Starting /dee2/code/volunteer_pipeline.sh SRR7804226 current disk space = 1540540731392 free memory = 1414595940 SRR7804226 SRAfilesize 324b6208bcca610482dc2a73e68d2439 SRR7804226.sra SRR7804226.sra file validated SRR7804226 is paired end SRR7804226 is conventional basespace SRR7804226 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804226_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1575 37.0 37.0 37.0 37.0 37.0 2 36.209 37.0 37.0 37.0 37.0 37.0 3 36.3125 37.0 37.0 37.0 37.0 37.0 4 36.4245 37.0 37.0 37.0 37.0 37.0 5 36.5645 37.0 37.0 37.0 37.0 37.0 6 36.5345 37.0 37.0 37.0 37.0 37.0 7 36.27 37.0 37.0 37.0 37.0 37.0 8 36.4885 37.0 37.0 37.0 37.0 37.0 9 36.444 37.0 37.0 37.0 37.0 37.0 10-14 36.47130000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.410000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.464999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.391200000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.3589 37.0 37.0 37.0 37.0 37.0 35-39 36.2999 37.0 37.0 37.0 37.0 37.0 40-44 36.285199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.1913 37.0 37.0 37.0 37.0 37.0 50-54 36.2039 37.0 37.0 37.0 37.0 37.0 55-59 36.13700000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.119299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.1452 37.0 37.0 37.0 37.0 37.0 70-74 36.038 37.0 37.0 37.0 37.0 37.0 75-79 36.0222 37.0 37.0 37.0 37.0 37.0 80-84 36.0101 37.0 37.0 37.0 37.0 37.0 85-89 35.97709999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.927 37.0 37.0 37.0 37.0 37.0 95-99 35.8067 37.0 37.0 37.0 37.0 37.0 100-104 35.8218 37.0 37.0 37.0 37.0 37.0 105-109 35.7407 37.0 37.0 37.0 37.0 37.0 110-114 35.7625 37.0 37.0 37.0 37.0 37.0 115-119 35.6183 37.0 37.0 37.0 37.0 37.0 120-124 35.5021 37.0 37.0 37.0 37.0 37.0 125-129 35.5386 37.0 37.0 37.0 37.0 37.0 130-134 35.4011 37.0 37.0 37.0 37.0 37.0 135-139 35.2743 37.0 37.0 37.0 29.8 37.0 140-144 35.28060000000001 37.0 37.0 37.0 29.8 37.0 145-149 35.06410000000001 37.0 37.0 37.0 27.4 37.0 150-151 34.543499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 7.0 26 11.0 27 16.0 28 20.0 29 38.0 30 45.0 31 45.0 32 81.0 33 111.0 34 155.0 35 464.0 36 2777.0 37 227.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.953838434520826 13.748118414450577 8.429503261414952 33.86853988961364 2 23.724999999999998 18.025 37.2 21.05 3 20.05 25.874999999999996 25.525 28.549999999999997 4 27.35 29.4 20.325 22.925 5 26.174999999999997 33.074999999999996 20.95 19.8 6 20.1 33.575 22.825 23.5 7 17.625 21.05 40.275 21.05 8 20.05 19.625 27.950000000000003 32.375 9 21.125 19.1 30.325000000000003 29.45 10-14 23.73 25.385 24.785 26.1 15-19 23.765 25.314999999999998 24.46 26.46 20-24 24.349999999999998 25.005 24.89 25.755 25-29 24.02 25.085 24.555 26.340000000000003 30-34 23.84 24.69 24.92 26.55 35-39 24.025 25.115 24.55 26.31 40-44 24.075 25.424999999999997 24.675 25.825 45-49 24.315 25.035 24.395 26.255 50-54 23.75 24.795 24.605 26.85 55-59 24.38 24.935 24.33 26.355 60-64 23.87 24.905 24.635 26.590000000000003 65-69 23.9 25.41 24.16 26.529999999999998 70-74 24.765 24.545 23.755000000000003 26.935 75-79 24.87 24.310000000000002 24.57 26.25 80-84 24.16 24.73 24.51 26.6 85-89 24.625 24.245 24.490000000000002 26.640000000000004 90-94 25.755 23.56 24.48 26.205000000000002 95-99 24.685000000000002 24.545 24.85 25.919999999999998 100-104 24.93 24.495 24.025 26.55 105-109 24.62 24.395 24.415 26.57 110-114 24.535 23.945 24.709999999999997 26.810000000000002 115-119 25.16 24.12 24.02 26.700000000000003 120-124 25.224999999999998 23.91 24.0 26.865 125-129 25.55 24.165 23.705000000000002 26.58 130-134 25.380000000000003 23.735 24.26 26.625 135-139 24.775 24.715 24.2 26.31 140-144 25.14 23.31 24.145 27.405 145-149 25.7 23.945 23.64 26.715 150-151 25.85 23.4875 24.0125 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 0.5 25 1.5 26 1.5 27 2.5 28 3.5 29 4.0 30 7.5 31 10.5 32 12.0 33 17.5 34 25.0 35 36.5 36 51.0 37 60.5 38 79.5 39 96.5 40 111.5 41 135.5 42 163.5 43 164.0 44 158.5 45 182.5 46 197.5 47 169.0 48 153.0 49 164.5 50 160.0 51 162.0 52 131.5 53 102.5 54 109.5 55 96.5 56 87.0 57 91.5 58 86.5 59 87.0 60 85.5 61 67.0 62 72.0 63 72.5 64 59.0 65 61.0 66 58.5 67 63.5 68 59.5 69 48.0 70 48.5 71 43.5 72 36.5 73 27.5 74 15.5 75 13.0 76 12.5 77 9.5 78 5.5 79 6.5 80 5.