109.5 65 103.5 66 94.0 67 89.5 68 80.5 69 77.5 70 80.0 71 69.5 72 57.5 73 41.5 74 37.0 75 39.5 76 30.0 77 20.0 78 11.0 79 6.0 80 4.5 81 3.5 82 3.0 83 1.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 95.34822601839684 90.7 2 4.31011826544021 8.200000000000001 3 0.2628120893561104 0.75 4 0.052562417871222074 0.2 5 0.0 0.0 6 0.026281208935611037 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.3624999999999998 0.0 0.0 0.0 0.0 136-137 1.4874999999999998 0.0 0.0 0.0 0.0 138-139 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGGAA 10 0.006830828 145.0 8 >>END_MODULE Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447204 spots for SRR7804224.sra Written 1447204 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra Read 1447202 spots for SRR7804224.sra Written 1447202 spots for SRR7804224.sra SRR ids: ['SRR7804224.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_67ctrvf_ SRR7804224.sra spots: 28944042 blocks: [[1, 1447202], [1447203, 2894404], [2894405, 4341606], [4341607, 5788808], [5788809, 7236010], [7236011, 8683212], [8683213, 10130414], [10130415, 11577616], [11577617, 13024818], [13024819, 14472020], [14472021, 15919222], [15919223, 17366424], [17366425, 18813626], [18813627, 20260828], [20260829, 21708030], [21708031, 23155232], [23155233, 24602434], [24602435, 26049636], [26049637, 27496838], [27496839, 28944042]] SRR7804224 file size 9786485 SRR7804224 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804224 SRR7804224_1.fastq SRR7804224_2.fastq Input file: SRR7804224_1.fastq Paired file: SRR7804224_2.fastq trimmed: SRR7804224-trimmed-pair1.fastq, SRR7804224-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:26:26 2024 >> started Sat Dec 7 18:27:36 2024 >> done (70.681s) 28944042 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 654 ( 0.00%) empty read pairs filtered out after trimming by size control 28943293 (100.00%) read pairs available; of these: 764961 ( 2.64%) trimmed read pairs available after processing 28178332 (97.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 20 0.00% 20 16 0.00% 21 19 0.00% 22 22 0.00% 23 21 0.00% 24 22 0.00% 25 28 0.00% 26 30 0.00% 27 41 0.00% 28 35 0.00% 29 34 0.00% 30 50 0.00% 31 47 0.00% 32 65 0.00% 33 38 0.00% 34 66 0.00% 35 62 0.00% 36 50 0.00% 37 55 0.00% 38 59 0.00% 39 67 0.00% 40 62 0.00% 41 66 0.00% 42 75 0.00% 43 68 0.00% 44 60 0.00% 45 79 0.00% 46 64 0.00% 47 75 0.00% 48 77 0.00% 49 98 0.00% 50 100 0.00% 51 67 0.00% 52 80 0.00% 53 106 0.00% 54 118 0.00% 55 98 0.00% 56 98 0.00% 57 104 0.00% 58 88 0.00% 59 115 0.00% 60 136 0.00% 61 111 0.00% 62 120 0.00% 63 131 0.00% 64 137 0.00% 65 156 0.00% 66 131 0.00% 67 164 0.00% 68 124 0.00% 69 176 0.00% 70 185 0.00% 71 235 0.00% 72 239 0.00% 73 279 0.00% 74 255 0.00% 75 279 0.00% 76 352 0.00% 77 344 0.00% 78 345 0.00% 79 466 0.00% 80 443 0.00% 81 499 0.00% 82 562 0.00% 83 593 0.00% 84 679 0.00% 85 795 0.00% 86 918 0.00% 87 931 0.00% 88 1059 0.00% 89 1128 0.00% 90 1303 0.00% 91 1362 0.00% 92 1554 0.01% 93 1726 0.01% 94 1916 0.01% 95 2096 0.01% 96 2224 0.01% 97 2350 0.01% 98 2686 0.01% 99 2847 0.01% 100 3115 0.01% 101 3236 0.01% 102 3538 0.01% 103 3812 0.01% 104 3892 0.01% 105 4383 0.02% 106 4847 0.02% 107 4910 0.02% 108 5248 0.02% 109 5576 0.02% 110 5927 0.02% 111 6208 0.02% 112 6703 0.02% 113 6934 0.02% 114 7448 0.03% 115 7888 0.03% 116 8335 0.03% 117 8568 0.03% 118 9052 0.03% 119 9585 0.03% 120 9762 0.03% 121 10466 0.04% 122 10785 0.04% 123 11528 0.04% 124 12286 0.04% 125 12720 0.04% 126 13098 0.05% 127 13807 0.05% 128 14376 0.05% 129 14861 0.05% 130 15252 0.05% 131 15911 0.05% 132 16854 0.06% 133 17536 0.06% 134 18269 0.06% 135 19416 0.07% 136 20172 0.07% 137 20431 0.07% 138 20843 0.07% 139 22246 0.08% 140 22489 0.08% 141 23411 0.08% 142 24648 0.09% 143 25371 0.09% 144 25940 0.09% 145 27243 0.09% 146 28212 0.10% 147 29068 0.10% 148 30700 0.11% 149 30677 0.11% 150 32786 0.11% 151 28178332 97.36% 28943293 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=20 prefix-density=0.79 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=157.02 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=10.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=15 prefix-density=0.61 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=26.95 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804224 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:29:05 Started mapping on | Dec 07 18:29:05 Finished on | Dec 07 18:33:27 Mapping speed, Million of reads per hour | 397.69 Number of input reads | 28943293 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 27378494 Uniquely mapped reads % | 94.59% Average mapped length | 299.83 Number of splices: Total | 27876599 Number of splices: Annotated (sjdb) | 26272563 Number of splices: GT/AG | 27495916 Number of splices: GC/AG | 317916 Number of splices: AT/AC | 11969 Number of splices: Non-canonical | 50798 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370127 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 28900 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1194672 1194672 1194672 N_multimapping 370127 370127 370127 N_noFeature 858673 26574515 1089187 N_ambiguous 700141 4624 127230 UnstrandedReadsAssigned:25819680 PositiveStrandReadsAssigned:799355 NegativeStrandReadsAssigned:26162077 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804224 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804224-trimmed-pair1.fastq SRR7804224-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,943,293 reads, 26,355,150 reads pseudoaligned [quant] estimated average fragment length: 327.423 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52973 SRR7804224.ke.tsv 35125 SRR7804224.se.tsv 88098 total ==> SRR7804224.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 610.564 0 0 PNS24247 1044 717.577 76.7603 4.94674 PNS24249 1928 1601.58 200.458 5.78798 PNS24246 1044 717.577 76.7603 4.94674 PNS24248 1044 717.577 76.7603 4.94674 PNS24244 1471 1144.58 133.261 5.38406 PNS24243 293 71.9487 0 0 KQK14069 1603 1276.58 15525.4 562.402 KQK14071 474 191.514 255.711 61.7447 ==> SRR7804224.se.tsv <== BRADI_1g14170v3 17236 BRADI_1g53295v3 1532 BRADI_1g59795v3 873 BRADI_1g07683v3 0 BRADI_1g00485v3 35 BRADI_1g20270v3 1762 BRADI_1g74790v3 932 BRADI_1g09890v3 11 BRADI_1g77505v3 384 BRADI_1g48960v3 1 SRR7804224 completed mapping pipeline successfully