Starting /dee2/code/volunteer_pipeline.sh SRR7804225 current disk space = 1540471255040 free memory = 1600996184 SRR7804225 SRAfilesize c330ff8ebb27ae600530d055087d625b SRR7804225.sra SRR7804225.sra file validated SRR7804225 is paired end SRR7804225 is conventional basespace SRR7804225 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804225_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.15625 37.0 37.0 37.0 37.0 37.0 2 36.194 37.0 37.0 37.0 37.0 37.0 3 36.3565 37.0 37.0 37.0 37.0 37.0 4 36.4855 37.0 37.0 37.0 37.0 37.0 5 36.3755 37.0 37.0 37.0 37.0 37.0 6 36.458 37.0 37.0 37.0 37.0 37.0 7 36.3575 37.0 37.0 37.0 37.0 37.0 8 36.43 37.0 37.0 37.0 37.0 37.0 9 36.4885 37.0 37.0 37.0 37.0 37.0 10-14 36.4408 37.0 37.0 37.0 37.0 37.0 15-19 36.4542 37.0 37.0 37.0 37.0 37.0 20-24 36.4307 37.0 37.0 37.0 37.0 37.0 25-29 36.373000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3461 37.0 37.0 37.0 37.0 37.0 35-39 36.309400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.286 37.0 37.0 37.0 37.0 37.0 45-49 36.200900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2226 37.0 37.0 37.0 37.0 37.0 55-59 36.1667 37.0 37.0 37.0 37.0 37.0 60-64 36.1541 37.0 37.0 37.0 37.0 37.0 65-69 36.1716 37.0 37.0 37.0 37.0 37.0 70-74 36.0861 37.0 37.0 37.0 37.0 37.0 75-79 36.0683 37.0 37.0 37.0 37.0 37.0 80-84 36.0596 37.0 37.0 37.0 37.0 37.0 85-89 35.983999999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9334 37.0 37.0 37.0 37.0 37.0 95-99 35.8344 37.0 37.0 37.0 37.0 37.0 100-104 35.8231 37.0 37.0 37.0 37.0 37.0 105-109 35.752 37.0 37.0 37.0 37.0 37.0 110-114 35.8122 37.0 37.0 37.0 37.0 37.0 115-119 35.6355 37.0 37.0 37.0 37.0 37.0 120-124 35.541399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5413 37.0 37.0 37.0 37.0 37.0 130-134 35.376799999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.303399999999996 37.0 37.0 37.0 29.8 37.0 140-144 35.3529 37.0 37.0 37.0 32.2 37.0 145-149 35.1221 37.0 37.0 37.0 27.4 37.0 150-151 34.448750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 7.0 26 14.0 27 8.0 28 21.0 29 22.0 30 39.0 31 79.0 32 75.0 33 101.0 34 168.0 35 446.0 36 2797.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.589370769616444 12.760090248182502 7.169716720982702 38.48082226121835 2 23.849999999999998 17.2 37.025000000000006 21.925 3 21.3 23.1 25.25 30.349999999999998 4 27.0 29.5 20.45 23.05 5 25.05 33.45 22.3 19.2 6 20.424999999999997 32.5 24.425 22.650000000000002 7 17.325 19.175 41.949999999999996 21.55 8 19.575 19.975 28.4 32.05 9 21.0 17.825 31.775 29.4 10-14 23.68 26.029999999999998 24.45 25.840000000000003 15-19 23.16 24.935 25.509999999999998 26.395000000000003 20-24 23.44 25.095 25.64 25.825 25-29 23.87 25.335 24.955 25.840000000000003 30-34 23.43 25.014999999999997 25.35 26.205000000000002 35-39 24.125 24.64 25.09 26.145000000000003 40-44 23.919999999999998 25.290000000000003 24.41 26.38 45-49 24.45 24.82 24.505 26.224999999999998 50-54 24.205 24.654999999999998 24.834999999999997 26.305 55-59 24.45 25.045 24.525 25.979999999999997 60-64 24.485 24.845 24.515 26.155 65-69 23.925 25.09 24.279999999999998 26.705000000000002 70-74 24.41 24.515 24.915000000000003 26.16 75-79 24.59 24.425 24.365000000000002 26.619999999999997 80-84 23.82 24.795 24.69 26.695 