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.975 #Duplication Level Percentage of deduplicated Percentage of total 1 96.04063558218286 92.175 2 3.7249283667621778 7.1499999999999995 3 0.23443605105496224 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5249999999999999 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.95 0.0 0.0 0.0 0.0 134-135 1.025 0.0 0.0 0.0 0.0 136-137 1.1375000000000002 0.0 0.0 0.0 0.0 138-139 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7804226 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7804226_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2985 37.0 37.0 37.0 37.0 37.0 2 35.997 37.0 37.0 37.0 37.0 37.0 3 36.0735 37.0 37.0 37.0 37.0 37.0 4 36.2415 37.0 37.0 37.0 37.0 37.0 5 36.267 37.0 37.0 37.0 37.0 37.0 6 36.1725 37.0 37.0 37.0 37.0 37.0 7 36.106 37.0 37.0 37.0 37.0 37.0 8 36.227 37.0 37.0 37.0 37.0 37.0 9 36.265 37.0 37.0 37.0 37.0 37.0 10-14 36.14269999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.112199999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.0354 37.0 37.0 37.0 37.0 37.0 25-29 36.0406 37.0 37.0 37.0 37.0 37.0 30-34 35.990899999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.8862 37.0 37.0 37.0 37.0 37.0 40-44 35.8897 37.0 37.0 37.0 37.0 37.0 45-49 35.8193 37.0 37.0 37.0 37.0 37.0 50-54 35.8295 37.0 37.0 37.0 37.0 37.0 55-59 35.849900000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.7436 37.0 37.0 37.0 37.0 37.0 65-69 35.6603 37.0 37.0 37.0 37.0 37.0 70-74 35.7 37.0 37.0 37.0 37.0 37.0 75-79 35.6486 37.0 37.0 37.0 37.0 37.0 80-84 35.5064 37.0 37.0 37.0 37.0 37.0 85-89 35.4251 37.0 37.0 37.0 34.6 37.0 90-94 35.3882 37.0 37.0 37.0 37.0 37.0 95-99 35.275 37.0 37.0 37.0 34.6 37.0 100-104 35.230000000000004 37.0 37.0 37.0 32.2 37.0 105-109 35.1148 37.0 37.0 37.0 27.4 37.0 110-114 35.0682 37.0 37.0 37.0 25.0 37.0 115-119 34.964999999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.9517 37.0 37.0 37.0 25.0 37.0 125-129 34.8625 37.0 37.0 37.0 25.0 37.0 130-134 34.797000000000004 37.0 37.0 37.0 25.0 37.0 135-139 34.5493 37.0 37.0 37.0 25.0 37.0 140-144 34.3881 37.0 37.0 37.0 25.0 37.0 145-149 34.2915 37.0 37.0 37.0 25.0 37.0 150-151 33.601749999999996 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 3.0 16 2.0 17 2.0 18 3.0 19 1.0 20 2.0 21 6.0 22 7.0 23 11.0 24 9.0 25 11.0 26 11.0 27 19.0 28 22.0 29 34.0 30 34.0 31 64.0 32 94.0 33 140.0 34 305.0 35 820.0 36 2322.0 37 73.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.975 13.750000000000002 10.0 34.275 2 28.625 19.275000000000002 30.225 21.875 3 24.5 22.2 27.05 26.25 4 28.000000000000004 30.725 17.175 24.099999999999998 5 28.050000000000004 32.525 18.275 21.15 6 21.425 34.1 18.05 26.424999999999997 7 22.1 14.7 37.3 25.900000000000002 8 21.675 19.975 22.6 35.75 9 23.7 20.25 24.5 31.55 10-14 26.32 24.735 22.165000000000003 26.779999999999998 15-19 26.39 24.01 23.225 26.375 20-24 26.145000000000003 24.535 23.200000000000003 26.119999999999997 25-29 26.665 24.435000000000002 23.080000000000002 25.82 30-34 26.845000000000002 24.485 22.675 25.995 35-39 26.075 24.505 22.475 26.945000000000004 40-44 26.36 24.395 22.845 26.400000000000002 45-49 26.419999999999998 24.365000000000002 22.68 26.534999999999997 50-54 26.32 24.13 23.145 26.405 55-59 26.57 23.89 23.05 26.490000000000002 60-64 27.51 24.05 22.86 25.580000000000002 65-69 26.965 24.11 23.3 25.624999999999996 