85-89 24.54 24.265 24.59 26.605 90-94 24.815 24.12 24.255 26.810000000000002 95-99 24.115000000000002 24.72 24.4 26.765 100-104 24.73 24.645 24.14 26.484999999999996 105-109 24.625 24.154999999999998 24.315 26.905 110-114 24.48 24.04 24.22 27.26 115-119 25.330000000000002 24.154999999999998 24.145 26.369999999999997 120-124 25.014999999999997 24.275 24.735 25.974999999999998 125-129 24.46 23.575 24.610000000000003 27.355 130-134 24.855 24.62 24.355 26.169999999999998 135-139 24.959999999999997 24.525 24.275 26.240000000000002 140-144 25.205 24.195 24.044999999999998 26.555 145-149 25.405 23.84 24.215 26.540000000000003 150-151 25.687500000000004 23.25 24.425 26.637499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 1.5 27 1.0 28 2.5 29 3.5 30 5.0 31 8.0 32 11.5 33 21.0 34 28.0 35 35.0 36 58.5 37 70.5 38 73.5 39 99.0 40 118.5 41 129.5 42 147.5 43 164.5 44 175.0 45 175.5 46 180.5 47 184.5 48 181.5 49 165.0 50 144.5 51 135.0 52 124.0 53 108.5 54 103.5 55 105.5 56 100.5 57 102.0 58 107.5 59 98.0 60 81.5 61 77.0 62 75.0 63 64.0 64 52.0 65 53.5 66 58.5 67 56.0 68 53.5 69 49.5 70 43.5 71 36.0 72 27.5 73 20.5 74 19.0 75 15.0 76 8.5 77 9.5 78 9.0 79 5.0 80 5.0 81 3.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.55 #Duplication Level Percentage of deduplicated Percentage of total 1 95.578231292517 91.325 2 4.1862899005756145 8.0 3 0.23547880690737832 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.0125 0.0 0.0 0.0 0.025 96-97 0.037500000000000006 0.0 0.0 0.0 0.025 98-99 0.05 0.0 0.0 0.0 0.025 100-101 0.05 0.0 0.0 0.0 0.025 102-103 0.05 0.0 0.0 0.0 0.025 104-105 0.07500000000000001 0.0 0.0 0.0 0.025 106-107 0.1 0.0 0.0 0.0 0.025 108-109 0.1 0.0 0.0 0.0 0.025 110-111 0.1 0.0 0.0 0.0 0.025 112-113 0.125 0.0 0.0 0.0 0.025 114-115 0.15 0.0 0.0 0.0 0.025 116-117 0.15 0.0 0.0 0.0 0.025 118-119 0.2 0.0 0.0 0.0 0.025 120-121 0.21250000000000002 0.0 0.0 0.0 0.025 122-123 0.275 0.0 0.0 0.0 0.025 124-125 0.375 0.0 0.0 0.0 0.025 126-127 0.4625 0.0 0.0 0.0 0.025 128-129 0.6125 0.0 0.0 0.0 0.025 130-131 0.7375 0.0 0.0 0.0 0.025 132-133 0.9 0.0 0.0 0.0 0.025 134-135 1.0875 0.0 0.0 0.0 0.025 136-137 1.225 0.0 0.0 0.0 0.025 138-139 1.4125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCGCG 10 0.006830828 145.0 7 >>END_MODULE SRR7804225 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804225_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5035 37.0 37.0 37.0 37.0 37.0 2 36.2955 37.0 37.0 37.0 37.0 37.0 3 36.293 37.0 37.0 37.0 37.0 37.0 4 36.408 37.0 37.0 37.0 37.0 37.0 5 36.45 37.0 37.0 37.0 37.0 37.0 6 36.3405 37.0 37.0 37.0 37.0 37.0 7 36.2435 37.0 37.0 37.0 37.0 37.0 8 36.401 37.0 37.0 37.0 37.0 37.0 9 36.4315 37.0 37.0 37.0 37.0 37.0 10-14 36.383300000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.261399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.2297 37.0 37.0 37.0 37.0 37.0 25-29 36.2067 37.0 37.0 37.0 37.0 37.0 30-34 36.2008 37.0 37.0 37.0 37.0 37.0 35-39 36.14020000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.1055 37.0 37.0 37.0 37.0 37.0 45-49 36.0454 37.0 37.0 37.0 37.0 37.0 50-54 36.128 37.0 37.0 37.0 37.0 37.0 55-59 36.0826 37.0 37.0 37.0 37.0 37.0 60-64 35.987 37.0 37.0 37.0 37.0 37.0 65-69 35.9037 37.0 37.0 37.0 37.0 37.0 70-74 