70-74 26.5 24.315 23.26 25.924999999999997 75-79 27.21 23.425 22.925 26.44 80-84 26.965 23.905 22.805 26.325 85-89 26.889999999999997 23.955000000000002 23.075000000000003 26.08 90-94 26.41 24.605 22.935 26.05 95-99 27.35 23.89 23.03 25.729999999999997 100-104 27.12 24.485 22.64 25.755 105-109 27.18 24.42 22.89 25.509999999999998 110-114 27.32 24.42 22.285 25.974999999999998 115-119 26.615 24.195 23.669999999999998 25.52 120-124 27.48 24.169999999999998 22.955000000000002 25.395 125-129 27.685 23.78 23.32 25.215 130-134 27.045 24.19 23.205000000000002 25.56 135-139 27.165 24.0 23.189999999999998 25.645 140-144 27.400000000000002 24.34 22.84 25.419999999999998 145-149 27.595 24.865000000000002 22.400000000000002 25.14 150-151 27.712500000000002 24.275 23.125 24.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 1.5 27 2.0 28 3.0 29 3.0 30 8.5 31 10.5 32 11.5 33 11.5 34 11.5 35 21.5 36 33.5 37 47.5 38 57.0 39 68.0 40 81.5 41 95.5 42 107.5 43 133.0 44 154.0 45 152.5 46 154.0 47 167.0 48 166.5 49 144.5 50 141.0 51 135.5 52 127.0 53 122.0 54 111.5 55 106.0 56 95.5 57 89.0 58 103.0 59 108.0 60 95.5 61 95.0 62 105.0 63 96.5 64 89.0 65 86.0 66 75.0 67 65.5 68 63.5 69 72.5 70 70.0 71 63.5 72 53.5 73 39.5 74 36.5 75 31.5 76 23.5 77 18.5 78 9.5 79 4.5 80 4.0 81 3.5 82 2.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.79634464751959 91.725 2 3.9947780678851172 7.6499999999999995 3 0.18276762402088773 0.525 4 0.02610966057441253 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5249999999999999 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0499999999999998 0.0 0.0 0.0 0.0 136-137 1.1625 0.0 0.0 0.0 0.0 138-139 1.2999999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACTC 10 0.006830828 145.0 2 TTCTGCC 10 0.006830828 145.0 4 CCCTCTT 10 0.006830828 145.0 9 GGAAACT 10 0.006830828 145.0 1 >>END_MODULE Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364263 spots for SRR7804226.sra Written 1364263 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra Read 1364256 spots for SRR7804226.sra Written 1364256 spots for SRR7804226.sra SRR ids: ['SRR7804226.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kbvjnvei SRR7804226.sra spots: 27285127 blocks: [[1, 1364256], [1364257, 2728512], [2728513, 4092768], [4092769, 5457024], [5457025, 6821280], [6821281, 8185536], [8185537, 9549792], [9549793, 10914048], [10914049, 12278304], [12278305, 13642560], [13642561, 15006816], [15006817, 16371072], [16371073, 17735328], [17735329, 19099584], [19099585, 20463840], [20463841, 21828096], [21828097, 23192352], [23192353, 24556608], [24556609, 25920864], [25920865, 27285127]] SRR7804226 file size 9224333 SRR7804226 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7804226 SRR7804226_1.fastq SRR7804226_2.fastq Input file: SRR7804226_1.fastq Paired file: SRR7804226_2.fastq trimmed: SRR7804226-trimmed-pair1.fastq, SRR7804226-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 18:31:33 2024 >> started Sat Dec 7 18:32:06 2024 >> done (32.902s) 27285127 read pairs processed; of these: 75 ( 0.00%) short read pairs filtered out after trimming by size control 528 ( 0.00%) empty read pairs filtered out after trimming by size control 27284524 (100.00%) read pairs available; of these: 748466 ( 2.74%) trimmed read pairs available after processing 26536058 (97.