35.890499999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.949400000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.7726 37.0 37.0 37.0 37.0 37.0 85-89 35.7987 37.0 37.0 37.0 37.0 37.0 90-94 35.701499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.6629 37.0 37.0 37.0 37.0 37.0 100-104 35.570499999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.59009999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.4411 37.0 37.0 37.0 37.0 37.0 115-119 35.3279 37.0 37.0 37.0 34.6 37.0 120-124 35.3251 37.0 37.0 37.0 32.2 37.0 125-129 35.2587 37.0 37.0 37.0 32.2 37.0 130-134 35.1441 37.0 37.0 37.0 27.4 37.0 135-139 35.0796 37.0 37.0 37.0 25.0 37.0 140-144 34.8631 37.0 37.0 37.0 25.0 37.0 145-149 34.765299999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.20525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 1.0 16 8.0 17 0.0 18 0.0 19 0.0 20 2.0 21 6.0 22 3.0 23 9.0 24 4.0 25 11.0 26 8.0 27 19.0 28 16.0 29 23.0 30 23.0 31 45.0 32 66.0 33 101.0 34 201.0 35 642.0 36 2660.0 37 146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.15 14.35 8.9 37.6 2 26.575 20.95 31.924999999999997 20.549999999999997 3 23.525 23.05 26.85 26.575 4 27.1 30.575000000000003 19.025 23.3 5 29.15 31.8 18.2 20.849999999999998 6 22.2 32.475 19.6 25.724999999999998 7 21.5 15.1 37.45 25.95 8 21.825 19.475 23.474999999999998 35.225 9 23.799999999999997 19.575 26.150000000000002 30.475 10-14 25.665 24.779999999999998 22.28 27.275 15-19 26.3 23.91 23.244999999999997 26.545 20-24 25.790000000000003 24.44 23.13 26.640000000000004 25-29 27.189999999999998 23.794999999999998 22.91 26.105 30-34 26.375 24.135 23.0 26.490000000000002 35-39 26.889999999999997 24.165 23.1 25.845000000000002 40-44 26.32 24.775 22.81 26.095000000000002 45-49 26.755000000000003 24.065 22.85 26.33 50-54 26.51 24.224999999999998 23.395 25.869999999999997 55-59 27.21 23.724999999999998 22.82 26.245 60-64 26.645000000000003 24.245 22.54 26.57 65-69 26.66 24.529999999999998 23.24 25.569999999999997 70-74 26.91 24.26 22.945 25.885 75-79 26.424999999999997 23.895 23.625 26.055 80-84 26.584999999999997 24.12 22.720000000000002 26.575 85-89 26.72 24.765 22.53 25.985000000000003 90-94 26.75 24.12 23.06 26.07 95-99 26.11 24.38 23.66 25.85 100-104 26.889999999999997 23.925 23.06 26.125 105-109 27.015 23.945 22.99 26.05 110-114 26.52 24.275 23.18 26.025 115-119 26.855 24.285 22.830000000000002 26.029999999999998 120-124 27.05 24.115000000000002 22.975 25.86 125-129 26.965 24.5 22.93 25.605 130-134 27.034999999999997 24.665 23.05 25.25 135-139 26.955000000000002 24.845 23.45 24.75 140-144 27.105 24.779999999999998 23.29 24.825 145-149 27.405 24.84 22.82 24.935 150-151 26.8125 24.587500000000002 23.075000000000003 25.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 2.0 21 1.0 22 0.0 23 1.0 24 1.5 25 2.0 26 2.5 27 1.5 28 1.5 29 3.0 30 5.5 31 6.0 32 7.0 33 9.5 34 15.0 35 23.0 36 31.0 37 41.5 38 55.5 39 72.5 40 89.5 41 103.5 42 118.0 43 124.0 44 145.5 45 159.5 46 170.0 47 176.5 48 165.0 49 156.0 50 128.0 51 135.0 52 137.5 53 108.0 54 105.0 55 100.5 56 90.0 57 90.5 58 100.0 59 97.5 60 91.0 61 103.5 62 108.0 63 104.5 64 93.5 65 83.0 66 81.0 67 77.0 68 76.0 69 71.5 70 69.5 71 58.5 72 40.0 73 38.0 74 35.0 75 28.0 76 18.5 77 11.0 78 9.0 79 5.0 80 2.5 81 1.5 82 2.0 83 1.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.67723342939482 91.3 2 3.9821849620120515 7.6 3 0.2619858527639507 0.75 4 0.026198585276395077 0.1 5 0.052397170552790154 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.07500000000000001 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.21250000000000002 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.4625 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.9 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.225 0.0 0.0 0.0 0.0 138-139 1.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 30 0.0014437955 24.166668 20-24 >>END_MODULE Read 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234346 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234346 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra Read 1234332 spots for SRR7804225.sra Written 1234332 spots for SRR7804225.sra SRR ids: ['SRR7804225.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b8oyz6ie SRR7804225.sra spots: 24686654 blocks: [[1, 1234332], [1234333, 2468664], [2468665, 3702996], [3702997, 4937328], [4937329, 6171660], [6171661, 7405992], [7405993, 8640324], [8640325, 9874656], [9874657, 11108988], [11108989, 12343320], [12343321, 13577652], [13577653, 14811984], [14811985, 16046316], [16046317, 17280648], [17280649, 18514980], [18514981, 19749312], [19749313, 20983644], [20983645, 22217976], [22217977, 23452308], [23452309, 24686654]] SRR7804225 file size 8343796 SRR7804225 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804225 SRR7804225_1.fastq SRR7804225_2.fastq Input file: SRR7804225_1.fastq Paired file: SRR7804225_2.fastq trimmed: SRR7804225-trimmed-pair1.fastq, SRR7804225-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:46:02 2024 >> started Sat Dec 7 18:47:49 2024 >> done (107.078s) 24686654 read pairs processed; of these: 71 ( 0.00%) short read pairs filtered out after trimming by size control 431 ( 0.00%) empty read pairs filtered out after trimming by size control 24686152 (100.00%) read pairs available; of these: 525422 ( 2.13%) trimmed read pairs available after processing 24160730 (97.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 13 0.00% 20 15 0.00% 21 12 0.00% 22 24 0.00% 23 21 0.00% 24 23 0.00% 25 28 0.00% 26 19 0.00% 27 31 0.00% 28 33 0.00% 29 32 0.00% 30 35 0.00% 31 45 0.00% 32 32 0.00% 33 40 0.00% 34 43 0.00% 35 48 0.00% 36 35 0.00% 37 43 0.00% 38 52 0.00% 39 55 0.00% 40 51 0.00% 41 46 0.00% 42 48 0.00% 43 48 0.00% 44 52 0.00% 45 56 0.00% 46 61 0.00% 47 54 0.00% 48 78 0.00% 49 65 0.00% 50 52 0.00% 51 70 0.00% 52 52 0.00% 53 69 0.00% 54 68 0.00% 55 83 0.00% 56 77 0.00% 57 70 0.00% 58 85 0.00% 59 74 0.00% 60 83 0.00% 61 83 0.00% 62 83 0.00% 63 78 0.00% 64 96 0.00% 65 110 0.00% 66 98 0.00% 67 110 0.00% 68 124 0.00% 69 109 0.00% 70 139 0.00% 71 142 0.00% 72 165 0.00% 73 176 0.00% 74 132 0.00% 75 158 0.00% 76 193 0.00% 77 214 0.00% 78 203 0.00% 79 249 0.00% 80 241 0.00% 81 272 0.00% 82 304 0.00% 83 367 0.00% 84 417 0.00% 85 440 0.00% 86 486 0.00% 87 540 0.00% 88 584 0.00% 89 596 0.00% 90 695 0.00% 91 781 0.00% 92 869 0.00% 93 993 0.00% 94 1125 0.00% 95 1121 0.00% 96 1309 0.01% 97 1370 0.01% 98 1530 0.01% 99 1551 0.01% 100 1650 0.01% 101 1816 0.01% 102 1922 0.01% 103 2257 