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 13 0.00% 20 35 0.00% 21 20 0.00% 22 30 0.00% 23 33 0.00% 24 26 0.00% 25 41 0.00% 26 33 0.00% 27 49 0.00% 28 40 0.00% 29 45 0.00% 30 38 0.00% 31 51 0.00% 32 65 0.00% 33 38 0.00% 34 52 0.00% 35 72 0.00% 36 58 0.00% 37 60 0.00% 38 71 0.00% 39 72 0.00% 40 50 0.00% 41 62 0.00% 42 69 0.00% 43 70 0.00% 44 93 0.00% 45 89 0.00% 46 69 0.00% 47 82 0.00% 48 88 0.00% 49 95 0.00% 50 99 0.00% 51 74 0.00% 52 83 0.00% 53 96 0.00% 54 106 0.00% 55 124 0.00% 56 120 0.00% 57 130 0.00% 58 125 0.00% 59 92 0.00% 60 130 0.00% 61 137 0.00% 62 126 0.00% 63 150 0.00% 64 159 0.00% 65 143 0.00% 66 164 0.00% 67 147 0.00% 68 194 0.00% 69 192 0.00% 70 177 0.00% 71 185 0.00% 72 267 0.00% 73 316 0.00% 74 265 0.00% 75 268 0.00% 76 322 0.00% 77 307 0.00% 78 371 0.00% 79 444 0.00% 80 410 0.00% 81 478 0.00% 82 525 0.00% 83 588 0.00% 84 642 0.00% 85 677 0.00% 86 859 0.00% 87 872 0.00% 88 1022 0.00% 89 1107 0.00% 90 1169 0.00% 91 1324 0.00% 92 1464 0.01% 93 1610 0.01% 94 1799 0.01% 95 1925 0.01% 96 2035 0.01% 97 2365 0.01% 98 2370 0.01% 99 2582 0.01% 100 2804 0.01% 101 3141 0.01% 102 3349 0.01% 103 3723 0.01% 104 3941 0.01% 105 4225 0.02% 106 4534 0.02% 107 4643 0.02% 108 5123 0.02% 109 5288 0.02% 110 5501 0.02% 111 6034 0.02% 112 6436 0.02% 113 7007 0.03% 114 7351 0.03% 115 7891 0.03% 116 8059 0.03% 117 8540 0.03% 118 8808 0.03% 119 9147 0.03% 120 9851 0.04% 121 10175 0.04% 122 10930 0.04% 123 11601 0.04% 124 12050 0.04% 125 12748 0.05% 126 13131 0.05% 127 13750 0.05% 128 13896 0.05% 129 14518 0.05% 130 15112 0.06% 131 15613 0.06% 132 16473 0.06% 133 17551 0.06% 134 18331 0.07% 135 18912 0.07% 136 19518 0.07% 137 20224 0.07% 138 20786 0.08% 139 21780 0.08% 140 21933 0.08% 141 23086 0.08% 142 23809 0.09% 143 24485 0.09% 144 25672 0.09% 145 27055 0.10% 146 27367 0.10% 147 28780 0.11% 148 29464 0.11% 149 30084 0.11% 150 31174 0.11% 151 26536058 97.26% 27284524 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=23 prefix-density=0.71 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=134.14 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=9.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=17 prefix-density=0.57 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.93 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7804226 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 18:33:20 Started mapping on | Dec 07 18:33:20 Finished on | Dec 07 18:37:53 Mapping speed, Million of reads per hour | 359.80 Number of input reads | 27284524 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 25554784 Uniquely mapped reads % | 93.66% Average mapped length | 299.69 Number of splices: Total | 26433611 Number of splices: Annotated (sjdb) | 24948750 Number of splices: GT/AG | 26072610 Number of splices: GC/AG | 296779 Number of splices: AT/AC | 11059 Number of splices: Non-canonical | 53163 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322926 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 17463 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.56% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1406814 1406814 1406814 N_multimapping 322926 322926 322926 N_noFeature 837344 24781111 1099076 N_ambiguous 632025 4715 120359 UnstrandedReadsAssigned:24085415 PositiveStrandReadsAssigned:768958 NegativeStrandReadsAssigned:24335349 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7804226 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7804226-trimmed-pair1.fastq SRR7804226-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,284,524 reads, 24,536,846 reads pseudoaligned [quant] estimated average fragment length: 329.667 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR7804226.ke.tsv 35125 SRR7804226.se.tsv 88098 total ==> SRR7804226.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 608.586 0 0 PNS24247 1044 715.333 92.3149 6.66765 PNS24249 1928 1599.33 192.3 6.21227 PNS24246 1044 715.333 92.3149 6.66765 PNS24248 1044 715.333 92.3149 6.66765 PNS24244 1471 1142.33 178.755 8.08491 PNS24243 293 73.3782 0 0 KQK14069 1603 1274.33 13212.6 535.693 KQK14071 474 192.478 188.726 50.6596 ==> SRR7804226.se.tsv <== BRADI_1g14170v3 14607 BRADI_1g53295v3 1291 BRADI_1g59795v3 1084 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 493 BRADI_1g74790v3 1210 BRADI_1g09890v3 0 BRADI_1g77505v3 281 BRADI_1g48960v3 0 SRR7804226 completed mapping pipeline successfully