0.01% 104 2370 0.01% 105 2609 0.01% 106 2724 0.01% 107 2843 0.01% 108 3111 0.01% 109 3335 0.01% 110 3490 0.01% 111 3785 0.02% 112 3910 0.02% 113 4356 0.02% 114 4561 0.02% 115 4938 0.02% 116 5216 0.02% 117 5445 0.02% 118 5872 0.02% 119 6027 0.02% 120 6358 0.03% 121 6808 0.03% 122 7071 0.03% 123 7604 0.03% 124 7914 0.03% 125 8536 0.03% 126 8809 0.04% 127 9126 0.04% 128 9499 0.04% 129 10225 0.04% 130 10331 0.04% 131 11054 0.04% 132 11603 0.05% 133 12207 0.05% 134 12847 0.05% 135 13452 0.05% 136 14130 0.06% 137 14638 0.06% 138 15182 0.06% 139 15626 0.06% 140 15878 0.06% 141 16864 0.07% 142 17475 0.07% 143 18093 0.07% 144 19166 0.08% 145 20198 0.08% 146 20829 0.08% 147 21826 0.09% 148 22440 0.09% 149 23045 0.09% 150 24063 0.10% 151 24160730 97.87% 24686152 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=20 prefix-density=0.71 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=163.16 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=12.7 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=20 prefix-density=0.53 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=28.28 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.8 sequence=TGGGCCATGCTTGGTGCCCTCGGCTGCGTCTTCCCCGAGCTGCT SRR7804225 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:54:13 Started mapping on | Dec 07 18:54:13 Finished on | Dec 07 18:58:20 Mapping speed, Million of reads per hour | 359.80 Number of input reads | 24686152 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 23203567 Uniquely mapped reads % | 93.99% Average mapped length | 300.09 Number of splices: Total | 24446490 Number of splices: Annotated (sjdb) | 23076171 Number of splices: GT/AG | 24113250 Number of splices: GC/AG | 272298 Number of splices: AT/AC | 10530 Number of splices: Non-canonical | 50412 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313385 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 19322 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1169200 1169200 1169200 N_multimapping 313385 313385 313385 N_noFeature 729171 22520816 948214 N_ambiguous 568214 4341 104776 UnstrandedReadsAssigned:21906182 PositiveStrandReadsAssigned:678410 NegativeStrandReadsAssigned:22150577 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804225 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804225-trimmed-pair1.fastq SRR7804225-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,686,152 reads, 22,302,057 reads pseudoaligned [quant] estimated average fragment length: 335.453 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52973 SRR7804225.ke.tsv 35125 SRR7804225.se.tsv 88098 total ==> SRR7804225.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 602.858 0 0 PNS24247 1044 709.547 101.265 8.01958 PNS24249 1928 1593.55 159.245 5.61535 PNS24246 1044 709.547 101.265 8.01958 PNS24248 1044 709.547 101.265 8.01958 PNS24244 1471 1136.55 147.96 7.31531 PNS24243 293 70.1729 0 0 KQK14069 1603 1268.55 10098.2 447.312 KQK14071 474 187.996 153.569 45.9019 ==> SRR7804225.se.tsv <== BRADI_1g14170v3 11216 BRADI_1g53295v3 2069 BRADI_1g59795v3 693 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 2373 BRADI_1g74790v3 1031 BRADI_1g09890v3 3 BRADI_1g77505v3 263 BRADI_1g48960v3 0 SRR7804225 completed mapping pipeline successfully